Topical Collection "International Summer School on Natural Products: The Contribution of Young Researchers to Marine Inspired Products"

Editors

Prof. Dr. Giorgia Oliviero
Website
Guest Editor
Molecular Medicine and Medical Biotechnologies, University of Naples Federico II, Via Pansini 5, 80131 Naples, Italy
Interests: synthesis and phisico-chemical characterization of natural and modified nucleosides, nucleotides and oligonucleotides (ODN) analogs to be used both in therapy and as novel diagnostic tool
Prof. Dr. Valeria Costantino
Website
Guest Editor
Department of Pharmacy, University of Naples Federico II, Via Montesano 149, 80131 Naples, Italy
Interests: isolation and stereostructural elucidation of new leads compounds in anti-inflammatory and anti-cancer drug discovery; exploration of the QQ and the QS system in bacteria symbiotic with sponges with the goal to create novel leads in antibacterial drug discovery; cyanobacteria as source of novel lead compounds and toxins
Special Issues and Collections in MDPI journals
Prof. Dr. Daniele Passarella
Website SciProfiles
Guest Editor
Department of Chemistry, University of Milan, Via Golgi, 19, 20133 Milan-Itlay
Special Issues and Collections in MDPI journals

Topical Collection Information

Dear Colleagues,

The main focus of the International Summer School on Natural Products (ISSNP) is on both established and emerging areas of research at the cutting-edge of organic chemistry inspired by natural products.

The natural world is a source of biologically active molecules and an inspiration for researchers in different fields. Natural products are bioactive compounds synthesized by terrestrial and marine plants, micro-organisms, and animals. Interdisciplinarity involves the simple combination of several points of view to solve complex problems relating to the characterization of bioactive natural compounds, their biological evaluation, and the clarification of their mechanisms of action.

Accordingly, the aim of this Special Issue of Marine Drugs  is to collect new discoveries in relation to bioactive molecules from marine-inspired compounds produced by isolation, semi-synthesis, and synthesis.

The biological activity of natural extracts or synthetic analogues without a proper chemical characterization will not be considered. Review articles in the field will also be evaluated.

The editors strongly encourage young scientists to publish their innovative research in this Special Issue.

Prof. Dr. Giorgia Oliviero
Prof. Dr. Valeria Costantino
Prof. Dr. Daniele Passarella
Guest Editors

Manuscript Submission Information

Manuscripts should be submitted online at www.mdpi.com by registering and logging in to this website. Once you are registered, click here to go to the submission form. Manuscripts can be submitted until the deadline. All papers will be peer-reviewed. Accepted papers will be published continuously in the journal (as soon as accepted) and will be listed together on the collection website. Research articles, review articles as well as short communications are invited. For planned papers, a title and short abstract (about 100 words) can be sent to the Editorial Office for announcement on this website.

Submitted manuscripts should not have been published previously, nor be under consideration for publication elsewhere (except conference proceedings papers). All manuscripts are thoroughly refereed through a single-blind peer-review process. A guide for authors and other relevant information for submission of manuscripts is available on the Instructions for Authors page. Marine Drugs is an international peer-reviewed open access monthly journal published by MDPI.

Please visit the Instructions for Authors page before submitting a manuscript. The Article Processing Charge (APC) for publication in this open access journal is 2000 CHF (Swiss Francs). Submitted papers should be well formatted and use good English. Authors may use MDPI's English editing service prior to publication or during author revisions.

Published Papers (3 papers)

2020

Jump to: 2019

Open AccessArticle
Evaluation of an Analogue of the Marine ε-PLL Peptide as a Ligand of G-quadruplex DNA Structures
Mar. Drugs 2020, 18(1), 49; https://doi.org/10.3390/md18010049 - 11 Jan 2020
Cited by 3
Abstract
ε-poly-l-Lysine (ε-PLL) peptide is a product of the marine bacterium Bacillus subtilis with antibacterial and anticancer activity largely used worldwide as a food preservative. ε-PLL and its synthetic analogue α,ε-poly-l-lysine (α,ε-PLL) are also employed in the biomedical field as [...] Read more.
ε-poly-l-Lysine (ε-PLL) peptide is a product of the marine bacterium Bacillus subtilis with antibacterial and anticancer activity largely used worldwide as a food preservative. ε-PLL and its synthetic analogue α,ε-poly-l-lysine (α,ε-PLL) are also employed in the biomedical field as enhancers of anticancer drugs and for drug and gene delivery applications. Recently, several studies reported the interaction between these non-canonical peptides and DNA targets. Among the most important DNA targets are the DNA secondary structures known as G-quadruplexes (G4s) which play relevant roles in many biological processes and disease-related mechanisms. The search for novel ligands capable of interfering with G4-driven biological processes elicits growing attention in the screening of new classes of G4 binders. In this context, we have here investigated the potential of α,ε-PLL as a G4 ligand. In particular, the effects of the incubation of two different models of G4 DNA, i.e., the parallel G4 formed by the Pu22 (d[TGAGGGTGGGTAGGGTGGGTAA]) sequence, a mutated and shorter analogue of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, and the hybrid parallel/antiparallel G4 formed by the human Tel22 (d[AGGGTTAGGGTTAGGGTTAGGG]) telomeric sequence, with α,ε-PLL are discussed in the light of circular dichroism (CD), UV, fluorescence, size exclusion chromatography (SEC), and surface plasmon resonance (SPR) evidence. Even though the SPR results indicated that α,ε-PLL is capable of binding with µM affinity to both the G4 models, spectroscopic and SEC investigations disclosed significant differences in the structural properties of the resulting α,ε-PLL/G4 complexes which support the use of α,ε-PLL as a G4 ligand capable of discriminating among different G4 topologies. Full article
Show Figures

Figure 1

2019

Jump to: 2020

Open AccessArticle
Fast Detection of Two Smenamide Family Members Using Molecular Networking
Mar. Drugs 2019, 17(11), 618; https://doi.org/10.3390/md17110618 - 30 Oct 2019
Cited by 5
Abstract
Caribbean sponges of the genus Smenospongia are a prolific source of chlorinated secondary metabolites. The use of molecular networking as a powerful dereplication tool revealed in the metabolome of S. aurea two new members of the smenamide family, namely smenamide F (1 [...] Read more.
Caribbean sponges of the genus Smenospongia are a prolific source of chlorinated secondary metabolites. The use of molecular networking as a powerful dereplication tool revealed in the metabolome of S. aurea two new members of the smenamide family, namely smenamide F (1) and G (2). The structure of smenamide F (1) and G (2) was determined by spectroscopic analysis (NMR, MS, ECD). The relative and the absolute configuration at C-13, C-15, and C-16 was determined on the basis of the conformational rigidity of a 1,3-disubstituted alkyl chain system (i.e., the C-12/C-18 segment of compound (1). Smenamide F (1) and G (2) were shown to exert a selective moderate antiproliferative activity against cancer cell lines MCF-7 and MDA-MB-231, while being inactive against MG-63. Full article
Show Figures

Graphical abstract

Open AccessArticle
New Linear Precursors of cIDPR Derivatives as Stable Analogs of cADPR: A Potent Second Messenger with Ca2+-Modulating Activity Isolated from Sea Urchin Eggs
Mar. Drugs 2019, 17(8), 476; https://doi.org/10.3390/md17080476 - 17 Aug 2019
Abstract
Herein, we report on the synthesis of a small set of linear precursors of an inosine analogue of cyclic ADP-ribose (cADPR), a second messenger involved in Ca2+ mobilization from ryanodine receptor stores firstly isolated from sea urchin eggs extracts. The synthesized compounds [...] Read more.
Herein, we report on the synthesis of a small set of linear precursors of an inosine analogue of cyclic ADP-ribose (cADPR), a second messenger involved in Ca2+ mobilization from ryanodine receptor stores firstly isolated from sea urchin eggs extracts. The synthesized compounds were obtained starting from inosine and are characterized by an N1-alkyl chain replacing the “northern” ribose and a phosphate group attached at the end of the N1-alkyl chain and/or 5′-sugar positions. Preliminary Ca2+ mobilization assays, performed on differentiated C2C12 cells, are reported as well. Full article
Show Figures

Figure 1

Back to TopTop