Development of Novel Microsatellite Markers in the Omei Treefrog (Rhacophorus omeimontis)
Abstract
:1. Introduction
2. Results and Discussion
3. Experimental Section
4. Conclusions
Acknowledgements
References
- Zhao, E.M.; Adler, K. Herpetology of China; Society for the Study of Amphibians and Reptiles: Oxford, UK, 1993. [Google Scholar]
- Fei, L.; Ye, C.Y. The Colour Handbook of Amphibians of Sichuan; China Forestry Publishing House: Beijing, China, 2001. [Google Scholar]
- Liao, W.B.; Lu, X. Breeding behaviour of the Omei tree frog Rhacophorus omeimontis (Anura: Rachophoridae) in a subtropical montane region. J. Nat. Hist 2010, 44, 47–48. [Google Scholar]
- Andersson, M.; Simmons, L.W. Sexual selection and mate choice. Trend. Ecol. Evol 2006, 21, 296–302. [Google Scholar]
- Avise, J.C.; Jones, A.G.; Walker, D.; DeWoody, J.A. Genetic mating systems and reproductive natural histories of fishes: Lessons for ecology and evolution. Annu. Rev. Genet 2002, 36, 19–45. [Google Scholar]
- Blouin, M.S. DNA-based methods for pedigree reconstruction and kinship analysis in natural populations. Trends Ecol. Evol 2003, 18, 503–511. [Google Scholar]
- Zane, L.; Bargelloni, L.; Patarnello, T. Strategies for microsatellite isolation: A review. Mol. Ecol 2002, 11, 1–16. [Google Scholar]
- Rozen, S.; Skaletsky, H.J. Primer3 on the WWW for General Users and for Biologist Programmers. In Bioinformatics Methods and Protocols: Methods in Molecular Biology; Humana Press: Totowa, NJ, USA, 2000; pp. 365–386. [Google Scholar]
- Excoffier, L.; Lischer, H.E.L. Arlequin suite ver 3.5: A new series of programs to perform population genetics analyses under Linux and Windows. Mol. Ecol. Resour 2010, 10, 564–567. [Google Scholar]
- Rousset, F. GENEPOP′007: A complete re-implementation of the GENEPOP software for Windows and Linux. Mol. Ecol. Resour 2008, 8, 103–106. [Google Scholar]
- Rice, W.R. Analysing tables of statistical tests. Evolution 1989, 43, 223–225. [Google Scholar]
- van Oosterhout, C.; Hutchinson, W.F.; Wills, D.P.M.; Shipley, P. Micro-Checker: Software for identifying and correcting genotyping errors in microsatellite data. Mol. Ecol. Notes 2004, 4, 535–538. [Google Scholar]
- Slate, J.; Marshall, T.C.; Pemberton, J.M. A retrospective assessment of the accuracy of the paternity inference program CERVUS. Mol. Ecol 2000, 9, 801–808. [Google Scholar]
Locus | Primer sequence (5′-3′) (F, forward; R, reverse) | Repeat motif | Labelling dye | Ta (°C) | A | Size range (bp) | HO | HE | GenBank Accession no. |
---|---|---|---|---|---|---|---|---|---|
OMTF1 | F:CAGGGTGACATCATAGACAA R:CTTCCAGCCACTAACAGAGC | (TG)13 | FAM | 60 | 5 | 220–236 | 0.542 | 0.631 | JQ031742 |
OMTF2 | F: CCAAGCGATGTCCCAATC R: CTCCGTGTCCACCCTGAA | (CA)32 | TAMRE | 62 | 14 | 199–255 | 0.458 | 0.914 | JQ031743 |
OMTF3 | F:AAAACACTATCATATCACCATC R: AAAATCTCCAAAAGGCAT | (AGAT)3 GCAT(AGAT)4 | FAM | 54 | 7 | 108–128 | 0.583 | 0.642 | JQ031744 |
OMTF4 | F: GCTGGGCTGATCCTACTCTT R: TTTGCTCTGGTACGCCTATT | (AGAT)16 | TAMRA | 60 | 10 | 243–283 | 0.833 | 0.888 | JQ031745 |
OMTF5 | F: ATTCAGCCATTCAGGAGAC R: CTGGTACGCCTATTAGTTT | (AGAT)16 | HEX | 54 | 10 | 192–232 | 0.839 | 0.902 | JQ031746 |
OMTF6 | F: AGCCATCAGATAGTTCAGG R: AATACTGCCCAAGTCAAAC | (TCTA)18 | FAM | 60 | 11 | 96–160 | 0.791 | 0.852 | JQ031747 |
OMTF7 | F: GTTTGGCTTTCAGTTAGA R: CTGGGAAGTTTGAGTTAGTT | (TCTA)11 | HEX | 53 | 13 | 168–232 | 0.767 | 0.887 | JQ031748 |
OMTF8 | F:GTGGTCAGCCAAGGAAACATAA R:AGCACCCCTAAAATGGTAGGAT | (TCTA)15 | TAMRA | 50 | 4 | 282–294 | 0.250 | 0.562 | JQ031749 |
OMTF9 | F: TGGATGAACGAGTTTGGT R: CTCCATGAGTCCAAGTGC | (AGAT)19 | HEX | 56 | 11 | 168–220 | 0.808 | 0.910 | JQ031750 |
OMTF10 | F: GCCTGGGGCAATGGATAC R: ACAACCACGAGGGAGCAA | (AGAT)15 | TAMRA | 63 | 15 | 204–280 | 0.825 | 0.895 | JQ031751 |
OMTF11 | F: GCCAGGAGCAGAATAATG R: GAGCAAACCCCACTTTGA | (TCTA)10 | FAM | 56 | 12 | 156–216 | 0.833 | 0.898 | JQ031752 |
Locus | PIC | NE-1P | NE-2P | NE-PP | NE-I | NE-SI |
---|---|---|---|---|---|---|
OMTF1 | 0.574 | 0.786 | 0.615 | 0.430 | 0.190 | 0.488 |
OMTF3 | 0.559 | 0.790 | 0.644 | 0.481 | 0.207 | 0.488 |
OMTF4 | 0.859 | 0.405 | 0.252 | 0.092 | 0.028 | 0.322 |
OMTF6 | 0.820 | 0.477 | 0.309 | 0.129 | 0.042 | 0.343 |
OMTF7 | 0.855 | 0.415 | 0.260 | 0.100 | 0.030 | 0.323 |
OMTF9 | 0.883 | 0.348 | 0.211 | 0.067 | 0.020 | 0.309 |
OMTF10 | 0.865 | 0.394 | 0.245 | 0.090 | 0.027 | 0.318 |
OMTF11 | 0.868 | 0.392 | 0.243 | 0.090 | 0.026 | 0.317 |
Combined | 0.785 | 2.68 × 10−3 | 1.01 × 10−4 | 1.30 × 10−7 | 1.96 × 10−11 | 2.66 × 10−4 |
© 2012 by the authors; licensee Molecular Diversity Preservation International, Basel, Switzerland. This article is an open-access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/3.0/).
Share and Cite
Zhao, M.; Zhang, R.; Li, C.; Mu, T.; Wei, S.; Li, X.; Wu, H. Development of Novel Microsatellite Markers in the Omei Treefrog (Rhacophorus omeimontis). Int. J. Mol. Sci. 2012, 13, 552-557. https://doi.org/10.3390/ijms13010552
Zhao M, Zhang R, Li C, Mu T, Wei S, Li X, Wu H. Development of Novel Microsatellite Markers in the Omei Treefrog (Rhacophorus omeimontis). International Journal of Molecular Sciences. 2012; 13(1):552-557. https://doi.org/10.3390/ijms13010552
Chicago/Turabian StyleZhao, Mian, Ruiping Zhang, Chenliang Li, Taiyang Mu, Shichao Wei, Xiong Li, and Hua Wu. 2012. "Development of Novel Microsatellite Markers in the Omei Treefrog (Rhacophorus omeimontis)" International Journal of Molecular Sciences 13, no. 1: 552-557. https://doi.org/10.3390/ijms13010552