Next Article in Journal
N,N’-alkylated Imidazolium-Derivatives Act as Quorum-Sensing Inhibitors Targeting the Pectobacterium atrosepticum-Induced Symptoms on Potato Tubers
Previous Article in Journal
CD8+ T Cell-Induced Expression of Tissue Inhibitor of Metalloproteinses-1 Exacerbated Osteoarthritis
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Short Note

Eleven Novel Polymorphic Microsatellite Loci for Oval Squid Sepioteuthis Lessoniana (Shiro-Ika Type)

1
Graduate School of Biosphere Science, Hiroshima University, Higashi-Hiroshima, Hiroshima 739-8528, Japan
2
Tokushima Agriculture, Forestry and Fisheries Technology Support Center, Naruto, Tokushima 771-0361, Japan
3
Gifu Prefectural Research Institute for Freshwater Fish and Aquatic Environments, Gero, Gifu 509-2592, Japan
*
Author to whom correspondence should be addressed.
Int. J. Mol. Sci. 2013, 14(10), 19971-19975; https://doi.org/10.3390/ijms141019971
Submission received: 9 August 2013 / Revised: 5 September 2013 / Accepted: 25 September 2013 / Published: 8 October 2013

Abstract

:
The oval squid Sepioteuthis lessoniana is one of the most economically important squid species in Japan; however, its population structure is poorly understood due to the lack of hypervariable markers. Such information is critical for managing sustainable fisheries, as well as for ensuring the existence of wild S. lessoniana stocks. Eleven candidate microsatellite loci were isolated from a small insert genomic DNA library. Polymorphisms in these 11 loci were screened in 24 wild individuals. The number of alleles per locus was found to range from 5 to 19 alleles, and the observed heterozygosity ranged from 0.292 to 0.958. No evidence for linkage disequilibrium was detected among all the loci. The genotypic proportions conformed to Hardy-Weinberg equilibrium, except at one locus. In conclusion, these polymorphic microsatellite loci may be used to develop a genetic framework to manage S. lessoniana in the future.

1. Introduction

The oval squid Sepioteuthis lessoniana, a member of the Loliginidae family, is distributed over a broad geographical range throughout the Indo-Pacific region, including northern Australia, central Japan, and eastward to the Hawaiian Islands [1]. In Japan, oval squids are abundant in inshore waters along the coast of western Japan and are one of the most economically important squid species in neritic fisheries.
Using allozyme markers, Izuka et al. [2] previously concluded that the population structure of S. lessoniana around mainland Japan is homogenous, in agreement with the observations of Aoki et al. [3] based on the sequencing analysis of the non-coding region of mitochondria. However, with the use of allozyme markers, Yokogawa and Ueta [4] also found evidence for differentiation between the Pacific Ocean and the Japan Sea populations. To date, the population structure of S. lessoniana over the primary biogeographic range in Japan remains unclear. A thorough understanding of the appropriate conservation units is a critical first step in addressing the fishery management of S. lessoniana; therefore, there is a need to identify hypervariable microsatellite loci of the species for allowing accurate evaluation of its genetic population structure.
Some researchers have proposed that S. lessoniana in southwest Japan is a species complex consisting of “Aka-ika”, “Shiro-ika”, and “Kuwa-ika” types that exhibit phenotypic and genotypic differences [5]. In the present study, we only evaluated the “Shiro-ika” type. We believe that this study will provide powerful genetic markers not only for studying the genetic structure of the species but also for planning the management of “Shiro-ika” S. lessoniana in the future.

2. Results and Discussion

Twenty-four unrelated individuals were collected from Mugi, Tokushima Prefecture, and the levels of polymorphism with primer sequences and repeat motifs in the 11 microsatellite loci were evaluated (Table 1). The number of alleles per locus ranged from 5 to 19 alleles. The observed heterozygosity ranged from 0.292 to 0.958, whereas the expected heterozygosity ranged from 0.368 to 0.947. Among 11 microsatellite loci, the locus SL-SHIRO 16 deviated significantly (p < 0.045) from Hardy-Weinberg equilibrium after sequential Bonferroni correction, which is probably due to excess of homozygosity. The Micro-checker analysis [6] further reveals that SL-SHIRO 16 may be affected by null alleles. However, there was no indication of allele scoring errors caused by stuttering or large allele dropout. In addition, no evidence for linkage disequilibrium was detected among possible pairwise locus comparisons.

3. Experimental Section

3.1. Development of Microsatellite Markers

To screen candidate microsatellite loci, two individuals were collected by squid jigging at Mugi, Tokushima Prefecture. A small section of the arm tissue was clipped from each specimen and stored in ethanol. DNA was subsequently extracted using the phenol-chloroform method [7], digested with Sau3AI, and directly ligated into the pUC19 vector. Ligated vector fragments were then transformed into competent Escherichia coli JM109 (Takara Bio Inc., Ohtsu, Japan). Positive colonies were detected by chemiluminescence using digoxigenin (Dig)-GT15 hybridization probes and the DIG Nucleic Acid Detection Kit (Boehringer, Mannheim, Germany). A total of 142 positive clones from 2352 colonies were sequenced using the ABI 3130xl Genetic Analyzer (Applied Biosystems, Foster, California, USA). Fifteen locus-specific forward and reverse primers were designed using online software Primer 3 (v. 0.4.0, Whitehead Institute for Biomedical Research, Cambridge, MA, USA) and either the forward or reverse primers were labeled at the 5′ end with FAM, HEX, or NED. Of these 15 primer pairs, only 11 were able to successfully amplify fragments within expected size ranges. Consequently, these 11 loci were characterized and deposited in GenBank (accession numbers, Table 1).

3.2. Primer Validation

To characterize microsatellite loci, 24 individuals were collected by a set net at Mugi, Tokushima Prefecture, Japan in 2012. Genomic DNA extracted as described above was subjected to PCR in a final reaction volume of 5 μL, consisting of 0.7 μL of ddH2O, 2.5 μL of KOD Buffer, 1.0 μL of dNTP, 0.1 μL of each of forward and reverse primers (10 mM), 0.1 μL of KOD Polymerase (Toyobo Co., Ltd., Osaka, Japan), and 0.5 μL of the DNA template. PCR was performed in a Mastercycler Gradient 96-Well system (Eppendorf, Hamburg, Germany) with the following amplification cycle: an initial denaturing step at 94 °C for 4 min; 30 cycles of 94 °C for 1 min, locus-specific annealing temperatures (Table 1) for 1 min, and 72 °C for 1 min; and a final extension step at 72 °C for 10 min. Next, PCR products (1 μL) were mixed with 8.8 μL of HiDi and 0.2 μL of 400HD ROX Size Standard and then sequenced using an ABI 3130xl Sequencer. Allele sizes and the number of alleles were estimated using Peak Scanner software v1.0 (Applied Biosystems) and FSTAT 2.9.3 [8], respectively. Each locus was tested for null alleles using Micro-Checker v. 2.2.3 [6]. Observed heterozygosity and expected heterozygosity were calculated using Arlequin v3.11 [9]. Other relevant parameters, including Hardy-Weinberg equilibrium and genotypic disequilibrium between pairs of loci within the population, were estimated using Genepop’007 [10].

4. Conclusions

The use of hypervariable microsatellite loci described in this study rendered good results when a single population was tested, suggesting that all the loci may be used for assessing the genetic diversity and the population structure of wild S. lessoniana, especially between the Japan Sea and Pacific Ocean. We believe that this study can not only lay a cornerstone for the investigation of accurate information regarding the stock structure and the recruitment source for managing sustainable S. lessoniana but also facilitate taxonomic studies of sympatric species in the future.
Table 1. Characterization of 11 microsatellite loci for the oval squid Sepioteuthis lessoniana.
Table 1. Characterization of 11 microsatellite loci for the oval squid Sepioteuthis lessoniana.
LocusRepeatPrimer sequence (5′–3′)TA (°C)Expected Size (bp)NAAllele Range (bp)HOHEGenBank Accession No.
SL-SHIRO 5(CA)4CG(CA)5(CG)3(CGCA)3F: ACGACCTCGTCAAAAGCACT
R: NED-GCTCGTCACGACTCTTGAAA
621975181–1970.3330.368AB821297
SL-SHIRO 8(GT)28F: CCAACTCCGAATAAAAGCAG
R: HEX-CTGTCACATCCGTGAAATGG
6217816159–1930.8750.939AB821298
SL-SHIRO 10(CA)4TA(CA)11F: FAM-ACAAAACGAAGGAGGGAGGT
R: CATCCCACCTATTTCACAGTATCA
622145203–2330.6670.573AB821299
SL-SHIRO 15(GT)26AAGAAAGAGTA(GA)7F: TTCCGCAAATTTTATGTAGCA
R: HEX-TTCAGTCGAAATGAGGTAGCAG
5421519189–2350.9580.947AB821300
SL-SHIRO 16(GTGTGA)2(GT)30F: AAACCCGCCTGACTTCAGTT
R: HEX-GGGACTCTTCCGTGACACAT
6220515170–2100.2920.937AB821301
SL-SHIRO 20(TA)11F: NED-CGAGTCGAGCCACACTGAAG
R: TTCGGTCACCCTCGAATAAG
621065102–1120.6670.624AB821302
SL-SHIRO 22(TA)13F: TCACGAGTCTTGCCTCACTG
R: HEX-CCTATGTGACCGGTTTTGTTG
621755167–1750.6250.602AB821303
SL-SHIRO 23(CTTT)13F: HEX-TCCTCTCTGCCACTTCCTTC
R: GACAAAATGAGAGGGATACGTG
621868167–1950.9170.872AB821304
SL-SHIRO 27(TATG)(TATC)30F: NED-GACAAGAGGTTTATTGGCATTGA
R: ACCAACTCAAATAGTGTGCGTA
5411213101–1610.7500.861AB821305
SL-SHIRO 29(GAAA)13F: FAM-CTGGTGGAGGTGGGTGTTAC
R: GGGTGCCTATCTGATTGCAG
5421610201–2330.8750.863AB821306
SL-SHIRO 30(CA)12F: TGTGTAGAAATTGTCCAAACGTC
R: FAM-CAAGACACCAAGGTTTTATGGA
541158109–1290.7080.800AB821307
TA, annealing temperature; NA, number of alleles; HO, observed heterozygosity; HE, Nei’s expected heterozygosity. * p < 0.045, significant departure from Hardy-Weinberg expectation after sequential Bonferroni correction.

Acknowledgments

We would like to thank Hikosaka Tomoe for her cooperation and assistance in sequencing using the ABI 3130xl Sequencer at the Gene Science Division, Natural Science Centre for Basic Research and Development, Hiroshima University.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Roper, C.F.E.; Sweeney, M.J.; Nauen, C.E. Cephalopods of the World. An Annotated and Illustrated Catalogue of Species of Interest to Fisheries, FAO Fisheries Synopsis, Rome, Italy, 1984; 3, pp. 109–111.
  2. Izuka, T.; Segawa, S.; Okutani, T. Biochemical study of the population heterogeneity and distribution of the oval squid Sepioteuthis lessoniana complex in southwestern Japan. Am. Malac. B 1996, 12, 129–135. [Google Scholar]
  3. Aoki, M.; Imai, H.; Naruse, T.; Ikeda, Y. Low genetic diversity of oval squid, Sepioteuthis cf. lessoniana (Cephalopoda: Loliginidea), in Japanese waters inferred from a mitochondrial DNA non-coding region. Pac. Sci 2008, 62, 403–411. [Google Scholar]
  4. Yokogawa, K.; Ueta, Y. Genetic analysis of oval squid (Sepioteuthis lessoniana) around Japan. Venus 2000, 59, 45–55. [Google Scholar]
  5. Imai, H.; Aoki, M. Genetic Diversity and Genetic Heterogeneity of Bigfin Reef Squid “Sepioteuthis lessoniana” Species Complex in Northwestern Pacific Ocean. In Analysis of Genetic Variation in Animals; Caliskan, M., Ed.; InTech: Rijeka, Croatia, 2012; pp. 151–166. [Google Scholar]
  6. Van Oosterhout, C.; Hutchinson, W.F.; Wills, D.P.M.; Shipley, P. Micro-Checker: Software for identifying and correcting genotyping errors in microsatellite data. Mol. Ecol. Notes 2004, 4, 535–538. [Google Scholar]
  7. Sambrook, J.; Fritsch, E.F.; Maniatis, T. Molecular Cloning: A Laboratory Manual; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, New York, NY, USA, 1989. [Google Scholar]
  8. Goudet, J. FSTAT (version 1.2): A computer program to calculate F-statistics. J. Hered 1995, 86, 485–486. [Google Scholar]
  9. Excoffier, L.; Laval, G.; Schneider, S. Arlequin (version 3.0): An integrated software package for population genetics data analysis. Evol. Bioinform. Online 2005, 1, 47–50. [Google Scholar]
  10. Rousset, F. Genepop’007: A complete reimplementation of the Genepop software for Windows and Linux. Mol. Ecol. Resour 2008, 8, 103–106. [Google Scholar]

Share and Cite

MDPI and ACS Style

Tomano, S.; Ahmad-Syazni, K.; Ueta, Y.; Ohara, K.; Umino, T. Eleven Novel Polymorphic Microsatellite Loci for Oval Squid Sepioteuthis Lessoniana (Shiro-Ika Type). Int. J. Mol. Sci. 2013, 14, 19971-19975. https://doi.org/10.3390/ijms141019971

AMA Style

Tomano S, Ahmad-Syazni K, Ueta Y, Ohara K, Umino T. Eleven Novel Polymorphic Microsatellite Loci for Oval Squid Sepioteuthis Lessoniana (Shiro-Ika Type). International Journal of Molecular Sciences. 2013; 14(10):19971-19975. https://doi.org/10.3390/ijms141019971

Chicago/Turabian Style

Tomano, Satoshi, Kamarudin Ahmad-Syazni, Yukio Ueta, Kenichi Ohara, and Tetsuya Umino. 2013. "Eleven Novel Polymorphic Microsatellite Loci for Oval Squid Sepioteuthis Lessoniana (Shiro-Ika Type)" International Journal of Molecular Sciences 14, no. 10: 19971-19975. https://doi.org/10.3390/ijms141019971

APA Style

Tomano, S., Ahmad-Syazni, K., Ueta, Y., Ohara, K., & Umino, T. (2013). Eleven Novel Polymorphic Microsatellite Loci for Oval Squid Sepioteuthis Lessoniana (Shiro-Ika Type). International Journal of Molecular Sciences, 14(10), 19971-19975. https://doi.org/10.3390/ijms141019971

Article Metrics

Back to TopTop