Search Results (135)

Osteosarcopenia, defined as the coexistence of low bone mass and sarcopenia, is a multifactorial condition influenced by molecular crosstalk between bone and muscle. Growing evidence suggests that this interaction contributes to disease progression and highlights the need for integrated diagnostic and therapeutic approaches. Artificial intelligence (AI) is emerging as an important tool for the clinical management of osteosarcopenia, with potential applications in risk prediction, early diagnosis, evaluation of adverse outcomes such as fractures and falls, imaging analysis, and personalized treatment planning through machine learning and deep learning algorithms or with the support of large language models. This narrative review summarizes current evidence on the pathophysiological mechanisms underlying osteosarcopenia, with particular emphasis on the molecular mediators involved, and examines the current and potential applications of AI in its clinical assessment and management. By integrating advances in musculoskeletal biology with AI-driven approaches, this review highlights emerging opportunities to improve early detection, optimize clinical decision-making, and support the development of precision medicine strategies for patients with osteosarcopenia. Full article

Background: Physical activity is widely recommended for preserving musculoskeletal health and managing osteoarthritis-related pain, although its benefits are commonly framed in terms of muscle strengthening, weight control, and physical performance. This narrative review aimed to examine movement more broadly as a physiological regulator of synovial joint homeostasis, sensory calibration, and functional adaptation. Methods: A structured literature search was performed in PubMed/MEDLINE, Scopus, and Web of Science from database inception to 1 February 2026. Experimental studies, observational studies, clinical trials, systematic reviews, meta-analyses, and selected narrative reviews addressing movement-responsive joint biology or pain regulation were considered. Evidence was synthesized across four interrelated domains: mechanical, fluidic, immune-metabolic, and sensory regulation. Results: The narrative synthesis indicates that the concept of the synovial joint as a dynamic mechano-fluidic organ in which cartilage, synovium, synovial fluid, capsule, subchondral bone, periarticular tissues, and sensory pathways interact continuously. Repeated physiological movement may promote synovial fluid exchange, lubrication, cartilage nutrition, hyaluronic acid and lubricin function, matrix turnover, anti-inflammatory signaling, proprioceptive control, and exercise-induced hypoalgesia. In contrast, inactivity and unloading may impair fluid dynamics, promote muscle inhibition, stiffness, inflammatory persistence, sensory deconditioning, and loss of function. Excessive or poorly distributed loading may also disrupt homeostasis through matrix injury, inflammation, fatigue, and nociceptive sensitization. These findings informed the proposed adaptive loading window, a hypothesis-generating conceptual framework rather than a clinically validated threshold, describing the dynamic range of movement within which joint function and pain regulation may be supported without sustained tissue or symptom aggravation. Conclusions: Movement should be viewed not only as a therapeutic intervention, but also as a continuous regulator of joint biology and perception. Its clinical value may depend on identifying an individualized loading range that supports adaptation, function, and confidence in movement while avoiding both underloading and overload. Full article

Prolonged skeletal muscle disuse, such as extended inactivity and mechanical unloading, typically elicits severe muscle atrophy and progressive bone loss, yet hibernating mammals evade this pathological cascade via poorly defined adaptive mechanisms. Using the Daurian ground squirrel (Spermophilus dauricus) as a unique natural model of prolonged torpor, we demonstrate that skeletal muscle-derived small extracellular vesicles (Mu-EVs) orchestrate protective muscle–bone crosstalk to maintain bone homeostasis during extended disuse. Morphological and microstructural analyses revealed no significant deficits in skeletal muscle and tibial bone between pre-hibernation (PRE) and torpor (TOR) states. Compared with PRE-Mu-EVs, TOR-Mu-EVs significantly enhanced osteogenic differentiation in MC3T3-E1 osteoblasts, markedly upregulating mRNA expression of the key osteogenic markers OCN and COL1A1 (p < 0.05, p < 0.01). Small RNA sequencing identified a novel unannotated miRNA (mature sequence: GCAGCAGCCCGGCTCTCCTAAT) sharply downregulated in TOR-Mu-EVs (p < 0.01); this miRNA exhibits binding potential toward the transcript of Bmp7, a pivotal regulator of osteogenesis. In vitro functional assays confirmed that this miRNA suppresses osteoblast maturation; in a mouse hindlimb unloading (HLU) disuse osteoporosis model, miRNA antagomir partially alleviated bone loss, boosting Masson staining area by 27.13% (p < 0.05) and bone volume fraction by 15.01% (n = 5, 0.05 < p < 0.1, Cohen’s d = 0.71, 95% CI [−0.16, 1.38]). Collectively, hibernating Mu-EVs mitigate this BMP7-inhibiting miRNA to sustain osteogenic activity, hinting at a conserved regulatory cascade that could offer tentative translational clues for managing disuse osteoporosis. Full article

Bone healing is a complex regenerative process regulated by interactions between skeletal and host biologic responses, and failure of bone repair remains a major challenge in orthopedic surgery. Using a murine model, this study investigated whether a preemptive priming stimulus could enhance healing of a subsequent contralateral cortical bone defect and whether the type and timing of the stimulus influenced this response. Skeletally mature male mice were randomized into six groups (n = 6/group) receiving either no stimulus, a skin incision, skin and muscle incisions, or a unicortical femoral drill hole stimulus. A subcritical-sized 1 mm × 2 mm unicortical defect was subsequently created in the contralateral femur after intervals of 2, 6, or 12 weeks, depending on group allocation. Femora were harvested 8 weeks later for micro-computed tomography, histology, and immunofluorescence analyses. Mice undergoing muscle elevation 2 weeks prior to defect creation and mice receiving drill hole stimulus 12 weeks prior demonstrated the greatest degree of cortical regeneration and healing of the contralateral subcritical-sized defect, with normalized cortical thicknesses reaching 104% and 109% of adjacent native cortex, respectively. Histologic analysis confirmed restoration of mature cortical architecture in these groups. Immunofluorescence analysis demonstrated a relative shift toward an Arg1-associated reparative macrophage profile with reduced iNOS-associated inflammatory signaling, suggesting that modulation of the innate immune response contributed to the enhanced regenerative healing observed. These findings demonstrate that priming stimuli can enhance subsequent bone healing in a timing- and stimulus-dependent manner and may represent a novel strategy to optimize bone regeneration. Full article

Background: With the global population aging, osteoporosis and associated vertebral compression fractures are increasingly prevalent. While bone mineral density (BMD) remains the standard clinical parameter for diagnosing osteoporosis, it provides an incomplete assessment of holistic spinal bone health. Paraspinal muscles are essential for spinal stability and movement. This narrative review aims to evaluate the interplay between paraspinal muscle status and lumbar spine BMD, thereby providing a scientific foundation for comprehensive bone health management. Methods: A comprehensive literature search was conducted in PubMed using relevant keywords to identify studies evaluating the functional and morphological interactions between paraspinal muscles and bone mineral density. Discussion: Current evidence demonstrates a significant negative correlation between paraspinal muscle FI and lumbar spine BMD. High FI is identified as an independent risk factor for osteoporotic vertebral fractures and a robust predictor of postoperative complications. The relationship between paraspinal muscle CSA and BMD remains debated. Nevertheless, targeted high-impact and resistance training generate substantial mechanical loading through muscle contraction, providing biological stimuli for trabecular BMD preservation. Conclusions: Evidence highlights a critical synergy between paraspinal muscle status and bone mineral density, with muscle fat infiltration acting as a key marker for bone loss and fracture susceptibility. Integrating these muscle parameters with traditional BMD measurements improves fracture risk stratification and osteoporosis management. Full article

The aim of this study was to compare carcass composition, meat quality, digestive tract morphometry, and leg bone dimensions of Pekin and Muscovy ducks. The study involved 40 birds, including 10 males and 10 females from each genotype, reared to market age. Carcass traits, physicochemical properties of breast and leg muscles, texture parameters, internal organ development, intestinal measurements, and selected dimensions of the femur and tibia were evaluated. The results demonstrated a significant effect of duck genotype (p < 0.05) on carcass weight, dressing percentage, and the proportion of neck, wings, and skin with subcutaneous fat. Genotype also affected meat color (L*, a*, b*), intramuscular fat and collagen content, cooking loss, pH, electrical conductivity, and selected texture parameters of breast muscles. Differences were also observed in the mass and proportion of internal organs, most intestinal morphometric traits, and selected bone measurements. Sex had a significant effect on body and carcass weight, selected meat quality traits, intestinal measurements, and leg bone dimensions, with males generally showing greater body size and more developed skeletal structures. Significant interactions between genotype and sex were observed for several analyzed traits. The findings indicate that both genotype and sex substantially affect slaughter traits and meat quality characteristics of ducks. Full article

Evidence suggests that physical activity promotes bone health through mechanical loading and biochemical signaling between bone and muscle tissues. A class of signaling molecules known as exerkines is a key mediator of bone–muscle crosstalk. Although exercise regulates osteokines, the acute exerkine responses across different exercise modalities remain unclear. This randomized repeated-measures crossover study compared acute changes in serum sclerostin (SCL), dickkopf-1 (DKK-1), receptor activator of nuclear factor kappa-B ligand (RANKL), osteopontin (OPN), brain-derived neurotrophic factor (BDNF), irisin, and interleukin 6 (IL-6) following circuit training (CT) (cycle ergometer, push-up, step-ups, medicine ball twist, and front squats with kettlebell for three rounds) and traditional resistance (TR) exercise (3 sets 10 repetitions 50–60% 1 RM for leg press, seated cable row, barbell bench press, dumbbell deadlifts, and dumbbell seated shoulder press) in healthy young adults (n = 12). Participants performed two protocols separated by 2-week wash-out periods. Blood samples were analyzed before exercise training (pre), immediately post-exercise (IP), and 30 min post-exercise (30P) for all exerkines using ELISA. There was a significant interaction between protocol, timepoint, and sex (p = 0.038) for SCL levels. In males, SCL levels increased from Pre to IP under both training protocols (CT: 0.10 ± 0.02 ng/mL to 0.14 ± 0.02 ng/mL; TR: 0.20 ± 0.02 ng/mL to 0.21 ± 0.02 ng/mL). In both protocols, SCL levels decreased from IP to 30 P (CT: 0.14 ± 0.02 to 0.10 ± 0.01 ng/mL; TR: 0.22 ± 0.02 to 0.17 ± 0.02 ng/mL). In females, SCL levels increased from Pre to IP under both training protocols (CT: 0.03 ± 0.02 ng/mL to 0.06 ± 0.02 ng/mL; TR: 0.07 ± 0.02 ng/mL to 0.13 ± 0.02 ng/mL). There was a significant time effect for OPN and RANKL concentrations. Marginal means for the time point showed that OPN was significantly higher at the Pre time point. Post hoc analyses showed that OPN levels significantly decreased from 30P to Pre (18.84 ± 0.92 to 15.69 ± 1.32 pg/mL) (p = 0.01). RANKL showed a significant increase from Pre (0.38 ± 0.04 pg/mL) to 30P (0.57 ± 0.06 pg/mL) (p = 0.02); otherwise, there were no significant differences between protocols or sexes. Irisin significantly decreased from Pre (28,761.73 ± 238.52 pg/mL) to IP (2364.85 ± 243.79 pg/mL) in both protocols (p = 0.01). DKK-1, BDNF, and IL-6 levels were only different between protocols (p < 0.01). SCL and BDNF levels were expressed higher in the TR protocol, whereas DKK-1, IL-6, and Irisin levels were expressed higher in the CT protocol. Overall, the findings suggest that SCL, RANKL, OPN, and irisin responded to the exercise bout, while the other exerkines did not show meaningful changes over time. Full article

Background: Tumor–stroma interactions play a critical role in renal cell carcinoma (RCC) progression. Cancer-associated fibroblasts (CAFs) are considered key components of the tumor microenvironment; however, their origin remains controversial. This study aimed to determine whether bone marrow-derived mesenchymal stem cells (MSCs) contribute to CAF-like stromal changes and RCC progression. Methods: An orthotopic xenograft mouse model was established using luciferase- and GFP-labeled Caki-1 cells. MSCs labeled with PKH26 were administered intravenously. Tumor growth was evaluated using an in vivo imaging system and tumor volume measurements. Immunohistochemical analyses were performed to assess MSC localization and α-smooth muscle actin (α-SMA) expression. In vitro proliferation and migration assays were conducted using direct and indirect co-culture systems. Results: The intravenous administration of MSCs significantly increased tumor growth and bioluminescence intensity in an orthotopic model. The tumor volumes were significantly larger in the MSC-treated versus control group. An immunofluorescence analysis demonstrated partial co-localization of PKH26-labeled MSCs with α-SMA-positive fibroblast-like cells, suggesting acquisition of CAF-like features. Direct co-culture with MSCs significantly enhanced RCC cell proliferation and migration in vitro, whereas culturing in conditioned medium alone did not produce similar effects. Conclusions: Exogenously administered bone marrow-derived MSCs may be recruited into RCC tissues and acquire CAF-like features through interactions with tumor cells. These findings suggest that stromal–tumor cell interactions within the tumor microenvironment may contribute to RCC progression and represent a potential therapeutic target. Full article

Body measurement traits are a direct production indicator reflecting growth status and guiding genetic selection. Identifying molecular markers associated with body measurement traits could accelerate animal breeding programs. The Yanqi horse, an important indigenous breed in Xinjiang, is primarily distributed in the Bayingolin Mongol Autonomous Prefecture. However, molecular markers linked to body measurement traits in Yanqi horses remain uncharacterized. In the present study, whole-genome resequencing was performed on 183 Yanqi horses, yielding 13,366,672 single-nucleotide polymorphisms (SNPs) after quality control. A genome-wide association study on withers height, body length, heart girth, and cannon bone circumference was conducted using a mixed linear model implemented in GEMMA, with population structure and relatedness controlled using principal components and a genomic kinship matrix. Bonferroni-adjusted thresholds (p < 1 × 10⁻⁷ for significant associations; p < 1 × 10⁻⁶ for suggestive associations) were applied to minimize false positives. A total of 185 single-nucleotide polymorphisms were significantly associated with body measurement traits and 359 candidate genes were annotated within 200 kb upstream and downstream of the significant loci. Among these, five genes, GABRB1, FIGN, GABRA4, ENSECAG00000051747, and COX7B2, may be implicated in the growth and development of Yanqi horses. Gene Ontology and Kyoto Encyclopedia of Genes and Genomes pathway analyses indicated that these genes are primarily involved in cytoskeletal structures within muscle cells, regulation of the actin cytoskeleton, and neuroactive ligand–receptor interaction pathways. In summary, this study presents novel markers and candidate gene sets associated with body measurement traits in Yanqi horses, offering valuable insights for functional gene investigations and presenting substantial potential for accelerating the breeding of Yanqi horses. Full article

Background: Hallux valgus (HV) is a complex forefoot deformity influenced by interactions between osseous alignment, ligamentous restraint, and muscle–tendon forces. While the biomechanical role of ligament laxity and bone geometry has been extensively investigated, the contribution of tibialis anterior (TA) tendon insertion variability to medial column mechanics remains insufficiently understood. Materials and Methods: A patient-specific finite element model of the foot was developed from high-resolution computed tomography data. Five anatomically documented TA distal insertion configurations were modeled, representing different distributions of attachment to the medial cuneiform and first metatarsal base. All simulations were performed under identical boundary and loading conditions representative of the stance phase of gait. Global (full-foot) and local (first bone and first metatarsal) mechanical responses were quantified using total deformation, equivalent von Mises stress, and strain distributions. Results: Marked differences in mechanical behavior were observed across TA insertion types. The metatarsal-dominant configuration (Type 3) demonstrated the highest global and local deformation values (global deformation: 1.0928 mm; first bone deformation: 1.0928 mm) and elevated strain distributions, whereas the medial-dominant configuration (Type 2) showed minimal deformation (global: 0.0727 mm; first bone: 0.0350 mm) but the highest global equivalent von Mises stress (5.7698 MPa). The single-band insertion to the medial cuneiform (Type 5) produced the greatest localized stress in the first bone region (3.8634 MPa). Representative strain maps revealed distinct spatial redistribution patterns within the medial column associated with TA insertion geometry. Conclusions: This patient-specific finite element analysis indicated that distal TA insertion variability alone can substantially modify deformation, stress, and strain patterns within the medial column. These findings suggested that TA insertion anatomy may act as a biomechanical modulator of first-ray mechanics and should be considered in future studies investigating hallux valgus pathomechanics and personalized treatment strategies. Full article

This study presents a computational, simulation-based investigation of the dielectric response of human hand tissues, skin, fat, muscle, and bone to radiofrequency (RF) electromagnetic fields emitted by mobile devices. The widespread adoption of handheld devices and the deployment of fifth-generation (5G) networks, including millimetre-wave (mmWave) bands, have intensified concerns regarding localized human exposure to RF radiation, particularly in the hand, which serves as the primary interface during device operation. Using validated dielectric property datasets, numerical simulations were performed across the frequency range of 0.5–40 GHz, employing the Finite-Difference Time-Domain (FDTD) method to solve Maxwell’s equations, with analytical evaluations conducted in Maple-18. A heterogeneous multilayer hand phantom was developed, and simulations were conducted under controlled exposure conditions, including a transmitted power of 1 W, antenna gain of 2 dBi, and incident power density of 5 W/m², consistent with ICNIRP and NCC safety guidelines. Tissue responses were assessed over a temperature range of 10–40 °C to account for thermal variability. The results demonstrate strong frequency- and temperature-dependent behaviour of dielectric properties, intrinsic impedance, reflection coefficient, attenuation, and specific absorption rate (SAR). At lower frequencies (<1 GHz), RF energy penetrated more deeply with distributed absorption and relatively low SAR values, whereas higher frequencies (3–40 GHz) produced highly localized absorption in superficial tissues, particularly skin and muscle. Increasing temperature led to significant increases in permittivity, conductivity, and SAR, with up to a twofold enhancement observed between 10 °C and 40 °C. These findings confirm that 5G and mmWave exposures result in predominantly surface-confined energy deposition in hand tissues. The study provides a robust computational framework for evaluating hand device electromagnetic interactions and offers quantitative insights relevant to antenna design, exposure compliance assessment, and the development of evidence-based safety guidelines. Full article

Background/Objectives: Magnetite nanoparticles represent promising candidates for a broad spectrum of biomedical applications, ranging from in vitro diagnostic assays to in vivo imaging, hyperthermia, and targeted drug and gene delivery, with some nanoagents already approved for clinical use. A critical determinant of their functionality is the nanoparticle coating, which facilitates beneficial interactions within biological systems. In the context of tumor-targeted therapeutic delivery, key design parameters—particularly surface coatings—can be optimized to enhance treatment efficacy by modulating blood circulation kinetics, biodistribution, and other critical properties. However, current preclinical screening methods primarily rely on cell culture models to identify potential nanocarriers, yet these systems often poorly correlate with actual in vivo performance. This discrepancy highlights the necessity of incorporating more biologically relevant testing platforms, such as high-throughput in vivo assays. Methods: In this work, we employed an original magnetic particle quantification (MPQ) technology to systematically evaluate the blood circulation kinetics and biodistribution patterns for magnetite nanoparticles with 17 different coatings across multiple organs and tissues, including the liver, spleen, lungs, kidneys, heart, tumor, brain, peripheral blood, muscle, and bone. This methodology offers high sensitivity, user-friendly operation, and provides quantitative measurements across a broad dynamic range of nanoparticle concentrations. These advantages enabled high-throughput acquisition of precise blood circulation and biodistribution data. In addition, histological analysis was conducted to evaluate nanoparticle penetration depth within tumor tissue. Results: Here we conducted a comprehensive study of the effect of 17 different polymer-, lectin-, and small molecule-based coatings on the behavior of magnetite nanoparticles in vivo. For each type of obtained nanoparticles, we implemented passive targeting as well as magnetic targeting, the latter using an external magnetic field localized in the tumor area. Conclusions: The collected dataset provides critical insights into how surface modifications influence nanoparticle performance in complex biological systems, offering valuable guidance for optimizing therapeutic nanocarrier design. Full article

Background: Osteoporosis is a complex disorder involving bone loss and muscle degeneration. Multi-omics technologies provide novel insights into its molecular mechanisms and may support biomarker discovery, patient stratification, and therapeutic development. Objective: This scoping review aimed to synthesize current evidence on the application of multi-omics approaches in osteoporosis, focusing on molecular insights, methodological diversity, and translational potential. Methods: A literature search of PubMed, Embase, and Scopus retrieved 433 records using the keywords “osteoporosis,” “osteosarcopenia,” and “omics.” After removing duplicates and screening titles, abstracts, and full texts, 30 studies met the inclusion criteria. Data on study populations, biological samples, multi-omics techniques, and integration methods were extracted. Results: Studies employed transcriptomics, proteomics, metabolomics, lipidomics, epigenomics, and metagenomics, often combined in multi-omics analyses with computational modeling. Key pathways included osteoclast differentiation, immune regulation, ferroptosis, and microbiome–metabolite interactions. Multi-omics integration enabled the identification of molecular subtypes, candidate biomarkers, and potential therapeutic targets. Limitations included small or single-center cohorts, heterogeneous designs, and limited validation, restricting generalizability and clinical translation. Conclusions: Multi-omics approaches offer a powerful framework to uncover the molecular mechanisms underlying bone and muscle degeneration and to guide precision diagnostics and interventions. Future studies should prioritize large, multicenter, longitudinal designs integrating multi-omics data with clinical and functional validation to facilitate clinical application. Full article

Major orthopedic limb surgery is often accompanied by external coaptation; the combined effect of these interventions can lead to muscle atrophy and functional impairment. Large animal models, including goats, are commonly used to study orthopedic interventions, yet longitudinal data on muscle changes after such interventions are limited. This study quantified gastrocnemius muscle adaptations in adult Boer-cross goats undergoing a clinically representative unilateral tibial segmental ostectomy and external coaptation protocol. Muscles on the operated side exhibited statistically significant decreases in mass, length, optimal fiber length, and CSA, and increases in nucleus density compared to muscles on the contralateral, non-operated side (p < 0.05). Although muscle properties showed partial recovery over time, mass and CSA remained 20–30% lower on the operated side than on the non-operated side at 12 months post-surgery despite cast removal at about 2 months post-surgery. Muscle CSA was positively correlated with bone mineral density and peak vertical ground reaction forces measured during the in vivo study. The extent of muscle recovery in the goat model was less than that observed for other mammalian models of hindlimb remobilization. More research is needed to understand the complex interaction between surgery, external coaptation, and muscle properties in the goat model. Full article

Background/Objectives: The menopausal decline in estrogen levels accelerates age-related changes, including visceral adiposity, insulin resistance, sarcopenia, osteoporosis, and endothelial dysfunction. While nutrition independently influences these outcomes, the interactive role of estrogen signaling and nutrient metabolism in healthy aging remains underexplored. This article evaluates these interactions. Methods: We conducted a narrative synthesis of studies examining estrogen’s effects on energy balance, adipose regulation, muscle, bone, and cardiovascular health, with an emphasis on estrogen-like nutritional modulators and phytoestrogens. In addition, we present original experimental data from our laboratory investigating sex-specific vascular responses to G protein-coupled estrogen receptor (GPER) activation using functional myography in isolated rat aortic rings from young adult and middle-aged rats (n = 6–8 per group) to assess responses to the GPER agonist G-1 (1.0 μM). Results: Literature evidence demonstrates that estrogen supports macronutrient utilization, suppresses adipose inflammation, preserves bone density, and promotes endothelial function. Phytoestrogens may engage estrogen-responsive pathways to mitigate age-related physiological decline. Our original findings show that GPER agonism enhances both contractile and vasodilatory responses in female (p < 0.05) but not male rat aortas, providing mechanistic evidence of sex-specific vascular estrogen signaling. These results suggest that dietary phytoestrogens and nutrient-rich dietary patterns may, in part, activate GPER-dependent pathways to support cardiovascular resilience in aging women. Conclusions: Estrogen–nutrition interactions are central to metabolic adaptation and healthy aging. Our findings highlight GPER as a functionally resilient pathway in aging vasculature, offering a putative mechanistic link for nutritional modulation. However, direct translation of these findings to human clinical outcomes remains to be established. Precision nutrition strategies targeting GPER represent a promising framework for healthy aging, though large-scale human trials are necessary to confirm these receptor-specific effects. Full article