Change in Secondary Metabolites and Expression Pattern of Key Rosmarinic Acid Related Genes in Iranian Lemon Balm (Melissa officinalis L.) Ecotypes Using Methyl Jasmonate Treatments
Abstract
:1. Introduction
2. Result and Discussion
2.1. Changes in RA under Various MeJA Concentrations
2.2. Effect of Various Concentrations of MeJA on Total Phenol Content (TPC) and Total Flavonoid Content (TFC)
2.3. Influence of MeJA on Expression MoPAL, Mo4CL, and MoRAS Genes
3. Materials and Methods
3.1. Plant Material and Growth Conditions
3.2. Application of MeJA treatments
3.3. RNA Isolation, Synthesis of cDNA, and q-PCR Analysis
3.4. Rosmarinic Acid (RA) Extraction and HPLC Analysis
3.5. Assay of Total Phenolic and Flavonoid Contents
3.6. Statistical Analysis
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Sample Availability
References
- Petersen, M.; Simmonds, M.S.J. Molecules of interest: Rosmarinic acid. Phytochemistry 2003, 62, 121–125. [Google Scholar] [CrossRef]
- Hamaguchi, T.; Ono, K.; Murase, A.; Yamada, M. Phenolic compounds prevent Alzheimer’s pathology through different effects on the amyloid-beta aggregation pathway. Am. J. Pathol. 2009, 175, 2557–2565. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mazzanti, G.; Battinelli, L.; Pompeo, C.; Serrilli, A.M.; Rossi, R.; Sauzullo, I.; Megoni, F.; Vullo, V. Inhibitory activity of Melissa officinalis L. extracts on Herpes simplex virus type 2 replication. Nat. Prod. Res. 2008, 23, 1433–1440. [Google Scholar] [CrossRef] [PubMed]
- Al-Dhabi, N.A.; Arasu, M.V.; Park, C.H.; Park, S.U. Recent studies on rosmarinic acid and its biological and pharmacological activities. Excli. J. 2014, 13, 1192–1195. [Google Scholar]
- Taha, R.A.; Hassan, M.M.; Ibrahim, E.A.; Abo-Bakr, N.H.; Shaaban, E.A. Carbon nanotubes impact on date palm in vitro cultures. Plant Cell Tissue Organ Cult. 2016, 127, 525–534. [Google Scholar] [CrossRef]
- Petersen, M. Rosmarinic acid: New aspects. Phytochem. Rev. 2013, 12, 207–227. [Google Scholar] [CrossRef]
- Petersen, M.; Abdullah, Y.; Benner, J.; Eberle, D.; Gehlen, K.; Hücherig, S.; Janiak, V.; Kim, K.H.; Sander, M.; Weitzel, C.; et al. Evolution of rosmarinic acid biosynthesis. Phytochemistry 2009, 70, 1663–1679. [Google Scholar] [CrossRef]
- Weitzel, C.; Petersen, M. Cloning and characterization of rosmarinic acid synthase from Melissa officinalis L. Phytochemistry 2011, 72, 572–578. [Google Scholar] [CrossRef]
- Deng, C.; Wang, Y.; Huang, F.; Lu, S.; Zhao, L.; Ma, X.; Kai, G. SmMYB2 promotes salvianolic acid biosynthesis in the medicinal herb Salvia miltiorrhiza. J. Integr. Plant. Biol. 2020, 62, 1688–1702. [Google Scholar] [CrossRef]
- Zhang, S.; Li, H.; Liang, X.; Yan, Y.; Xia, P.; Jia, Y.; Liang, Z. Enhanced production of phenolic acids in Salvia miltiorrhiza hairy root cultures by combing the RNAi-mediated silencing of chalcone synthase gene with salicylic acid treatment. Biochem. Eng. J. 2015, 103, 185–192. [Google Scholar] [CrossRef]
- Fu, R.; Shi, M.; Deng, C.; Zhang, Y.; Zhang, X.; Wang, Y.; Kai, G. Improved phenolic acid content and bioactivities of Salvia miltiorrhiza hairy roots by genetic manipulation of RAS and CYP98A14. Food Chem. 2020, 331, 127365. [Google Scholar] [CrossRef] [PubMed]
- Guerriero, G.; Berni, R.; Muñoz-Sanchez, J.A.; Apone, F.; Abdel-Salam, E.M.; Qahtan, A.A.; Alatar, A.A.; Cantini, C.; Cai, G.; Hausman, J.-F.; et al. Production of plant secondary metabolites: Examples, tips and suggestions for biotechnologists. Genes 2018, 9, 309. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Naik, P.M.; Al–Khayri, J.M. Abiotic and Biotic Elicitors- Role in Secondary Metabolites Production Through In Vitro Culture of Medicinal Plants. In Abiotic and Biotic Stress in Plants-Recent Advances and Future Perspectives; Shanker, A.K., Shanker, C., Eds.; InTech: Rijeka, Croatia, 2016; pp. 247–278. [Google Scholar]
- Gonçalves, S.; Romano, A. Production of plant secondary metabolites by using biotechnological tools. In Secondary Metabolites: Sources and Applications; Vijayakumar, R., Raja, S.S.S., Eds.; InTech: Rijeka, Croatia, 2018. [Google Scholar]
- Sircar, D.; Cardoso, H.G.; Mukherjee, C.; Mitra, A.; Arnholdt-Schmitt, B. Alternative oxidase (AOX) and phenolic metabolism in methyl jasmonate-treated hairy root cultures of Daucus carota L. J. Plant Physiol. 2012, 169, 657–663. [Google Scholar] [CrossRef] [PubMed]
- Narayani, M.; Srivastava, S. Elicitation: A stimulation of stress in in vitro plant cell/tissue cultures for enhancement of secondary metabolite production. Phytochem. Rev. 2017, 16, 1227–1252. [Google Scholar] [CrossRef]
- Gai, Q.; Jiao, J.; Wang, X.; Zang, Y.; Niu, L.; Fu, Y. Elicitation of Isatis tinctoria L. hairy root cultures by salicylic acid and methyl jasmonate for the enhanced production of pharmacologically active alkaloids and flavonoids. Plant Cell Tissue Organ Cult. 2019, 137, 77–86. [Google Scholar] [CrossRef]
- Xing, B.; Yang, D.; Liu, L.; Han, R.; Sun, Y.; Liang, Z. Phenolic acid production is more effectively enhanced than tanshinone production by methyl jasmonate in Salvia miltiorrhiza hairy roots. Plant Cell Tissue Organ Cult. 2018, 134, 119–129. [Google Scholar] [CrossRef]
- Fatemi, F.; Abdollahi, M.R.; Mirzaie-asl, A.; Dastan, D.; Garagounis, C.; Papadopoulou, K. Identification and expression profiling of rosmarinic acid biosynthetic genes from Satureja khuzistanica under carbon nanotubes and methyl jasmonate elicitation. Plant Cell Tissue Organ Cult. 2019, 136, 561–573. [Google Scholar] [CrossRef]
- Kianersi, F.; Abdollahi, M.R.; Mirzaie-asl, A.; Dastan, D.; Rasheed, F. Identification and tissue-specific expression of rutin biosynthetic pathway genes in Capparis spinosa elicited with salicylic acid and methyl jasmonate. Sci. Rep. 2020, 10, 8884. [Google Scholar] [CrossRef]
- Kianersi, F.; Abdollahi, M.R.; Mirzaie-asl, A.; Dastan, D.; Rasheed, F. Biosynthesis of rutin changes in Capparis spinosa due to altered expression of its pathway genes under elicitors’ supplementation. Plant Cell Tissue Organ Cult. 2020, 141, 619–631. [Google Scholar] [CrossRef]
- Kianersi, F.; PourAboughadareh, A.; Majdi, M.; Poczai, P. Effect of Methyl Jasmonate on Thymol, Carvacrol, Phytochemical Accumulation, and Expression of Key Genes Involved in Thymol/Carvacrol Biosynthetic Pathway in Some Iranian Thyme Species. Int. J. Mol. Sci. 2021, 22, 11124. [Google Scholar] [CrossRef]
- Zhang, S.; Yan, Y.; Wang, B.; Liang, Z.; Liu, Y.; Liu, F.; Qi, Z. Selective responses of enzymes in the two parallel pathways of rosmarinic acid biosynthetic pathway to elicitors in Salvia miltiorrhiza hairy root cultures. J. Biosci Bioeng. 2014, 117, 645–651. [Google Scholar] [CrossRef] [PubMed]
- Yousefian, S.; Lohrasebi, T.; Farhadpour, M.; Haghbeen, K. Effect of methyl jasmonate on phenolic acids accumulation and the expression profile of their biosynthesis-related genes in Mentha spicata hairy root cultures. Plant Cell Tissue Organ Cult. 2020, 142, 285–297. [Google Scholar] [CrossRef]
- Kim, Y.B.; Kim, J.K.; Uddin, M.R.; Xu, H.; Park, W.T.; Tuan, P.A.; Li, X.; Chung, E.S.; Lee, J.-H.; Park, S.U. Metabolomics analysis and biosynthesis of rosmarinic acid in Agastache rugosa Kuntze treated with methyl jasmonate. PLoS ONE 2013, 8, e64199. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fatemi, F.; Abdollahi, M.R.; Mirzaie-Asl, A.; Dastan, D.; Papadopoulou, K. Phytochemical, antioxidant, enzyme activity and antifungal properties of Satureja khuzistanica in vitro and in vivo explants stimulated by some chemical elicitors. Pharm Biol. 2020, 58, 286–296. [Google Scholar] [CrossRef] [Green Version]
- Ruan, J.; Zhou, Y.; Zhou, M.; Yan, J.; Khurshid, M.; Weng, W.; Cheng, J.; Zhang, K. Jasmonic acid signaling pathway in plants. Int. J. Mol. Sci. 2019, 20, 2479. [Google Scholar] [CrossRef] [Green Version]
- Xiao, Y.; Gao, S.; Di, P.; Chen, J.; Chen, W.; Zhang, L. Methyl jasmonate dramatically enhances the accumulation of phenolic acids in Salvia miltiorrhiza hairy root cultures. Physiol. Plant. 2009, 137, 1–9. [Google Scholar] [CrossRef]
- Park, W.T.; Arasu, M.V.; Al-Dhabi, N.A.; Yeo, S.K.; Jeon, J.; Park, J.S.; Lee, S.Y.; Park, S.U. Yeast extract and silver nitrate induce the expression of phenylpropanoid biosynthetic genes and induce the accumulation of rosmarinic acid in agastache rugosa cell culture. Molecules 2016, 21, 426. [Google Scholar] [CrossRef]
- Kintzios, S.; Makri, O.; Panagiotopoulos, E.; Scapeti, M. In vitro rosmarinic acid accumulation in sweet basil (Ocimum basilicum L.). Biotechnol. Lett. 2003, 25, 405–408. [Google Scholar] [CrossRef]
- Mizukami, H.; Tabira, Y.; Ellis, B.E. Methyl jasmonate-induced rosmarinic acid biosynthesis in Lithospermum erythrorhizon cell suspension cultures. Plant. Cell. Rep. 1993, 12, 706–709. [Google Scholar] [CrossRef]
- Guan, Y.; Hu, W.; Jiang, A.; Xu, Y.; Sa, R.; Feng, K.; Zhao, M.; Yu, J.; Ji, Y.; Hou, M.; et al. Effect of Methyl Jasmonate on Phenolic Accumulation in Wounded Broccoli. Molecules 2019, 24, 3537. [Google Scholar] [CrossRef] [Green Version]
- Yamamoto, R.; Ma, G.; Zhang, L.; Hirai, M.; Yahata, M.; Yamawaki, K.; Shimada, T.; Fujii, H.; Endo, T.; Kato, M. Effects of Salicylic Acid and Methyl Jasmonate Treatments on Flavonoid and Carotenoid Accumulation in the Juice Sacs of Satsuma Mandarin In Vitro. Appl Sci. 2020, 10, 8916. [Google Scholar] [CrossRef]
- Salami, M.; Rahimmalek, M.; Ehtemam, M.H. Inhibitory effect of different fennel (Foeniculum vulgare) samples and their phenolic compounds on formation of advanced glycation products and comparison of antimicrobial and antioxidant activities. Food Chem. 2016, 213, 196–205. [Google Scholar] [CrossRef] [PubMed]
- Roby, M.H.H.; Sarhana, M.A.; Selima, K.A.; Khalela, K.I. Antioxidant and Antimicrobial Activities of Essential Oil and Extracts of Fennel (Foeniculum vulgare L.) and Chamomile (Matricaria chamomilla L.). Ind. Crop Prod. 2013, 44, 437–445. [Google Scholar] [CrossRef]
- Kim, H.J.; Chen, F.; Wang, X.; Choi, J.H. Effect of methyl jasmonate on phenolics, isothiocyanate, and metabolic enzymes in radish sprout (Raphanus sativus L.). J. Agr. Food. Chem. 2006, 54, 7263–7269. [Google Scholar] [CrossRef] [PubMed]
- Kim, H.J.; Chen, F.; Wang, X.; Rajapakse, N.C. Effect of methyl jasmonate on secondary metabolites of sweet basil (Ocimum basilicum L.). J. Agric. Food. Chem. 2006, 54, 2327–2332. [Google Scholar] [CrossRef]
- Kim, H.J.; Park, K.J.; Lim, J.H. Metabolomic analysis of phenolic compounds in buckwheat (Fagopyrum esculentum M.) sprouts treated with methyl jasmonate. J. Agric. Food. Chem. 2011, 59, 5707–5713. [Google Scholar] [CrossRef]
- Awasthi, P.; Mahajan, V.; Jamwal, V.L.; Chouhan, R.; Kapoor, N.; Bedi, Y.S.; Gandhi, S.G. Characterization of the gene encoding 4-coumarate: CoA ligase in Coleus forskohlii. J. Plant. Biochem. Biot. 2019, 28, 203–210. [Google Scholar] [CrossRef]
- Deng, Y.; Li, C.; Li, H.; Lu, S.; Iriti, M. Identification and characterization of flavonoid biosynthetic enzyme genes in Salvia miltiorrhiza (Lamiaceae). Molecules 2018, 23, 1467. [Google Scholar] [CrossRef] [Green Version]
- Park, C.H.; Yeo, H.J.; Park, Y.E.; Chun, S.W.; Chung, Y.S.; Lee, S.Y.; Park, S.U. Influence of Chitosan, Salicylic Acid and Jasmonic Acid on Phenylpropanoid Accumulation in Germinated Buckwheat (Fagopyrum esculentum Moench). Foods 2019, 8, 153. [Google Scholar] [CrossRef] [Green Version]
- Abdollahi, M.R.; Kianersi, F.; Moosavi, S.S.; Dastan, D.; Asadi, S. Identification and Expression Analysis of Two Genes Involved in the Biosynthesis of t-Anethole in Fennel (Foeniculum vulgare Mill.) and Their Up-Regulation in Leaves in Response to Methyl Jasmonate Treatments. J. Plant Growth Regul 2022, 1–12. [Google Scholar] [CrossRef]
- Jaafar, H.Z.; Ibrahim, M.H.; Mohamad- Fakri, N.F. Impact of soil field water capacity on secondary metabolites, phenylalanine ammonia-lyase (PAL), maliondialdehyde (MDA) and photosynthetic responses of Malaysian Kacip Fatimah (Labisia pumila Benth). Molecules 2012, 17, 7305–7322. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhou, P.; Li, Q.; Liu, G.; Xu, N.; Yang, Y.; Zeng, W.; Chen, A.; Wang, S. Integrated analysis of transcriptomic and metabolomic data reveals critical metabolic pathways involved in polyphenol biosynthesis in Nicotiana tabacum under chilling stress. Funct. Plant Biol. 2018, 46, 30–43. [Google Scholar] [CrossRef] [PubMed]
- Gharibi, S.; Sayed Tabatabaei, B.E.; Saeidi, G.; Talebi, M.; Matkowski, A. The effect of drought stress on polyphenolic compounds and expression of flavonoid biosynthesis related genes in Achillea pachycephala Rech.f. Phytochemistry 2019, 162, 90–98. [Google Scholar] [CrossRef]
- Majdi, M.; Abdollahi, M.R.; Maroufi, A. Parthenolide accumulation and expression of genes related to parthenolide biosynthesis affected by exogenous application of methyl jasmonate and salicylic acid in Tanacetum parthenium. Plant. Cell. Rep. 2015, 34, 1909–1918. [Google Scholar] [CrossRef]
- Elyasi, R.; Majdi, M.; Bahramnejad, B.; Mirzaghaderi, G. Spatial modulation and abiotic elicitors responses of the biosynthesis related genes of mono/triterpenes in black cumin (Nigella sativa). Ind. Crops Prod. 2016, 79, 240–247. [Google Scholar] [CrossRef]
- Brouki Milan, E.; Mandoulakani, B.A.; Kheradmand, F. The effect of methyl jasmonate on the expression of phenylalanine ammonia lyase and eugenol-o-methyl transferase genes in basil. Philipp. Agric. Sci. 2017, 100, 163–167. [Google Scholar]
- Chezem, W.R.; Clay, N.K. Regulation of plant secondary metabolism and associated specialized cell development by MYBs and bHLHs. Phytochemistry 2016, 131, 26–43. [Google Scholar] [CrossRef] [Green Version]
- Açıkgoz, M. Establishment of cell suspension cultures of Ocimum basilicum L. and enhanced production of pharmaceutical active ingredients. Ind. Crops Prod. 2020, 148, e112278. [Google Scholar] [CrossRef]
- Li, X.; Kim, J.K.; Park, S.U. Molecular cloning and characterization of rosmarinic acid biosynthetic genes and rosmarinic acid accumulation in Ocimum basilicum L. Saudi. J. Biol. Sci. 2017, 26, 469–472. [Google Scholar]
- Thiyagarajan, K.; Vitali, F.; Tolaini, V.; Galeffi, P.; Cantale, C.; Vikram, P.; Singh, S.; De Rossi, P.; Nobili, C.; Procacci, S.; et al. Genomic characterization of phenylalanine ammonia lyase gene in buckwheat. PLoS ONE 2016, 11, 151187. [Google Scholar] [CrossRef] [Green Version]
- Hao, X.; Pu, Z.; Cao, G.; You, D.; Zhou, Y.; Deng, C.; Shi, M.; Nile, S.H.; Wang, Y.; Zhou, W.; et al. Tanshinone and salvianolic acid biosynthesis are regulated bySmMYB98 in Salvia miltiorrhiza hairy roots. J. Adv. Res. 2020, 23, 1–12. [Google Scholar] [CrossRef] [PubMed]
- Huang, J.; Gu, M.; Lai, Z.; Fan, B.; Shi, K.; Zhou, Y.H.; Yu, J.Q.; Chen, Z. Functional analysis of the Arabidopsis PAL gene family in plant growth, development, and response to environmental stress. Plant Physiol. 2010, 153, 1526–1538. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cocetta, G.; Rossoni, M.; Gardana, C.; Mignani, I.; Ferrante, A.; Spinardi, A. Methyl jasmonate affects phenolic metabolism and gene expression in blueberry (Vaccinium corymbosum). Physiol. Plant. 2015, 153, 269–283. [Google Scholar] [CrossRef] [PubMed]
- Biswas, T. Elicitor induced increased rosmarinic acid content of in vitro root cultures of Ocimum basilicum L. (Sweet Basil). Plant Sci Tod. 2020, 7, 157–163. [Google Scholar] [CrossRef]
- Sarabandi, M.; Farokhzad, A.; Mandoulakani, B.A.; Ghasemzadeh, R. Biochemical and gene expression responses of two Iranian grape cultivars to foliar application of methyl jasmonate under boron toxicity conditions. Sci. Hort. 2019, 249, 355–363. [Google Scholar] [CrossRef]
- Belhadj, A.; Saigne, C.; Telef, N.; Cluzet, S.; Bouscaut, J.; Corio-Costet, M.F.; Mérillon, J.M. Methyl jasmonate induces defense responses in grapevine and triggers protection against Erysiphe necator. J. Agric. Food Chem. 2006, 54, 9119–9125. [Google Scholar] [CrossRef] [PubMed]
- Farooq, M.A.; Gill, R.A.; Islam, F.; Ali, B.; Liu, H.; Xu, J.; He, S.; Zhou, W. Methyl jasmonate regulates antioxidant defense and suppresses arsenic uptake in Brassica napus L. Front. Plant Sci. 2016, 7, 468. [Google Scholar] [CrossRef] [Green Version]
- Döring, A.S.; Pellegrini, E.; Della- Bartola, M.; Nali, C.; Lorenzini, G.; Petersen, M. How do background ozone concentrations affect the biosynthesis of rosmarinic acid in Melissa officinalis. J. Plant Physiol. 2014, 171, 35–41. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔct method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Wang, H. Determination of rosmarinic acid and caffeic acid in aromatic herbs by HPLC. Food Chem. 2004, 87, 307–311. [Google Scholar] [CrossRef]
- Zhang, D.Y.; Yao, X.H.; Duan, M.H.; Wei, F.Y.; Wu, G.H.; Li, L. Variation of essential oil content and antioxidant activity of Lonicera species in different sites of China. Ind. Crops Prod. 2015, 77, 772–779. [Google Scholar] [CrossRef]
Real-Time Primers | Sequences (5ʹ to 3ʹ) |
---|---|
PAL F PAL R | CCGAAGTCATGAACGGAAAGC CGCAGCCTTAACATAACCGCTC |
4CL F 4CL R | AGACGATCATGCTCTTGCTCCC GGCCTTGGCTTGCTTGATTACC |
RAS F RAS R | ACGCCCCGACCTCAACCTTATC AAGTGGTGCTCGTTTGCCACG |
β-Actin β-Actin | TGTATGTTGCCATCCAGGCCG AGCATGGGGAAGCGCATAACC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kianersi, F.; Amin Azarm, D.; Pour-Aboughadareh, A.; Poczai, P. Change in Secondary Metabolites and Expression Pattern of Key Rosmarinic Acid Related Genes in Iranian Lemon Balm (Melissa officinalis L.) Ecotypes Using Methyl Jasmonate Treatments. Molecules 2022, 27, 1715. https://doi.org/10.3390/molecules27051715
Kianersi F, Amin Azarm D, Pour-Aboughadareh A, Poczai P. Change in Secondary Metabolites and Expression Pattern of Key Rosmarinic Acid Related Genes in Iranian Lemon Balm (Melissa officinalis L.) Ecotypes Using Methyl Jasmonate Treatments. Molecules. 2022; 27(5):1715. https://doi.org/10.3390/molecules27051715
Chicago/Turabian StyleKianersi, Farzad, Davood Amin Azarm, Alireza Pour-Aboughadareh, and Peter Poczai. 2022. "Change in Secondary Metabolites and Expression Pattern of Key Rosmarinic Acid Related Genes in Iranian Lemon Balm (Melissa officinalis L.) Ecotypes Using Methyl Jasmonate Treatments" Molecules 27, no. 5: 1715. https://doi.org/10.3390/molecules27051715
APA StyleKianersi, F., Amin Azarm, D., Pour-Aboughadareh, A., & Poczai, P. (2022). Change in Secondary Metabolites and Expression Pattern of Key Rosmarinic Acid Related Genes in Iranian Lemon Balm (Melissa officinalis L.) Ecotypes Using Methyl Jasmonate Treatments. Molecules, 27(5), 1715. https://doi.org/10.3390/molecules27051715