Characterization of Nodulation-Compatible Strains of Native Soil Rhizobia from the Rhizosphere of Soya Bean (Glycine max L.) Fields in South Africa
Abstract
1. Introduction
2. Materials and Methods
2.1. Soil Sample Collection
2.2. Soil Trap Experiment for Isolation of Native Rhizobia
2.3. Nodulation Authentication Test
2.4. Experimental Layout and Statistical Analysis
2.5. Evaluation of Rhizobia for Tolerance to Various Abiotic Stresses
2.6. Molecular Characterization of Rhizobia
2.6.1. PCR Amplification of 16S, Housekeeping, and Symbiotic Genes
2.6.2. Phylogenetic Analysis
3. Results
3.1. Rhizobial Isolation and Soil Trap Experiment
3.2. Nodulation Authentication Experiment
3.2.1. Nodulation Compatibility of Isolates from Nodule Trapping
3.2.2. Nodulation Compatibility of the Isolates from the SARCC
3.3. Tolerance to Abiotic Stress
3.4. Phylogeny and Taxonomy of Rhizobial Isolates
3.5. Phylogenetic Analysis of nifH and nifD Genes
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Mu, X.; Chen, Y. The physiology response of photosynthesis to nitrogen deficiency. Plant Physiol. Biochem. 2020, 158, 76–82. [Google Scholar] [CrossRef] [PubMed]
- LeBauer, D.S.; Treseder, K. Nitrogen limitation of net primary productivity in terrestrial ecosystems is globally distributed. Ecology 2008, 89, 371–379. [Google Scholar] [CrossRef] [PubMed]
- Courty, P.E.; Smith, P.; Koegel, S.; Redecker, D.; Wipf, D. Inorganic nitrogen uptake and transport in beneficial plant root-microbe interactions. Crit. Rev. Plant Sci. 2015, 34, 4–16. [Google Scholar] [CrossRef]
- Karimi, S.; Soltani, S.; Jesemi, K. Positive and negative impacts of nitrogen fertilizers on soil properties and nutrient dynamics. Asia. J. Res. Agric. Fores. 2023, 9, 233–240. [Google Scholar] [CrossRef]
- Tyagi, J.; Ahmad, S.; Malik, M. Nitrogenous fertilizers: Impact on environment sustainability, mitigation strategies, and challenges. Int. J. Environ. Sci. Technol. 2022, 19, 11649–11672. [Google Scholar] [CrossRef]
- Abebe, G.; Debebe, S.; Yildiz, F. Factors affecting use of organic fertilizer among smallholder farmers in Sekela district of Amhara region, Northwestern Ethiopia. Cogent Food. Agric. 2019, 5, 1669398. [Google Scholar] [CrossRef]
- Mendoza-Suárez, M.; Andersen, S.U.; Poole, P.S.; Sánchez-Cañizares, C. Competition, Nodule Occupancy, and Persistence of Inoculant Strains: Key Factors in the Rhizobium-Legume Symbioses. Front. Plant Sci. 2021, 12, 690567. [Google Scholar] [CrossRef] [PubMed]
- Okazaki, S.; Kaneko, T.; Sato, S.; Saeki, K. Hijacking of leguminous nodulation signaling by rhizobia type III secretion system. Proc. Natl. Acad. Sci. USA 2013, 110, 17131–17136. [Google Scholar] [CrossRef]
- Oldroyd, G.E.D.; Murray, J.D.; Poole, P.S.; Downie, J.A. The rules of engagement in the legume-rhizobial symbiosis. Annu. Rev. Genet. 2011, 45, 119–144. [Google Scholar] [CrossRef]
- Yang, J.; Lan, L.; Jin, Y.; Yu, N.; Wang, D.; Wang, E. Mechanisms underlying legume–rhizobium symbioses. J. Integr. Plant Biol. 2022, 64, 244–267. [Google Scholar] [CrossRef]
- Hassan, S.; Mathesius, U. The role of flavonoids in root–rhizosphere signalling: Opportunities and challenges for improving plant–microbe interactions. J. Exp. Bot. 2012, 63, 3429–3444. [Google Scholar] [CrossRef] [PubMed]
- Hartman, G.L.; West, E.D.; Herman, T.K. Crops that feed the world 2 soybean-worldwide protection, use, and constraints caused by pathogens and pests. Food Secur. 2011, 3, 5–17. [Google Scholar] [CrossRef]
- Kyei-Boahen, S.; Savala, C.E.N.; Muananamuale, C.P.; Malita, C.; Wiredu, A.N.; Chibeba, A.M.; Elia, P.; Chikoye, D. Symbiotic effectiveness of Bradyrhizobium strains on Soybean growth and Productivity in Mozambique. Front. Sustain. Food Syst. 2023, 6, 1084745. [Google Scholar] [CrossRef]
- Farid, M.; Earl, H.J.; Navabi, A. Yield stability of dry bean genotypes across nitrogen-fixation-dependent and fertilizer-dependent management systems. Crop. Sci. 2016, 56, 173–182. [Google Scholar]
- Lira, M.A., Jr.; Nascimento, L.R.S.; Fracetto, G.G.M. Legume-rhizobia signal exchange: Promiscuity and environmental effects. Front. Microbiol. 2015, 6, 945. [Google Scholar] [CrossRef]
- Grönemeyer, J.L.; Kulkarni, A.; Berkelmann, D.; Hurek, T.; Reinhold-Hurek, B. Rhizobia Indigenous to the Okavango Region in Sub-Saharan Africa: Diversity, Adaptations, and Host Specificity. Appl. Environ. Microbiol. 2014, 23, 7244–7257. [Google Scholar] [CrossRef]
- Thilankarathna, M.S.; Raizada, M.N. A meta-analysis of the effectiveness of diverse rhizobia inoculants on soybean traits under field conditions. Soil Biol. Biochem. 2017, 105, 177–196. [Google Scholar] [CrossRef]
- Anderson, E.J.; Ali, M.L.; Beavis, W.D.; Chen, P.; Clemente, T.E.; Dier, B.W.; Greaf, G.L.; Grassini, P.; Hyten, D.L.; Mchale, L.K.; et al. Soybean (Glycine max (L.)) breeding history, improvement, production and future opportunities. In Advances in Plant Breeding Strategies: Legumes; Al-Khayri, J., Jain, S., Johnson, D., Eds.; Springer: Cham, Switzerland, 2019. [Google Scholar]
- Legget, M.; Diaz-Zorita, M.; Koivunen, M.; Bownam, R.; Pesek, R.; Stevenson, C.; Leister, T. Soybean response to inoculation with Bradyrhizobium japonicum in the United States and Argentina. Agron J. 2017, 109, 1031–1038. [Google Scholar] [CrossRef]
- Nakei, M.D.; Ventakaramana, B.P.; Ndakidemi, P.A. Soybean-nodulating rhizobia: Ecology, Characterization, Diversity and Growth promoting functions. Front. Sustain. Food Syst. 2022, 6, 824444. [Google Scholar] [CrossRef]
- Hassen, A.I.; Bopape, F.L.; Habig, J.H.; Lambrecht, S.C. Nodulation of rooibos (Aspalathus linearis Burm. F), an indigenous South African legume by members of both α and β-protobacteria. Biol. Fert. Soils 2012, 48, 295–303. [Google Scholar] [CrossRef]
- Howieson, J.G.; Dilworth, M.J. Working with Rhizobia; Australian Centre for International Agricultural Research: Canberra, Australia, 2016. [Google Scholar]
- SAS Institute. Statistical Analysis Software (SAS) User’s Guide Version 9.4. SAS Institute Inc.: Cary, NC, USA, 2016. [Google Scholar]
- Keyser, H.M.; Munns, D.M. Tolerance of rhizobia to acidity, aluminium and phosphate. Soil Sci. Soc. Am. J. 1979, 43, 519–523. [Google Scholar] [CrossRef]
- Sukumaran, S. Concentration determination of nucleic acids and proteins using the micro-volume bio-spec nano spectrophotometer. J. Vis. Exp. 2011, 48, 2699. [Google Scholar] [CrossRef]
- Beukes, C.W.; Venter, S.N.; Law, I.J.; Phalane, F.L.; Steenkamp, E.T. South African papilionoid legumes are nodulated by diverse Burkholderia with unique nodulation and nitrogen-fixation loci. PLoS ONE 2013, e68406. [Google Scholar] [CrossRef]
- Beukes, C.W.; Stepkowiski, T.; Venter, S.N.; Law, I.J.; Clapa, T.; Phalane, F.L.; Le Roux, M.M.; Steenkamp, E.T. Crotolarieae and genisteae of the South African great escarpment are nodulated by diverse symbiotic loci. Mol. Phylogenet. Evol. 2016, 100, 206–218. [Google Scholar] [CrossRef]
- Widmer, F.; Shaffer, B.T.; Porteous, L.A.; Seidler, R.J. Analysis of gene pool complexity in soil and litter at a Douglas Fir Forest site in the Oregon Cascade Mountain range. Appl. Environ. Microbiol. 1999, 65, 374–380. [Google Scholar] [CrossRef]
- Silva, C.; Kan, F.L.; Martinez-Romero, E. Population genetic structure of Sinorhizobium meliloti and S. medicae isolated from nodules of Medicago spp. in Mexico. FEMS Microbiol. Ecol. 2007, 60, 477–489. [Google Scholar] [CrossRef] [PubMed]
- Stepkowiski, T.; Moulin, L.; Krzyzanska, A.; Mclnnes, A.; Law, I.J.; Howieson, J. European origin of Bradyrhizobium populations infecting lupins and serradella in soils of Western Australia and South Africa. Appl. Environ. Microbiol. 2005, 71, 7041–7052. [Google Scholar] [CrossRef] [PubMed]
- Stepkowiski, T.; Watkin, E.; Mclnnes, A.; Gurda, D.; Gracz, J.; Steenkamp, E.T. Distinct Bradyrhizobium communities nodulate native to temperate and tropical monsoon Australia. Mol. Phylogent. Evol. 2012, 63, 265–277. [Google Scholar] [CrossRef]
- Stepkowiski, T.; Hughes, C.E.; Law, I.J.; Markiewicz, L.; Gurda, D.; Chlebicka, A.; Moulin, L. Diversification of lupine Bradyrhizobium strains: Evidence from nodulation gene trees. Appl. Environ. Microbiol. 2007, 73, 3254–3264. [Google Scholar] [CrossRef]
- Vinuesa, P.; Rojas-Jimenez, K.; Contreras-Moreira, B.; Mahna, S.K.; Prasad, B.N.; Moe, H.; Selvaraju, S.B.; Thierfelder, H.; Werner, D. Multilocus sequence analysis for assessment of the biogeography and the evolutionary genetics of four Bradyrhizobium species that nodulate soybeans on the Asiantic continent. Appl. Environ. Microbiol. 2008, 74, 6987–6996. [Google Scholar] [CrossRef]
- Tamura, K.; Stecher, G.; Kumar, S. MEGA11: Molecular Evolutionary Genetics Analysis version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef] [PubMed]
- Abaidoo, R.; Singleton, P.; Keyser, H.; Borthakur, D.; Dashiell, K. Distribution and Characteristics of Bradyrhizobium spp. Nodulating African Soybeans. In Highlights of Nitrogen Fixation Research; Martĺnez, E., Hernández, G., Eds.; Springer: Boston, MA, USA, 1999. [Google Scholar] [CrossRef]
- Jarecki, W.; Buczek, J.; Jancazak-pieniazek, M. Soybean (Glycine max L.) response to commercial inoculation with Bradyrhizobium japonicum. Appl. Ecol. Environ. Res. 2020, 18, 6713–6724. [Google Scholar] [CrossRef]
- Bloem, J.; Law, I. Determination of competitive abilities of Bradyrhizobium japonicum strains in soils from soybean production regions in South Africa. Biol. Fertil. Soils 2001, 33, 181–189. [Google Scholar] [CrossRef]
- Hassen, A.; Ndhlovu, K.; Mtsweni, P.; Van Vuuren, A.; van der Linde, E.; Bopape, F. Soya bean Bradyrhizobium persistence or an inoculation paradox? Oil Seeds Focus 2022, 8, 9–11. [Google Scholar]
- Gatabazi, A.; Vorster, B.J.; Mvondo-She, M.A.; Mangwende, E.; Mangani, R.; Hassen, A.I. Efficacy of Peat and Liquid Inoculant Formulations of Bradyrhizobium japonicum Strain WB74 on Growth, Yield and Nitrogen Concentration of Soybean (Glycine max L.). Nitrogen 2021, 2, 332–346. [Google Scholar] [CrossRef]
- Chen, L.; Figueredo, A.; Villani, H. Diversity and symbiotic effectiveness of rhizobia isolated from field-grown soybean nodules in Paraguay. Biol. Fertil. Soils 2002, 35, 448–457. [Google Scholar] [CrossRef]
- Youseif, S.H.; El-megeed, F.H.A.; Khalifa, M.A.; Saleh, S.A. Symbiotic effectiveness of rhizobium (Agrobacterium) compared to Ensifer (Sinorhizobium) and Bradyrhizobium genera for soybean inoculation under field conditions. Res. J. Microbiol. 2014, 9, 151–162. [Google Scholar] [CrossRef]
- Alam, F.; Bhuiyan, M.A.H.; Alam, S.S.; Waghmode, T.R.; Kim, P.J.; Lee, Y.B. Effect of Rhizobium sp. BARIRGm901 inoculation on nodulation, nitrogen fixation and yield. (Glycine max) genotypes in gray terrace soil. Bisci. Biotechnol. Biochem. 2015, 79, 1660–1668. [Google Scholar] [CrossRef] [PubMed]
- Liu, W.Y.; Ridway, H.J.; James, T.K.; Chen, W.M.; Sprent, J.I.; Young, J.P.W.; Andrew, M. Burkholderia sp. induces functional nodules on the south African invasive legume Dipogon lignosus (Phaseoleae) in New Zealand. Microb. Ecol. 2014, 68, 542–555. [Google Scholar] [CrossRef]
- Delamuta, J.R.M.; Ribeiro, R.A.; Menna, P.; Bangel, E.V.; Hungria, M. Multilocus sequence analysis (MLSA) of Bradyrhizobium strains: Revealing high density of tropical diazotrophic symbiotic bacteria. Braz. J. Microbiol. 2012, 43, 698–710. [Google Scholar] [CrossRef]
- Delamuta, J.R.M.; Ribeiro, R.A.; Ormeno-Orrillo, E.; melo, I.S.; Martinez-Romero, E.; Hungria, M. Polyphasic evidence supporting the reclassification of Bradyrhizobium diazoefficiens sp. nov. Int. J. Syst. Evol. Microbiol. 2013, 63, 3342–3351. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.Y.; Wang, R.; Zhang, Y.M.; Liu, W.F.C.; Wang, E.T.; Siu, X.H.; Chen, W.X. Bradyrhizobium daqingense sp. Nov., isolated from soybean nodules. Int. J. Syst. Evol. Microbiol. 2013, 63, 616–624. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.M.; Li, Y.R.; Chen, W.F.; Wang, E.T.; Sui, X.H.; Li, Q.Q.; Zhang, Y.Z.; Zhou, Y.G.; Chen, W.X. Bradyrhizobium huanghuaihaiense sp. Nov., an effective symbiotic bacterium isolated from soybean (Glycine max L.) nodules. Int. J. Syst. Evol. Mcrobiol. 2012, 62, 1951–1956. [Google Scholar] [CrossRef]
- Andrews, M.; De Meyer, S.; James, E.K.; Stępkowski, T.; Hodge, S.; Simon, M.F.; Young, J.P.W. Horizontal Transfer of Symbiosis Genes within and Between Rhizobial Genera: Occurrence and Importance. Genes 2018, 9, 321. [Google Scholar] [CrossRef]
- Barcellos, F.G.; Menna, P.; da Silva Batista, J.S.; Hungria, M. Evidence of horizontal transfer of symbiotic genes from a Bradyrhizobium japonicum inoculant strain to indigenous diazotrophs Sinorhizobium (Ensifer) fredii and Bradyrhizobium elkanii in a Brazilian Savannah soil. Appl. Environ. Microbiol. 2007, 73, 2635–2643. [Google Scholar] [CrossRef] [PubMed]
- Puozza, D.K.; Jaiswal, S.K.; Dakora, F.D. African origin of Bradyrhizobium populations nodulating Bambara groundnut (Vigna subterranean) in Ghanian and South Africa soils. PLoS ONE 2017, 12, e0184943. [Google Scholar]
- Yu, X.; Cloutier, S.; Tambong, J.T.; Bromfield, E.S.P. Bradyrhizobium ottawaense sp. nov., a symbiotic nitrogen fixing bacterium from the root nodules of soybean in Canada. Int. J. Syst. Evol. Microbiol. 2014, 64, 3202–3207. [Google Scholar] [CrossRef]
- Yuan, K.; Reckling, M.; Ramirez, M.D.A.; Djedidi, S.; Fukuhara, I.; Onyama, T.; Yokoyama, T.; Belingra-Kimukura, S.D.; Halwani, M.; Egamberdieva, D.; et al. Characterization of rhizobia for the improvement of soybean cultivation at cold conditions in central Europe. Microbes Environ. 2020, 35, ME19124. [Google Scholar] [CrossRef]
Target Gene | Forward Primer Reverse Primer | PCR Reaction Condition | Reference |
---|---|---|---|
16S rRNA | 27f-ADAGTTGATCCTGGCTCAG 1492r-GGTTACCTTGTTACGACTT | 94 °C for 2 min, 94 °C for 1 min, 55 °C for 1 min, 72 °C for 1 min (30 cycles) | [26] |
NifD | TsnifDF1; CCGVGGAGGTSCTSAAGGTCTATCC Nifp12; CCGAAGAAGTTGTACCTCGCACCA | 94 °C for 90 s, 94 °C for 45 s, 53 °C for 30 s, 72 °C (35 cycles) | [27] |
NifH | GCIWTITAYGGNAARGGNGG GCRTAIABNGCCATCATYTC | 95 °C for 3 min, 94 °C for 1 min, 55 °C for 1 min, 72 °C, (35 cycles) | [28] |
recA | 41F-TTCGGCAAGGGMTCGRTSATG 640r-ACATSACRCCGATCTTCATGC | 94 °C for 4 min, 96 °C for 30 s, 57 °C for 30 s, 72 °C for 90 s (35 cycles) | [29] |
gInII | TSgInIIf; AAGCTCGAGTACATCTGGCTCGACGG TSgInIIr; SGAGCCGTTCCAGTCGGTGTCG | 94 °C for 2 min, 94 °C for 45 s, 53 °C for 30 s, 72 °C for 90 s (35 cycles). | [30] |
atpD | TSatpDf; TCTGGTCCGYGGCCAGGAAG TSatpDr; CGACACTTCCARCCSGCCTG | 95 °C for 3 min, 94 °C for 1 min, 62 °C for 1 min, 72 °C for 1 min (35 cycles) | [30] |
gyrB | AMgyrBf; GCATGTATATCGGCGACAC AMgyrBr; GTGAAGCACAGYACGTTCTC | 94 °C for 2 min, 94 °C for 1 min, 54 °C for 1 min, 72 °C for 1 min (35 cycles) | [31] |
dnaK | TSdnaK4; GGCAAGGAGCCGCAYAAG TSdnak2; GTACATGGCCTCGCCGAGCTTCA | 95 °C for 2 min, 95 °C for 45 s, 60 °C for 30 s, 72 °C for 1.5 min (35 cycles) | [32] |
rpoB | Rpob-456f: ATCGTYTCGCAGATGCACCG rpoB-1364r: TCGATGTCGTCGATYTCGCC | 94 °C for 2 min, 94 °C for 30 s, 59 °C for 30 s, 72 °C for 2 min (35 cycles) | [33] |
Isolates Codes | SARCC-Accession | NCBI Blast Search Similarity | %Identity |
---|---|---|---|
B-4B3063c | SARCC-3486 | Bradyrhizobium leucaenae | 99.01 |
L-9B2551a | SARCC-3541 | Bradyrhizobium sp. | 92.30 |
S-4B2733c | SARCC-3542 | Bradyrhizobium japonicum | 92.25 |
S-4B2783b | SARCC-3408 | Bradyrhizobium sp. | 91.97 |
B-1B3041c | SARCC-3407 | Bradyrhizobium sp. | 91.85 |
B-2B3151b | SARCC-3414 | Bradyrhizobium sp. | 91.02 |
L-2B2483c | SARCC-3409 | Rhizobium alamii | 99.25 |
S-2B2792a | SARCC-3412 | Paraburkholderia sp. | 98.00 |
B-2B3132b | SARCC-3417 | Bradyrhizobium sp. | 91.68 |
L-1B2411b | SARCC-3490 | Bradyrhizobium sp. | 91.20 |
B-4B3093a | SARCC-3416 | Rhizobium pusense | 98.96 |
L-4B253b | SARCC-3413 | Bradyrhizobium sp. | 99.63 |
S-9B283b | SARCC-3540 | Bradyrhizobium sp. | 99.15 |
S-4B2691a | SARCC-3467 | Rhizobium leguminosarum | 98.80 |
L-4B2392a | SARCC-3456 | Bradyrhizobium sp. | 92.20 |
B-2B3153b | SARCC-3410 | Bradyrhizobium sp. | 91.66 |
B-5B3041c | SARCC-3418 | Bradyrhizobium sp. | 91.20 |
S-A45.2dsc | SARCC-1030 | Bradyrhizobium sp. | 99.34 |
S-2B2882c | SARCC-3415 | Bradyrhizobium japonicum | 98.97 |
WBK1 * | SARCC-365 | Rhizobium alanii | 99.31 |
WB96 * | SARCC-361 | Sinorhizobium fredii | 91.36 |
B4:1d * | SARCC-2374 | Bradyrhizobium sp. | 97.23 |
WB69 * | SARCC-337 | Bradyrhizobium sp. | 92.82 |
WB87 * | SARCC-353 | Bradyrhizobium sp. | 97.73 |
S4B2751c * | SARCC-3507 | Rhizobium sp. | 99.92 |
WB74 * | SARCC-340 | Bradyrhizobium diazoefficiens | 99.78 |
Isolates from the Soil | Soya Bean Farm Location | Total Fresh Weight (g) | Total Dry Weight (g) | Nodule Number | Nodule Dry Weight (g) |
---|---|---|---|---|---|
B-1B3041c | Bothaville | 13.41 a | 1.897 ab | 28.80 bcd | 0.085 bcde |
S-2B2792a | Standerton | 13.39 a | 1.945 a | 29.37 bcd | 0.090 abc |
S-4B2783b | Standerton | 13.05 ab | 1.863 abc | 32.52 ab | 0.094 ab |
S-4B2733c | Standerton | 12.79 ab | 1.743 bcdefg | 31.53 abc | 0.098 a |
L-4B253b | Lothair | 12.07 bc | 1.844 bcd | 37.63 a | 0.092 ab |
L-2B2483c | Lothair | 12.07 bc | 1.744 bcde | 27.60 bcde | 0.072 bcde |
B-2B3151b | Bothaville | 11.77 bcd | 1.744 bcde | 31.80 abc | 0.087 abcd |
B-2B3153b | Bothaville | 11.61 bcde | 1.616 abcdefg | 26.72 def | 0.075 cde |
B-5B3041c | Bothaville | 11.44 cdef | 1.463 defgh | 26.80 bcde | 0.091 bcde |
L-4B2392a | Lothair | 11.28 cdef | 1.583 bcdefgh | 25.33 f | 0.071 e |
L-9B2551a | Lothair | 11.22 cdef | 1.765 abcde | 28.07 bcde | 0.090 abc |
B-2B3132b | Bothaville | 11.17 cdef | 1.546 cdefg | 26.67 bcde | 0.072 de |
S-9B283b | Standerton | 11.05 cdefg | 1.569 bcefgh | 25.87 bcde | 0.080 abcde |
S-4B2691a | Standerton | 10.21 efg | 1.517 defg | 16.23 fg | 0.044 fgh |
B-4B3063c | Bothaville | 10.16 fg | 1.463 efgh | 9.47 g | 0.033 fgh |
L-1B2411b | Lothair | 10.15 fg | 1.282 gh | 20.97 ef | 0.055 efg |
B-4B3093a | Bothaville | 9.22 gh | 1.346 hi | 9.95 g | 0.020 hi |
S-4B2751c | Standerton | 10.68 defg | 1.492 efgh | 25.47 bcde | 0.073 bcde |
S-4B2882c | Standerton | 11.68 bcde | 1.696 abcde | 25.87 bcde | 0.071 bcde |
Control | NA | 7.81 h | 1.179 i | 0.000 h | 0.000 i |
LSD | 2.209 | 0.33 | 7345 | 0.023 | |
CV | 40.5 | 41.4 | 60.1 | 70.7 | |
p value | <0.001 | <0.001 | <0.001 | <0.001 |
Cultivar × Rhizobia | Total Fresh Weight (g) | Total Dry Weight (g) | Nodule Number | Nodule Dry Weight (g) |
---|---|---|---|---|
PAN1555R × B1B3041c | 21.09 ± 4.221 a | 2.947 ± 0.205 a | 51.00 ± 22.63 c–l | 0.170 ± 0.028 a–e |
PAN1692R × B2B3151b | 19.26 ± 1.296 a–c | 2.563 ± 0.106 a–i | 62.67 ± 13.05 a–c | 0.160 ± 0.052 a–i |
PAN1644R × S4B2783b | 19.17 ± 4.816 a–d | 2.303 ± 0.637 a–s | 53.00 ± 17.44 b–i | 0.176 ± 0.040 a–e |
LS6851R × B2B3153b | 12.18 ± 10.727 e–H | 1.910 ± 0.070 a–G | 55.50 ± 33.23 b–f | 0.170 ± 0.098 a–d |
PAN1644R × L2B2483c | 18.03 ± 5.524 a–f | 2.707 ± 0.189 a–d | 78.00 ± 36.00 a | 0.183 ± 0.061 a–c |
PAN1644R × B5B3041c | 17.96 ± 4.882 a–g | 2.423 ± 0.767 a–m | 31.00 ± 14.73 j–T | 0.133 ± 0.095 a–n |
LS6851R × L1B2411b | 5.74 ± 9.948 F–Q | 2.600 ± 0.00 a–h | 50.00 ± 0.00 c–m | 0.073 ± 0.127 j–G |
PAN1692R × S4B2751c | 17.14 ± 2.527 a–j | 2.240 ± 0.648 a–t | 53.67 ± 20.51 b–f | 0.176 ± 0.073 a–e |
PAN1644R × S4B2733c | 16.59 ± 3.856 a–o | 2.127 ± 0.285 a–z | 45.67 ± 14.47 c–v | 0.193 ± 0.025 a |
PAN1644R × L9B2551a | 16.58 ± 3.340 a–o | 2.237 ± 0.453 a–u | 49.67 ± 10.41 c–n | 0.193 ± 0.020 a |
LS6851R × S4B2783b | 15.18 ± 5.909 a–t | 2.227 ± 0.407 a–v | 56.00 ± 6.93 a–d | 0.17 ± 0.020 a–e |
PAN1479R × L4B253b | 14.78 ± 0.717 a–u | 2.347 ± 0.155 a–q | 56.33 ± 10.26 a–d | 0.107 ± 0.089 c–u |
PAN1555R × S4B2733c | 14.45 ± 5.601 a–x | 1.910 ± 0.685 a–G | 53.33 ± 12.22 b–h | 0.156 ± 0.032 a–h |
LS6851R × L4B253b | 11.96 ± 6.025 e–J | 1.890 ± 0.528 a–J | 74.00 ± 6.24 ab | 0.190 ± 0.045 ab |
LSD | 6.86 | 1.068 | 23.22 | 0.07 |
CV | 40.5 | 41.4 | 60.1 | 70.7 |
p Value | <0.001 | <0.001 | <0.001 | <0.001 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ndhlovu, K.; Bopape, F.L.; Diale, M.O.; Mpai, T.; Morey, L.; Mtsweni, N.P.; Gerrano, A.S.; Vuuren, A.v.; Babalola, O.O.; Hassen, A.I. Characterization of Nodulation-Compatible Strains of Native Soil Rhizobia from the Rhizosphere of Soya Bean (Glycine max L.) Fields in South Africa. Nitrogen 2024, 5, 1107-1123. https://doi.org/10.3390/nitrogen5040071
Ndhlovu K, Bopape FL, Diale MO, Mpai T, Morey L, Mtsweni NP, Gerrano AS, Vuuren Av, Babalola OO, Hassen AI. Characterization of Nodulation-Compatible Strains of Native Soil Rhizobia from the Rhizosphere of Soya Bean (Glycine max L.) Fields in South Africa. Nitrogen. 2024; 5(4):1107-1123. https://doi.org/10.3390/nitrogen5040071
Chicago/Turabian StyleNdhlovu, Khumbudzo, Francina Lebogang Bopape, Mamonokane Olga Diale, Tiisetso Mpai, Liesl Morey, Nompumelelo Prudence Mtsweni, Abe Shegro Gerrano, Ansa van Vuuren, Olubukola Oluranti Babalola, and Ahmed Idris Hassen. 2024. "Characterization of Nodulation-Compatible Strains of Native Soil Rhizobia from the Rhizosphere of Soya Bean (Glycine max L.) Fields in South Africa" Nitrogen 5, no. 4: 1107-1123. https://doi.org/10.3390/nitrogen5040071
APA StyleNdhlovu, K., Bopape, F. L., Diale, M. O., Mpai, T., Morey, L., Mtsweni, N. P., Gerrano, A. S., Vuuren, A. v., Babalola, O. O., & Hassen, A. I. (2024). Characterization of Nodulation-Compatible Strains of Native Soil Rhizobia from the Rhizosphere of Soya Bean (Glycine max L.) Fields in South Africa. Nitrogen, 5(4), 1107-1123. https://doi.org/10.3390/nitrogen5040071