Next Article in Journal
The Role of Rotational Thromboelastometry in Early Detection of the Hemostatic Derangements in Neonates with Systemic Candida Infection
Previous Article in Journal
Genome Sequencing Providing Molecular Evidence of Tetrapolar Mating System and Heterothallic Life Cycle for Edible and Medicinal Mushroom Polyporus umbellatus Fr.
Previous Article in Special Issue
Diversity of Cytospora Species Associated with Trunk Diseases of Prunus persica (Peach) in Northern China
 
 
Due to scheduled maintenance work on our database systems, there may be short service disruptions on this website between 10:00 and 11:00 CEST on June 14th.
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Establishment of a Mutant Library for Infection Cushion Development and Identification of a Key Regulatory Gene in Botrytis cinerea

1
College of Plant Sciences, Jilin University, Changchun 130062, China
2
Engineering Research Centre of Forestry Biotechnology, Jilin Province in Beihua University, Jilin 132013, China
*
Author to whom correspondence should be addressed.
J. Fungi 2025, 11(1), 16; https://doi.org/10.3390/jof11010016
Submission received: 28 November 2024 / Revised: 20 December 2024 / Accepted: 27 December 2024 / Published: 29 December 2024
(This article belongs to the Special Issue Biodiversity, Systematics, and Evolution of Plant Pathogenic Fungi)

Abstract

:
Botrytis cinerea, the grey mould fungus affecting over 1400 plant species, employs infection cushion (IC), a branched and claw-like structure formed by mycelia, as a critical strategy to breach host surface barriers. However, the molecular mechanisms underlying IC formation remain largely unexplored. In this study, we utilized a forward genetics approach to establish a large T-DNA tagged population of B. cinerea, which contained 14,000 transformants. Through phenotype screening, we identified 161 mutants with defects in IC development. Detailed analyses revealed that these mutants exhibited various degrees of impairment in IC formation, ranging from complete failure to form ICs to a reduction in the number and maturity of ICs. Further genetic analysis of one of the mutants led to the identification of EXO70, a gene encoding a component of the exocyst complex, as a key regulatory factor in IC development. Mutants with deletion of EXO70 failed to form ICs, confirming its crucial role in the process. The mutant library reported here provides a rich resource for further large-scale identification of genes involved in IC development. Our findings provide valuable insights into the genetic and molecular basis of IC formation and offer new targets for controlling B. cinerea pathogenicity.

1. Introduction

Botrytis cinerea infects over 1400 plant species, causing grey mould disease, which severely threatens agricultural production [1,2,3]. The surface of host plants has powerful physical barriers, including wax, cuticle, and cell wall, which effectively block the invasion of most pathogens. As a notorious and successful crop killer, B. cinerea has evolved strategies to break through these barriers, one of which is the infection cushion (IC), a branched and claw-like structure, with the infectious tip formed by clusters of short, bead-like cells [4,5]. By forming this large, sometimes exaggerated, infection structure, B. cinerea can breach most of the host’s physical barriers and invade the plant, creating opportunities for further parasitic establishment.
B. cinerea primarily uses conidia as the source of primary and secondary infections, which are spread via wind, rain, irrigation, or agricultural activities [6]. Upon reaching the plant surface, conidium germinate and form a germ tube under cool and high-humidity conditions. The tip of the germ tube is induced by host surface signals to develop into appressorium or further branch out to form a more complex and powerful IC for host penetration. Germ tubes can also invade through decaying flowers, wounds, or necrotic tissues [4]. Inoculation experiments have shown that when conidial concentrations are as low as 2 × 10⁴ mL⁻1, B. cinerea primarily penetrates hosts via ICs [7]. Given the dispersion pattern of conidia in the field, low concentrations are a common scenario, making ICs play an important role in the penetration process [5].
Despite the critical role of ICs in pathogenesis, their developmental mechanisms remain poorly understood, with limited research available. Due to a historical lack of attention to IC development, many studies focused on the pathogenicity genes of B. cinerea have not analyzed the phenotype of mutants related to IC formation. Instead, we can only rely on detailed descriptions of pathogenicity in the literature to infer whether relevant genes are involved in IC development.
The formation of ICs requires two types of signals. One is the developmental state (or developmental signal), where only mature hyphae have the potential to develop into ICs. Germ tubes from conidia lack this ability, and must further branch and grow into mature hyphae before developing ICs. The second signal is a hard interface, such as the surface of plant leaves or fruits. In the laboratory, hydrophobic plastic covers and hydrophilic glass slides can both induce the formation of ICs from mature hyphae when they contact these hard surfaces [8]. B. cinerea likely perceives host surface signals through surface receptors or proteins, such as G-protein-coupled receptors or the signaling mucin Msb2 [9], which then transduce the signals into hyphal cells. Intracellular signaling is dependent on two classical signaling pathways: the cAMP pathway and the MAPK pathway. Mutants with deficient key components of the cAMP pathway, such as Δbcg3 (G-protein deletion strain) and Δbac (adenylate cyclase deletion strain), lose their ability to invade the host [10,11,12]. Similarly, mutants with knockouts of key MAPK signaling components, such as Ste11 (MAPKKK), Ste7 (MAPKK), bmp1 (MAPK), Ste50 (MAP kinase adaptor), and Ste12 (MAPK downstream transcription factor), also lose host invasion ability [11,13]. Additionally, studies have shown that reactive oxygen species (ROS) also regulate the development of ICs. Superoxide anions (O₂) produced by NADPH oxidase are involved in this regulation, as NADPH oxidase mutants (ΔnoxA, ΔnoxD) and their regulatory protein mutant ΔnoxR cannot form ICs [14]. Recently, our team found that knocking out the ribosomal 60S subunit assembly protein Nop53 causes B. cinerea to completely lose the ability to form ICs, suggesting that the normal functioning of the protein synthesis machinery is crucial for IC formation [15]. By knocking out the core septin Sep4 in both B. cinerea and the rice blast fungus, we identified that Sep4 regulates the initial development of infection structures such as appressoria and ICs [16]. Preliminary studies indicated that Sep4 functions downstream of cAMP, ROS, and other signaling pathways, to mediate the initiation of infection structure development [16]. Our recent work showed that deletion of the histone H3 demethylase Jar1 disrupts the subcellular localization of Sep4, and these mutants completely lose the ability to form ICs, indicating that Sep4’s function is regulated at the DNA level [17].
To thoroughly unravel the mechanisms behind IC development in B. cinerea, we need to identify more genes involved in this process. The most effective way to achieve this goal is the forward genetics approach [18,19]. By creating a high-throughput mutant library with defects in IC development, we can conduct large-scale identification of associated genes and analyze their functions and mechanisms. This would provide new insights and potential entry points for a comprehensive understanding of the formation and function of ICs, the key infection structure of B. cinerea. In this study, we used the Agrobacterium tumefaciens-mediated transformation (ATMT) method to transform B. cinerea and established a large T-DNA-tagged population containing 14,000 transformants. Through phenotype analysis, we identified 161 mutants with defects in IC development, establishing a large mutant library. We analyzed the T-DNA insertion site of a mutant that was unable to form ICs and identified the tagged gene as EXO70, which encodes a component of the exocyst. Upon knocking out this gene, we found that the deletion mutant lost the ability to form ICs. This result validates the effectiveness of the mutant library we established. The IC development-deficient mutant library we have reported here provides a solid foundation for further large-scale identification of genes involved in IC development and for unraveling the developmental mechanisms of this large infection structure.

2. Materials and Methods

2.1. Fungal Strains and Culture Conditions

B. cinerea strains used here are listed in Table 1. The wild-type (WT) strain B05.10 and its derived strains, including random T-DNA insertional transformants, the knockout mutant ∆exo70, and the complemented strain ∆exo70-C, were cultured on potato dextrose agar (PDA) plates, as previously described [16]. Strains were stored on PDA in Eppendorf tubes at 4 °C or covered with 20% glycerol at −20 °C.

2.2. Creation of T-DNA Randomly Insertional Transformant Population of B. cinerea

For creating the T-DNA randomly insertional transformant population of B. cinerea, the binary vector pBHt2 (Table 2), was used to transform the WT strain B05.10 via the Agrobacterium tumefaciens-mediated transformation (ATMT) method, as described [16], with PDA plates containing 100 mg/L hygromycin as the selection condition.

2.3. Screening Method of IC Formation-Deficient Mutants

For IC induction, fresh mycelial plugs taken from edges of the colony were inoculated on glass slides, cultured at 20 °C, and observed at 20–40 h. Each strain was subjected to three biological replicates, with three technical replicates per replicate. For each sample, six random fields were observed, and transformants with an IC count less than 20% of the wild-type number, or those unable to form mature ICs, were categorized as IC formation-deficient mutants. For quantitative analysis, each strain was evaluated according to the IC rank based on the percentage of IC number to the wild type: 5 (80–100%), 4 (50–80%), 3 (20–50%; or unmature), 2 (10–20%), 1 (<10%), 0 (0%). Conidia were also observed for IC development, with 10 μL conidial suspensions [105 conidia/mL in 1/2 potato dextrose broth (PDB)] inoculated on glass slides.

2.4. Identification of T-DNA-Tagged Genes

Thermal asymmetric interlaced-PCR (TAIL-PCR) was employed to identify T-DNA insertion sites in the genome of mutants with the method described previously [21,23,24]. Briefly, three specific nested primers annealing to the T-DNA right border and an arbitrary primer (Table 3) were used to amplify the flank sequence of inserted T-DNA. By sequencing and the following sequence analysis, the T-DNA insertion sites in the mutant genomes were identified, and T-DNA-tagged genes were confirmed, consequently.

2.5. Gene Knockout and Genetic Complementation

Vectors and primers used in this study are listed in Table 2 and Table 3, respectively. The gene replacement method was used for EXO70 knockout. The vector pXEH, containing the hygromycin resistance gene HPH [16], was used to construct the knockout vector. The 5’- and 3’- homologous flanks of EXO70 were amplified with Q5 high-fidelity DNA polymerase (NEB, Ipswich, MA, USA), and cloned into pXEH in the upstream and downstream of HPH, respectively. The resultant vector pEXO-KO was transformed into B. cinerea via the ATMT method. The transformants were selected on PDA plates supplemented with 100 mg/L hygromycin.
The vector pSULPHGFP [22], resistant to chlorimuron ethyl, was used to generate the complemented strain ∆exo70-C. The full fragment of EXO70 was amplified by PCR and cloned into pSULPHGFP to generate the complemented vector pEXO-C, which was then transformed into ∆exo70. The transformants were selected on DCM plates containing 100 mg/L chlorimuron ethyl, as previously described [25].
The EXO70 deletion mutants and complemented strains were further confirmed by quantitative reverse transcription PCR (qRT-PCR) [26]. DNA and RNA were extracted as previously described [27,28].

2.6. Growth and Conidiation Assays

The growth and conidiation assays of B. cinerea were performed as previously described [16]. Briefly, the growth was determined by measuring the colony diameter of the cultures on PDA at 72 h. For quantitative analysis, each mutant strain was evaluated according to the growth rank based on the percentage of colony diameter to the wild type: 5 (80–100%), 4 (50–80%), 3 (20–50%), 2 (10–20%), 1 (<10%). For conidiation, PDA cultures were induced with light at 20–25 °C and conidial number per plate was calculated using a hemocytometer at 12 days post inoculation (DPI).

2.7. Pathogenicity Assays

Pathogenicity was assayed as described previously [16]. Briefly, mycelial plugs (5 mm in diameter) were inoculated on detached green bean leaves, incubated in plastic containers with high humidity at 20–25 °C, and observed at 48 h post inoculation (HPI). Plugs derived from the wild-type strain B05.10 or blank plates were used as controls.

2.8. Statistical Analysis

All the quantitative data resulted from triplicate experiments, independently. The significance of the data was assessed using the Student’s t-tests, and a p-value lower than 0.05 was considered to be statistically significant.

3. Results

3.1. Establishment of a T-DNA-Tagged Population Using the ATMT Method

B. cinerea is a highly successful crop killer, but its IC developmental mechanisms remain poorly understood. To identify genes involved in IC formation on a large scale, we employed a forward genetics approach and used the ATMT method to transform B. cinerea. After screening with hygromycin, we established a large T-DNA-tagged population containing 14,000 transformants. Each transformant in this population contains at least one randomly inserted T-DNA in its genome. The insertion of T-DNA may inactivate native genes (e.g., by inserting into coding regions) or reduce their expression levels (e.g., by inserting into promoter regions or UTRs) [29]. Therefore, this T-DNA-tagged population lays the foundation for screening mutants with defects in IC development.

3.2. Screening of IC Formation-Deficient Mutants

We next evaluated the IC development phenotypes of the T-DNA-tagged population mentioned above. We used a simple and effective method to induce ICs by placing mycelial plugs onto glass slides. Under this induction condition, the wild-type strain B05.10 typically forms a large number of ICs at 20 h, with more than 20 ICs per 10 × 10 microscopic field. Considering that some mutants may exhibit slower growth, which could theoretically delay the formation of ICs, we doubled the induction time to 40 h. Additionally, since there will be variability in the IC formation phenotype between replicates, we refined our screening criteria to better identify mutants with defects in IC development. For each tested strain, we counted the number of ICs per microscope field under 10 × 10 magnification. Strains with fewer than 20% of the wild-type IC number were classified as mutants with deficient IC formation. Using this stringent screening approach, we identified 161 mutants with significantly reduced IC development from the T-DNA-tagged population (Table 4), thereby establishing a refined mutant library of B. cinerea with defects in IC development.

3.3. Phenotype Analysis of B. cinerea IC Development-Deficient Mutants

We conducted a detailed phenotype analysis of the IC development-deficient mutants (Table 4 and Table 5). Our results showed that some mutants completely lost the ability to form ICs, while others had impaired IC formation and could only develop immature primary ICs (Figure 1a). Additionally, some mutants exhibited a significant reduction in the number of ICs formed (Figure 1b).
Among the 161 mutants, 86 were unable to form ICs. Over half of these strains (54 mutants) showed significantly slower hyphal growth, and 37 of 54 strains exhibited very slow growth. This indicates that genes important for hyphal growth often play crucial roles in IC development, particularly in the initiation of IC formation, likely because these mutants failed to form ICs from the beginning. When these genes were inactivated by T-DNA insertion, the mutants lost the ability to initiate IC development, resulting in the failure to form ICs and a marked reduction in hyphal growth. Another 32 mutants grew normally, suggesting that the mutated genes are specifically required for IC development but are not essential for hyphal growth.
Among the 161 mutants, 29 showed a significant reduction in the number of ICs formed (Table 5), with fewer than 20% of the wild-type number. Approximately one-third of these mutants (9 strains) had slightly slower growth, while the remaining two-thirds (20 strains) grew normally. There were also 44 mutants in the library that were hampered in IC formation and did not form mature ICs. Most of these mutants grew normally.
To analyze the relationship between IC development and conidiation, we randomly selected 10 mutants with defects in IC development (M4, M6, M15, M21, M22, M24, M32, M33, M50, M59, M135) and examined their conidiation ability. We found that only two mutants (M4 and M135) were able to produce conidia, while the other eight mutants were unable to produce conidia. This suggests that the processes of IC formation and conidiation are highly overlapping, and many genes are involved in both developmental processes.

3.4. Functional Identification of a Key Regulatory Gene for IC Development in B. cinerea

From the established mutant library, we randomly selected a mutant, M12, which was unable to form ICs for further investigation. Using TAIL-PCR amplification and sequence analysis, we found that the T-DNA was inserted into the 5′ UTR region of the EXO70 gene in this mutant. EXO70 encodes a core component of the exocyst complex, which is responsible for the transport of secretory vesicles to the apical membrane of hyphae, where these vesicles fuse with the membrane to release their contents or become incorporated into the membrane, playing an essential role in processes such as hyphal growth and development.
In B. cinerea, EXO70 has been reported to be involved in growth, conidiation, sclerotia production, and virulence [30]. However, whether it plays a role in IC development remains unclear. To confirm whether the inability of mutant M12 to form ICs was due to the T-DNA insertion in the 5’ UTR region of EXO70, we created two independent EXO70 knockouts, KO1 and KO2, in the wild-type strain B05.10 (Figure 2a,b).
Our data showed that EXO70 is involved in both growth (Figure 2c,f) and pathogenicity (Figure 2d,g), which is consistent with previous reports [30]. Similar to the phenotype of the T-DNA insertion mutant M12, we found that the EXO70 knockout strains completely lost the ability to form ICs (Figure 2e,h). When induced on glass slides for 48 h, the mutant was unable to initiate IC formation. Given that the EXO70 knockout mutants exhibited significantly slower growth, we extended the observation time to 96 h, but the mutants still failed to initiate IC formation. In contrast, the complemented strain fully restored IC formation, showing no significant difference from the wild-type strain.
These results indicate that EXO70 is a key regulatory factor for IC formation in B. cinerea and plays a critical role in the initiation of IC development, likely because the knockout mutants failed to form ICs from the outset.

4. Discussion

The development of IC in B. cinerea plays a pivotal role in the fungus’s ability to breach plant physical defenses and establish infection. Despite its importance in pathogenesis, the molecular mechanisms that regulate IC formation have been poorly understood. In this study, we established a comprehensive T-DNA insertion mutant library to identify genes involved in IC development. By screening 14,000 transformants, we identified 161 mutants with defective IC formation, providing a valuable resource for dissecting the genetic pathways underlying this critical infection process.
Our screening results revealed a range of phenotypes among the mutants. Some mutants completely failed to form ICs, while others displayed partial defects, such as the formation of immature or fewer ICs. Interestingly, many of the mutants with severe defects in IC development also exhibited slow or impaired hyphal growth, indicating that the genes required for IC formation are often involved in fundamental processes such as hyphal growth and development. This observation aligns with previous studies showing that signaling pathways and cellular processes regulating growth, such as the cAMP and MAPK pathways, also influence host-penetration ability [10,13]. Additionally, the development of the IC is strongly correlated with conidiation. Mutants with severe defects in the IC often show a significant reduction in their ability to produce conidia. Their pathogenicity phenotype is found to be complex, and a separate, more comprehensive follow-up study would be needed. EXO70 serves as a typical example. We found that the EXO70 deletion mutants are unable to form ICs. Previous reports and our data have indicated that mutants lacking this gene have difficulty forming conidia. It is also noteworthy that some mutants grew normally but exhibited specific defects in IC formation, suggesting that distinct regulatory mechanisms may control these processes independently.
A key finding of our study was the identification of EXO70 as a critical regulator of IC formation. EXO70 encodes a component of the exocyst complex, which is involved in vesicle trafficking and membrane fusion, processes essential for hyphal growth and cellular development. Our results show that the disruption of EXO70 completely abolished IC formation, confirming its role in this key aspect of pathogenicity. The observation that the EXO70 knockout strains also exhibited impaired growth further underscores the importance of vesicle trafficking in both vegetative growth and the development of infection structures. These findings are consistent with the broader role of EXO70 in other fungal processes, such as host penetration, virulence, and secretion of effectors [31,32,33].
The involvement of EXO70 in IC formation adds new knowledge to our understanding of the cellular machinery underlying fungal pathogenesis. Given its essential role in the trafficking of vesicles to the apical membrane, EXO70 likely mediates the delivery of critical proteins and membrane components necessary for the morphogenesis of infection structures. This suggests that IC development may rely on tightly regulated exocytosis and membrane dynamics, processes that could be targeted for the development of new antifungal strategies.
In addition to EXO70, our mutant library provides a wealth of other candidate genes that may regulate IC development. The diversity of phenotypes observed in the mutants suggests that multiple signaling pathways, including those involved in growth, environmental sensing, and cellular stress responses, contribute to the formation of ICs. Future studies focused on the functional characterization of these genes will help uncover the intricate regulatory networks that coordinate infection structure development in B. cinerea.
In conclusion, the establishment of the IC-deficient mutant library and the identification of EXO70 as a key regulatory gene for IC development represent significant advances in our understanding of B. cinerea pathogenesis. This study lays the groundwork for future genetic and biochemical investigations into the molecular mechanisms governing IC formation, and will offer new targets for controlling the devastating impact of B. cinerea on crop production.

Author Contributions

Conceptualization, G.L.; methodology, M.T., K.W., P.Z., J.H., X.Y., H.W., Y.W. and G.L.; formal analysis, M.T. and G.L.; investigation, M.T. and G.L.; resources, G.L.; data curation, G.L.; writing—original draft preparation, M.T. and G.L.; writing—review and editing, G.L.; visualization, M.T. and G.L.; supervision, G.L.; project administration, G.L.; funding acquisition, G.L. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Natural Science Foundation of China (No. 32372489) and the Natural Science Foundation of Jilin Province, China (No. 20220101279JC). The APC was funded by the National Natural Science Foundation of China (No. 32372489).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Data are contained within the article.

Acknowledgments

The authors would like to thank the anonymous reviewers for their constructive comments on this article.

Conflicts of Interest

The authors declare no conflicts of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript, or in the decision to publish the results.

References

  1. Elad, Y.; Fillinger, S. Botrytis—The Fungus, The Pathogen and Its Management in Agricultural Systems; Springer: New York, NY, USA, 2016. [Google Scholar] [CrossRef]
  2. You, Y.; Suraj, H.M.; Matz, L.; Herrera Valderrama, A.L.; Ruigrok, P.; Shi-Kunne, X.; Pieterse, F.P.J.; Oostlander, A.; Beenen, H.G.; Chavarro-Carrero, E.A.; et al. Botrytis cinerea combines four molecular strategies to tolerate membrane-permeating plant compounds and to increase virulence. Nat. Commun. 2024, 15, 6448. [Google Scholar] [CrossRef] [PubMed]
  3. Dean, R.; Van Kan, J.A.; Pretorius, Z.A.; Hammond-Kosack, K.E.; Di Pietro, A.; Spanu, P.D.; Rudd, J.J.; Dickman, M.; Kahmann, R.; Ellis, J.; et al. The Top 10 fungal pathogens in molecular plant pathology. Mol. Plant Pathol. 2012, 13, 414–430. [Google Scholar] [CrossRef] [PubMed]
  4. Choquer, M.; Fournier, E.; Kunz, C.; Levis, C.; Pradier, J.M.; Simon, A.; Viaud, M. Botrytis cinerea virulence factors: New insights into a necrotrophic and polyphageous pathogen. FEMS Microbiol. Lett. 2007, 277, 1–10. [Google Scholar] [CrossRef] [PubMed]
  5. Choquer, M.; Rascle, C.; Goncalves, I.R.; de Vallee, A.; Ribot, C.; Loisel, E.; Smilevski, P.; Ferria, J.; Savadogo, M.; Souibgui, E.; et al. The infection cushion of Botrytis cinerea: A fungal ‘weapon’ of plant-biomass destruction. Environ. Microbiol. 2021, 23, 2293–2314. [Google Scholar] [CrossRef]
  6. Petrasch, S.; Knapp, S.J.; van Kan, J.A.L.; Blanco-Ulate, B. Grey mould of strawberry, a devastating disease caused by the ubiquitous necrotrophic fungal pathogen Botrytis cinerea. Mol. Plant Pathol. 2019, 20, 877–892. [Google Scholar] [CrossRef]
  7. Van den Heuvel, J.; Waterreus, L.P. Conidial concentration as an important factor determining the type of prepenetration structures formed by Botrytis cinerea on leaves of French bean (Phaseolus vulgaris). Plant Pathol. 1983, 32, 263–272. [Google Scholar] [CrossRef]
  8. Backhouse, D.; Willetts, H. Development and structure of infection cushions of Botrytis cinerea. Trans. Br. Mycol. Soc. 1987, 89, 89–95. [Google Scholar] [CrossRef]
  9. Leroch, M.; Mueller, N.; Hinsenkamp, I.; Hahn, M. The signalling mucin Msb2 regulates surface sensing and host penetration via BMP1 MAP kinase signalling in Botrytis cinerea. Mol. Plant Pathol. 2015, 16, 787–798. [Google Scholar] [CrossRef]
  10. Doehlemann, G.; Berndt, P.; Hahn, M. Different signalling pathways involving a Galpha protein, cAMP and a MAP kinase control germination of Botrytis cinerea conidia. Mol. Microbiol. 2006, 59, 821–835. [Google Scholar] [CrossRef]
  11. Williamson, B.; Tudzynski, B.; Tudzynski, P.; van Kan, J.A. Botrytis cinerea: The cause of grey mould disease. Mol. Plant Pathol. 2007, 8, 561–580. [Google Scholar] [CrossRef]
  12. Chen, X.; Zhang, X.; Zhu, P.; Wang, Y.; Na, Y.; Guo, H.; Cai, Y.; Nie, H.; Jiang, Y.; Xu, L. A Single Nucleotide Mutation in Adenylate Cyclase Affects Vegetative Growth, Sclerotial Formation and Virulence of Botrytis cinerea. Int. J. Mol. Sci. 2020, 21, 2912. [Google Scholar] [CrossRef] [PubMed]
  13. Schamber, A.; Leroch, M.; Diwo, J.; Mendgen, K.; Hahn, M. The role of mitogen-activated protein (MAP) kinase signalling components and the Ste12 transcription factor in germination and pathogenicity of Botrytis cinerea. Mol. Plant Pathol. 2010, 11, 105–119. [Google Scholar] [CrossRef] [PubMed]
  14. Marschall, R.; Tudzynski, P. BcIqg1, a fungal IQGAP homolog, interacts with NADPH oxidase, MAP kinase and calcium signaling proteins and regulates virulence and development in Botrytis cinerea. Mol. Microbiol. 2016, 101, 281–298. [Google Scholar] [CrossRef] [PubMed]
  15. Cao, S.N.; Yuan, Y.; Qin, Y.H.; Zhang, M.Z.; de Figueiredo, P.; Li, G.H.; Qin, Q.M. The pre-rRNA processing factor Nop53 regulates fungal development and pathogenesis via mediating production of reactive oxygen species. Environ. Microbiol. 2018, 20, 1531–1549. [Google Scholar] [CrossRef]
  16. Feng, H.Q.; Li, G.H.; Du, S.W.; Yang, S.; Li, X.Q.; de Figueiredo, P.; Qin, Q.M. The septin protein Sep4 facilitates host infection by plant fungal pathogens via mediating initiation of infection structure formation. Environ. Microbiol. 2017, 19, 1730–1749. [Google Scholar] [CrossRef]
  17. Hou, J.; Feng, H.Q.; Chang, H.W.; Liu, Y.; Li, G.H.; Yang, S.; Sun, C.H.; Zhang, M.Z.; Yuan, Y.; Sun, J.; et al. The H3K4 demethylase Jar1 orchestrates ROS production and expression of pathogenesis-related genes to facilitate Botrytis cinerea virulence. New Phytol. 2020, 225, 930–947. [Google Scholar] [CrossRef]
  18. Jeon, J.; Park, S.Y.; Chi, M.H.; Choi, J.; Park, J.; Rho, H.S.; Kim, S.; Goh, J.; Yoo, S.; Choi, J.; et al. Genome-wide functional analysis of pathogenicity genes in the rice blast fungus. Nat. Genet. 2007, 39, 561–565. [Google Scholar] [CrossRef]
  19. Giesbert, S.; Schumacher, J.; Kupas, V.; Espino, J.; Segmuller, N.; Haeuser-Hahn, I.; Schreier, P.H.; Tudzynski, P. Identification of pathogenesis-associated genes by T-DNA-mediated insertional mutagenesis in Botrytis cinerea: A type 2A phosphoprotein phosphatase and an SPT3 transcription factor have significant impact on virulence. Mol. Plant Microbe Interact. 2012, 25, 481–495. [Google Scholar] [CrossRef]
  20. Quidde, T.; Osbourn, A.; Tudzynski, P. Detoxification of α-tomatine by Botrytis cinerea. Physiol. Mol. Plant Pathol. 1998, 52, 151–165. [Google Scholar] [CrossRef]
  21. Mullins, E.D.; Chen, X.; Romaine, P.; Raina, R.; Geiser, D.M.; Kang, S. Agrobacterium-Mediated Transformation of Fusarium oxysporum: An Efficient Tool for Insertional Mutagenesis and Gene Transfer. Phytopathology 2001, 91, 173–180. [Google Scholar] [CrossRef]
  22. Sesma, A.; Osbourn, A.E. The rice leaf blast pathogen undergoes developmental processes typical of root-infecting fungi. Nature 2004, 431, 582–586. [Google Scholar] [CrossRef]
  23. Liu, Y.G.; Whittier, R.F. Thermal asymmetric interlaced PCR: Automatable amplification and sequencing of insert end fragments from P1 and YAC clones for chromosome walking. Genomics 1995, 25, 674–681. [Google Scholar] [CrossRef]
  24. Wang, Z.; Ye, S.; Li, J.; Zheng, B.; Bao, M.; Ning, G. Fusion primer and nested integrated PCR (FPNI-PCR): A new high-efficiency strategy for rapid chromosome walking or flanking sequence cloning. BMC Biotechnol. 2011, 11, 109. [Google Scholar] [CrossRef] [PubMed]
  25. Sweigard, J.; Chumley, F.; Carroll, A.; Farrall, L.; Valent, B. A series of vectors for fungal transformation. Fungal Genet. Rep. 1997, 44, 52–53. [Google Scholar] [CrossRef]
  26. Weiberg, A.; Wang, M.; Lin, F.M.; Zhao, H.; Zhang, Z.; Kaloshian, I.; Huang, H.D.; Jin, H. Fungal small RNAs suppress plant immunity by hijacking host RNA interference pathways. Science 2013, 342, 118–123. [Google Scholar] [CrossRef] [PubMed]
  27. Chi, M.H.; Park, S.Y.; Lee, Y.H. A Quick and Safe Method for Fungal DNA Extraction. Plant Pathol. J. 2009, 25, 108–111. [Google Scholar] [CrossRef]
  28. Lecellier, G.; Silar, P. Rapid methods for nucleic acids extraction from Petri dish-grown mycelia. Curr. Genet. 1994, 25, 122–123. [Google Scholar] [CrossRef]
  29. Li, G.; Zhou, Z.; Liu, G.; Zheng, F.; He, C. Characterization of T-DNA insertion patterns in the genome of rice blast fungus Magnaporthe oryzae. Curr. Genet. 2007, 51, 233–243. [Google Scholar] [CrossRef]
  30. Guan, W.; Feng, J.; Wang, R.; Ma, Z.; Wang, W.; Wang, K.; Zhu, T. Functional analysis of the exocyst subunit BcExo70 in Botrytis cinerea. Curr. Genet. 2020, 66, 85–95. [Google Scholar] [CrossRef]
  31. Giraldo, M.C.; Dagdas, Y.F.; Gupta, Y.K.; Mentlak, T.A.; Yi, M.; Martinez-Rocha, A.L.; Saitoh, H.; Terauchi, R.; Talbot, N.J.; Valent, B. Two distinct secretion systems facilitate tissue invasion by the rice blast fungus Magnaporthe oryzae. Nat. Commun. 2013, 4, 1996. [Google Scholar] [CrossRef]
  32. Giraldo, M.C.; Valent, B. Filamentous plant pathogen effectors in action. Nat. Rev. Microbiol. 2013, 11, 800–814. [Google Scholar] [CrossRef]
  33. Gupta, Y.K.; Dagdas, Y.F.; Martinez-Rocha, A.L.; Kershaw, M.J.; Littlejohn, G.R.; Ryder, L.S.; Sklenar, J.; Menke, F.; Talbot, N.J. Septin-Dependent Assembly of the Exocyst Is Essential for Plant Infection by Magnaporthe oryzae. Plant Cell 2015, 27, 3277–3289. [Google Scholar] [CrossRef]
Figure 1. Phenotypes of several representative infection cushion (IC) development-deficient mutants of B. cinerea. (a) Mutants that do not form ICs or whose ICs cannot mature. Mycelial plugs of the tested strains were inoculated on glass slides to induce IC development and observed at 40 h post inoculation (HPI). Bar = 50 μm. (b) Mutants with a significantly reduced number of ICs. Conidial suspensions (105 conidia/mL in 1/2 PDB) of the tested strains were inoculated on glass slides to induce IC development and observed at 40 HPI. Bar = 100 μm. WT, the wild-type strain B05.10. Other strains are selected typical T-DNA-tagged mutants.
Figure 1. Phenotypes of several representative infection cushion (IC) development-deficient mutants of B. cinerea. (a) Mutants that do not form ICs or whose ICs cannot mature. Mycelial plugs of the tested strains were inoculated on glass slides to induce IC development and observed at 40 h post inoculation (HPI). Bar = 50 μm. (b) Mutants with a significantly reduced number of ICs. Conidial suspensions (105 conidia/mL in 1/2 PDB) of the tested strains were inoculated on glass slides to induce IC development and observed at 40 HPI. Bar = 100 μm. WT, the wild-type strain B05.10. Other strains are selected typical T-DNA-tagged mutants.
Jof 11 00016 g001
Figure 2. EXO70 is essential for IC development of B. cinerea. (a) Strategy for generation of EXO70 knockout strain Δexo70 via gene replacement approach. WT, the wild-type strain B05.10; pEXO-KO, EXO70 knockout vector. HPH, the hygromycin resistance gene. Blue lines and green lines indicate genomic sequences and EXO70 homologous flanks, respectively. (b) Molecular identifications of knockout mutants Δexo70 (KO1 and KO2) and the complemented strain Δexo70-C (KO1-C). PCR amplifications were used for detecting HPH upstream recombination (up-rec) with primers NU/Hb-RC, downstream recombination (down-rec) with primers Ha-RC/ND, and EXO70 loss with primers EI-F/EI-R, respectively. Relative EXO70 expression levels in the indicated strains were determined by quantitative reverse transcription PCR (qRT-PCR). (c) Colony of tested strains cultured on PDA. (d) Pathogenicity assays with mycelial plugs inoculated on detached green-bean leaves at 48 HPI. (e) IC development on glass slides at 40 HPI. Bar = 100 μm. (f) Quantification of the colony sizes at 72 h shown in (c). (g) Quantification of the lesion sizes shown in (d). (h) Quantification of the IC numbers shown in (e). ND, not detected. Data represent means ± standard deviations (SD) from at least three independent experiments. **, ***, significance at p < 0.01, 0.001, respectively.
Figure 2. EXO70 is essential for IC development of B. cinerea. (a) Strategy for generation of EXO70 knockout strain Δexo70 via gene replacement approach. WT, the wild-type strain B05.10; pEXO-KO, EXO70 knockout vector. HPH, the hygromycin resistance gene. Blue lines and green lines indicate genomic sequences and EXO70 homologous flanks, respectively. (b) Molecular identifications of knockout mutants Δexo70 (KO1 and KO2) and the complemented strain Δexo70-C (KO1-C). PCR amplifications were used for detecting HPH upstream recombination (up-rec) with primers NU/Hb-RC, downstream recombination (down-rec) with primers Ha-RC/ND, and EXO70 loss with primers EI-F/EI-R, respectively. Relative EXO70 expression levels in the indicated strains were determined by quantitative reverse transcription PCR (qRT-PCR). (c) Colony of tested strains cultured on PDA. (d) Pathogenicity assays with mycelial plugs inoculated on detached green-bean leaves at 48 HPI. (e) IC development on glass slides at 40 HPI. Bar = 100 μm. (f) Quantification of the colony sizes at 72 h shown in (c). (g) Quantification of the lesion sizes shown in (d). (h) Quantification of the IC numbers shown in (e). ND, not detected. Data represent means ± standard deviations (SD) from at least three independent experiments. **, ***, significance at p < 0.01, 0.001, respectively.
Jof 11 00016 g002
Table 1. Strains of Botrytis cinerea used in this study.
Table 1. Strains of Botrytis cinerea used in this study.
StrainDescriptionSource
B05.10Wild-type strain[20]
IC formation-deficient mutants 1Random T-DNA insertional mutants derived from B05.10This study
ΔEXO70B05.10 with EXO70 knocked out, ΔEXO70::HPH This study
ΔEXO70-CThe ectopic complementary strain of ΔEXO70This study
1 IC, infection cushion.
Table 2. Plasmid vectors used in this study.
Table 2. Plasmid vectors used in this study.
VectorDescription Source
pBHt2Binary vector used for generation of T-DNA insertional transformants[21]
pXEHBinary vector used for knockout of fungal genes, containing HPH gene within its T-DNA region; KmR[16]
pSULPHGFPBinary vector containing ILV1 gene (resistance to chlorimuron ethyl) within its T-DNA region; KmR[22]
pEXO-KOConstructed from pXEH, for knockout of EXO70This study
pEXO-CConstructed from pSULPHGFP, for genetic complementation of ΔEXO70This study
Table 3. Primers used in this study.
Table 3. Primers used in this study.
Primer NamePrimer Sequence (5′-3′)
For thermal asymmetric interlaced-PCR (TAIL-PCR)
RB1GGCACTGGCCGTCGTTTTACAAC
RB2AACGTCGTGACTGGGAAAACCCT
RB3CCCTTCCCAACAGTTGCGCA
AD1TGWGNAGWANCASAGA
For construction of EXO70 knockout vector
EXO70-UFCTCGAGTGTGGGAAATGTGGGATG
EXO70-URGAATTCGCACGCTAGACCTAATGC
EXO70-DFTCTAGACCTGTGGGTGAGACGAGA
EXO70-DRAAGCTTAATGCGAAATGCGAAACT
For screening EXO70 knockout strains
NUCGACATAACGAAGTGGGATT
NDAACCCGCAACAACCATAAAC
Ha-RCATGATGCAGCTTGGGCGCA
Hb-RCACAGACGTCGCGGTGAGTTCA
EI-FCCGCCACGGTTCCAATGAC
EI-RTTCCCAAAGCAGGCTTACCA
For genetic complementation of ΔEXO70
EXO70-CFTACCGTCGACGACATAACGAAGTGGGATTG
EXO70-CRCCGCTCTAGAATCACTTATTCACCCGTCCC
For qRT-PCR analysis of Actin
ACT-FCATGGCTGGTCGTGATTTGA
ACT-RGAGGATTGACTGGCGGTTTG
Table 4. Infection cushion (IC) development-deficient mutants of B. cinerea derived from T-DNA random insertions.
Table 4. Infection cushion (IC) development-deficient mutants of B. cinerea derived from T-DNA random insertions.
MutantIC 1Growth 2MutantICGrowthMutantICGrowth
M105M5502M10914
M205M5602M11024
M305M5702M11124
M405M5803M11224
M505M5901M11324
M605M6003M11424
M705M6103M11524
M805M6203M11635
M905M6303M11735
M1005M6403M11825
M1105M6502M11935
M1205M6602M12035
M1305M6702M12135
M1405M6802M12235
M1505M6902M12335
M1605M7002M12435
M1705M7102M12535
M1805M7201M12635
M1905M7302M12725
M2005M7402M12835
M2105M7502M12935
M2205M7602M13035
M2305M7702M13135
M2405M7802M13235
M2505M7902M13335
M2605M8002M13435
M2705M8102M13535
M2805M8201M13635
M2905M8302M13735
M3005M8402M13835
M3105M8502M13935
M3205M8602M14035
M3304M8715M14125
M3404M8815M14235
M3504M8925M14335
M3604M9015M14435
M3704M9115M14535
M3804M9215M14635
M3904M9325M14725
M4004M9425M14835
M4104M9515M14935
M4204M9615M15035
M4304M9715M15134
M4404M9815M15234
M4504M9915M15334
M4604M10025M15424
M4704M10115M15534
M4804M10215M15634
M4904M10315M15722
M5003M10415M15832
M5102M10515M15933
M5203M10615M16035
M5303M10714M16135
M5403M10814WT 355
1 Each strain we evaluated according to the IC rank, based on the percentage of IC number to the wild type; 2 hyphal growth was evaluated according to the growth rank based on the percentage of colony diameter to the wild type. The rating criteria are detailed in the Materials and Methods section. 3 The wild-type strain B05.10.
Table 5. Statistics of the IC developmental phenotypes of the mutant library.
Table 5. Statistics of the IC developmental phenotypes of the mutant library.
IC phenotypenonerare 1unmature 2slow
hyphal growthnormalslow slightlyvery slownormalslow slightlynormalslow slightlyvery slownormal
mutant number32173720935632
total number8629442
1 Mutants with an IC count less than 20% of the wild-type number; 2 mutants with an IC count less than 50% of the wild-type number, most of which were unmature.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Tang, M.; Wang, K.; Zhang, P.; Hou, J.; Yu, X.; Wang, H.; Wang, Y.; Li, G. Establishment of a Mutant Library for Infection Cushion Development and Identification of a Key Regulatory Gene in Botrytis cinerea. J. Fungi 2025, 11, 16. https://doi.org/10.3390/jof11010016

AMA Style

Tang M, Wang K, Zhang P, Hou J, Yu X, Wang H, Wang Y, Li G. Establishment of a Mutant Library for Infection Cushion Development and Identification of a Key Regulatory Gene in Botrytis cinerea. Journal of Fungi. 2025; 11(1):16. https://doi.org/10.3390/jof11010016

Chicago/Turabian Style

Tang, Maoyao, Kexin Wang, Pan Zhang, Jie Hou, Xiaoqian Yu, Hongfu Wang, Yangyizhou Wang, and Guihua Li. 2025. "Establishment of a Mutant Library for Infection Cushion Development and Identification of a Key Regulatory Gene in Botrytis cinerea" Journal of Fungi 11, no. 1: 16. https://doi.org/10.3390/jof11010016

APA Style

Tang, M., Wang, K., Zhang, P., Hou, J., Yu, X., Wang, H., Wang, Y., & Li, G. (2025). Establishment of a Mutant Library for Infection Cushion Development and Identification of a Key Regulatory Gene in Botrytis cinerea. Journal of Fungi, 11(1), 16. https://doi.org/10.3390/jof11010016

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop