Establishment of a Mutant Library for Infection Cushion Development and Identification of a Key Regulatory Gene in Botrytis cinerea
Abstract
1. Introduction
2. Materials and Methods
2.1. Fungal Strains and Culture Conditions
2.2. Creation of T-DNA Randomly Insertional Transformant Population of B. cinerea
2.3. Screening Method of IC Formation-Deficient Mutants
2.4. Identification of T-DNA-Tagged Genes
2.5. Gene Knockout and Genetic Complementation
2.6. Growth and Conidiation Assays
2.7. Pathogenicity Assays
2.8. Statistical Analysis
3. Results
3.1. Establishment of a T-DNA-Tagged Population Using the ATMT Method
3.2. Screening of IC Formation-Deficient Mutants
3.3. Phenotype Analysis of B. cinerea IC Development-Deficient Mutants
3.4. Functional Identification of a Key Regulatory Gene for IC Development in B. cinerea
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Elad, Y.; Fillinger, S. Botrytis—The Fungus, The Pathogen and Its Management in Agricultural Systems; Springer: New York, NY, USA, 2016. [Google Scholar] [CrossRef]
- You, Y.; Suraj, H.M.; Matz, L.; Herrera Valderrama, A.L.; Ruigrok, P.; Shi-Kunne, X.; Pieterse, F.P.J.; Oostlander, A.; Beenen, H.G.; Chavarro-Carrero, E.A.; et al. Botrytis cinerea combines four molecular strategies to tolerate membrane-permeating plant compounds and to increase virulence. Nat. Commun. 2024, 15, 6448. [Google Scholar] [CrossRef] [PubMed]
- Dean, R.; Van Kan, J.A.; Pretorius, Z.A.; Hammond-Kosack, K.E.; Di Pietro, A.; Spanu, P.D.; Rudd, J.J.; Dickman, M.; Kahmann, R.; Ellis, J.; et al. The Top 10 fungal pathogens in molecular plant pathology. Mol. Plant Pathol. 2012, 13, 414–430. [Google Scholar] [CrossRef] [PubMed]
- Choquer, M.; Fournier, E.; Kunz, C.; Levis, C.; Pradier, J.M.; Simon, A.; Viaud, M. Botrytis cinerea virulence factors: New insights into a necrotrophic and polyphageous pathogen. FEMS Microbiol. Lett. 2007, 277, 1–10. [Google Scholar] [CrossRef] [PubMed]
- Choquer, M.; Rascle, C.; Goncalves, I.R.; de Vallee, A.; Ribot, C.; Loisel, E.; Smilevski, P.; Ferria, J.; Savadogo, M.; Souibgui, E.; et al. The infection cushion of Botrytis cinerea: A fungal ‘weapon’ of plant-biomass destruction. Environ. Microbiol. 2021, 23, 2293–2314. [Google Scholar] [CrossRef]
- Petrasch, S.; Knapp, S.J.; van Kan, J.A.L.; Blanco-Ulate, B. Grey mould of strawberry, a devastating disease caused by the ubiquitous necrotrophic fungal pathogen Botrytis cinerea. Mol. Plant Pathol. 2019, 20, 877–892. [Google Scholar] [CrossRef]
- Van den Heuvel, J.; Waterreus, L.P. Conidial concentration as an important factor determining the type of prepenetration structures formed by Botrytis cinerea on leaves of French bean (Phaseolus vulgaris). Plant Pathol. 1983, 32, 263–272. [Google Scholar] [CrossRef]
- Backhouse, D.; Willetts, H. Development and structure of infection cushions of Botrytis cinerea. Trans. Br. Mycol. Soc. 1987, 89, 89–95. [Google Scholar] [CrossRef]
- Leroch, M.; Mueller, N.; Hinsenkamp, I.; Hahn, M. The signalling mucin Msb2 regulates surface sensing and host penetration via BMP1 MAP kinase signalling in Botrytis cinerea. Mol. Plant Pathol. 2015, 16, 787–798. [Google Scholar] [CrossRef]
- Doehlemann, G.; Berndt, P.; Hahn, M. Different signalling pathways involving a Galpha protein, cAMP and a MAP kinase control germination of Botrytis cinerea conidia. Mol. Microbiol. 2006, 59, 821–835. [Google Scholar] [CrossRef]
- Williamson, B.; Tudzynski, B.; Tudzynski, P.; van Kan, J.A. Botrytis cinerea: The cause of grey mould disease. Mol. Plant Pathol. 2007, 8, 561–580. [Google Scholar] [CrossRef]
- Chen, X.; Zhang, X.; Zhu, P.; Wang, Y.; Na, Y.; Guo, H.; Cai, Y.; Nie, H.; Jiang, Y.; Xu, L. A Single Nucleotide Mutation in Adenylate Cyclase Affects Vegetative Growth, Sclerotial Formation and Virulence of Botrytis cinerea. Int. J. Mol. Sci. 2020, 21, 2912. [Google Scholar] [CrossRef] [PubMed]
- Schamber, A.; Leroch, M.; Diwo, J.; Mendgen, K.; Hahn, M. The role of mitogen-activated protein (MAP) kinase signalling components and the Ste12 transcription factor in germination and pathogenicity of Botrytis cinerea. Mol. Plant Pathol. 2010, 11, 105–119. [Google Scholar] [CrossRef] [PubMed]
- Marschall, R.; Tudzynski, P. BcIqg1, a fungal IQGAP homolog, interacts with NADPH oxidase, MAP kinase and calcium signaling proteins and regulates virulence and development in Botrytis cinerea. Mol. Microbiol. 2016, 101, 281–298. [Google Scholar] [CrossRef] [PubMed]
- Cao, S.N.; Yuan, Y.; Qin, Y.H.; Zhang, M.Z.; de Figueiredo, P.; Li, G.H.; Qin, Q.M. The pre-rRNA processing factor Nop53 regulates fungal development and pathogenesis via mediating production of reactive oxygen species. Environ. Microbiol. 2018, 20, 1531–1549. [Google Scholar] [CrossRef]
- Feng, H.Q.; Li, G.H.; Du, S.W.; Yang, S.; Li, X.Q.; de Figueiredo, P.; Qin, Q.M. The septin protein Sep4 facilitates host infection by plant fungal pathogens via mediating initiation of infection structure formation. Environ. Microbiol. 2017, 19, 1730–1749. [Google Scholar] [CrossRef]
- Hou, J.; Feng, H.Q.; Chang, H.W.; Liu, Y.; Li, G.H.; Yang, S.; Sun, C.H.; Zhang, M.Z.; Yuan, Y.; Sun, J.; et al. The H3K4 demethylase Jar1 orchestrates ROS production and expression of pathogenesis-related genes to facilitate Botrytis cinerea virulence. New Phytol. 2020, 225, 930–947. [Google Scholar] [CrossRef]
- Jeon, J.; Park, S.Y.; Chi, M.H.; Choi, J.; Park, J.; Rho, H.S.; Kim, S.; Goh, J.; Yoo, S.; Choi, J.; et al. Genome-wide functional analysis of pathogenicity genes in the rice blast fungus. Nat. Genet. 2007, 39, 561–565. [Google Scholar] [CrossRef]
- Giesbert, S.; Schumacher, J.; Kupas, V.; Espino, J.; Segmuller, N.; Haeuser-Hahn, I.; Schreier, P.H.; Tudzynski, P. Identification of pathogenesis-associated genes by T-DNA-mediated insertional mutagenesis in Botrytis cinerea: A type 2A phosphoprotein phosphatase and an SPT3 transcription factor have significant impact on virulence. Mol. Plant Microbe Interact. 2012, 25, 481–495. [Google Scholar] [CrossRef]
- Quidde, T.; Osbourn, A.; Tudzynski, P. Detoxification of α-tomatine by Botrytis cinerea. Physiol. Mol. Plant Pathol. 1998, 52, 151–165. [Google Scholar] [CrossRef]
- Mullins, E.D.; Chen, X.; Romaine, P.; Raina, R.; Geiser, D.M.; Kang, S. Agrobacterium-Mediated Transformation of Fusarium oxysporum: An Efficient Tool for Insertional Mutagenesis and Gene Transfer. Phytopathology 2001, 91, 173–180. [Google Scholar] [CrossRef]
- Sesma, A.; Osbourn, A.E. The rice leaf blast pathogen undergoes developmental processes typical of root-infecting fungi. Nature 2004, 431, 582–586. [Google Scholar] [CrossRef]
- Liu, Y.G.; Whittier, R.F. Thermal asymmetric interlaced PCR: Automatable amplification and sequencing of insert end fragments from P1 and YAC clones for chromosome walking. Genomics 1995, 25, 674–681. [Google Scholar] [CrossRef]
- Wang, Z.; Ye, S.; Li, J.; Zheng, B.; Bao, M.; Ning, G. Fusion primer and nested integrated PCR (FPNI-PCR): A new high-efficiency strategy for rapid chromosome walking or flanking sequence cloning. BMC Biotechnol. 2011, 11, 109. [Google Scholar] [CrossRef] [PubMed]
- Sweigard, J.; Chumley, F.; Carroll, A.; Farrall, L.; Valent, B. A series of vectors for fungal transformation. Fungal Genet. Rep. 1997, 44, 52–53. [Google Scholar] [CrossRef]
- Weiberg, A.; Wang, M.; Lin, F.M.; Zhao, H.; Zhang, Z.; Kaloshian, I.; Huang, H.D.; Jin, H. Fungal small RNAs suppress plant immunity by hijacking host RNA interference pathways. Science 2013, 342, 118–123. [Google Scholar] [CrossRef] [PubMed]
- Chi, M.H.; Park, S.Y.; Lee, Y.H. A Quick and Safe Method for Fungal DNA Extraction. Plant Pathol. J. 2009, 25, 108–111. [Google Scholar] [CrossRef]
- Lecellier, G.; Silar, P. Rapid methods for nucleic acids extraction from Petri dish-grown mycelia. Curr. Genet. 1994, 25, 122–123. [Google Scholar] [CrossRef]
- Li, G.; Zhou, Z.; Liu, G.; Zheng, F.; He, C. Characterization of T-DNA insertion patterns in the genome of rice blast fungus Magnaporthe oryzae. Curr. Genet. 2007, 51, 233–243. [Google Scholar] [CrossRef]
- Guan, W.; Feng, J.; Wang, R.; Ma, Z.; Wang, W.; Wang, K.; Zhu, T. Functional analysis of the exocyst subunit BcExo70 in Botrytis cinerea. Curr. Genet. 2020, 66, 85–95. [Google Scholar] [CrossRef]
- Giraldo, M.C.; Dagdas, Y.F.; Gupta, Y.K.; Mentlak, T.A.; Yi, M.; Martinez-Rocha, A.L.; Saitoh, H.; Terauchi, R.; Talbot, N.J.; Valent, B. Two distinct secretion systems facilitate tissue invasion by the rice blast fungus Magnaporthe oryzae. Nat. Commun. 2013, 4, 1996. [Google Scholar] [CrossRef]
- Giraldo, M.C.; Valent, B. Filamentous plant pathogen effectors in action. Nat. Rev. Microbiol. 2013, 11, 800–814. [Google Scholar] [CrossRef]
- Gupta, Y.K.; Dagdas, Y.F.; Martinez-Rocha, A.L.; Kershaw, M.J.; Littlejohn, G.R.; Ryder, L.S.; Sklenar, J.; Menke, F.; Talbot, N.J. Septin-Dependent Assembly of the Exocyst Is Essential for Plant Infection by Magnaporthe oryzae. Plant Cell 2015, 27, 3277–3289. [Google Scholar] [CrossRef]
Strain | Description | Source |
---|---|---|
B05.10 | Wild-type strain | [20] |
IC formation-deficient mutants 1 | Random T-DNA insertional mutants derived from B05.10 | This study |
ΔEXO70 | B05.10 with EXO70 knocked out, ΔEXO70::HPH | This study |
ΔEXO70-C | The ectopic complementary strain of ΔEXO70 | This study |
Vector | Description | Source |
---|---|---|
pBHt2 | Binary vector used for generation of T-DNA insertional transformants | [21] |
pXEH | Binary vector used for knockout of fungal genes, containing HPH gene within its T-DNA region; KmR | [16] |
pSULPHGFP | Binary vector containing ILV1 gene (resistance to chlorimuron ethyl) within its T-DNA region; KmR | [22] |
pEXO-KO | Constructed from pXEH, for knockout of EXO70 | This study |
pEXO-C | Constructed from pSULPHGFP, for genetic complementation of ΔEXO70 | This study |
Primer Name | Primer Sequence (5′-3′) |
---|---|
For thermal asymmetric interlaced-PCR (TAIL-PCR) | |
RB1 | GGCACTGGCCGTCGTTTTACAAC |
RB2 | AACGTCGTGACTGGGAAAACCCT |
RB3 | CCCTTCCCAACAGTTGCGCA |
AD1 | TGWGNAGWANCASAGA |
For construction of EXO70 knockout vector | |
EXO70-UF | CTCGAGTGTGGGAAATGTGGGATG |
EXO70-UR | GAATTCGCACGCTAGACCTAATGC |
EXO70-DF | TCTAGACCTGTGGGTGAGACGAGA |
EXO70-DR | AAGCTTAATGCGAAATGCGAAACT |
For screening EXO70 knockout strains | |
NU | CGACATAACGAAGTGGGATT |
ND | AACCCGCAACAACCATAAAC |
Ha-RC | ATGATGCAGCTTGGGCGCA |
Hb-RC | ACAGACGTCGCGGTGAGTTCA |
EI-F | CCGCCACGGTTCCAATGAC |
EI-R | TTCCCAAAGCAGGCTTACCA |
For genetic complementation of ΔEXO70 | |
EXO70-CF | TACCGTCGACGACATAACGAAGTGGGATTG |
EXO70-CR | CCGCTCTAGAATCACTTATTCACCCGTCCC |
For qRT-PCR analysis of Actin | |
ACT-F | CATGGCTGGTCGTGATTTGA |
ACT-R | GAGGATTGACTGGCGGTTTG |
Mutant | IC 1 | Growth 2 | Mutant | IC | Growth | Mutant | IC | Growth |
---|---|---|---|---|---|---|---|---|
M1 | 0 | 5 | M55 | 0 | 2 | M109 | 1 | 4 |
M2 | 0 | 5 | M56 | 0 | 2 | M110 | 2 | 4 |
M3 | 0 | 5 | M57 | 0 | 2 | M111 | 2 | 4 |
M4 | 0 | 5 | M58 | 0 | 3 | M112 | 2 | 4 |
M5 | 0 | 5 | M59 | 0 | 1 | M113 | 2 | 4 |
M6 | 0 | 5 | M60 | 0 | 3 | M114 | 2 | 4 |
M7 | 0 | 5 | M61 | 0 | 3 | M115 | 2 | 4 |
M8 | 0 | 5 | M62 | 0 | 3 | M116 | 3 | 5 |
M9 | 0 | 5 | M63 | 0 | 3 | M117 | 3 | 5 |
M10 | 0 | 5 | M64 | 0 | 3 | M118 | 2 | 5 |
M11 | 0 | 5 | M65 | 0 | 2 | M119 | 3 | 5 |
M12 | 0 | 5 | M66 | 0 | 2 | M120 | 3 | 5 |
M13 | 0 | 5 | M67 | 0 | 2 | M121 | 3 | 5 |
M14 | 0 | 5 | M68 | 0 | 2 | M122 | 3 | 5 |
M15 | 0 | 5 | M69 | 0 | 2 | M123 | 3 | 5 |
M16 | 0 | 5 | M70 | 0 | 2 | M124 | 3 | 5 |
M17 | 0 | 5 | M71 | 0 | 2 | M125 | 3 | 5 |
M18 | 0 | 5 | M72 | 0 | 1 | M126 | 3 | 5 |
M19 | 0 | 5 | M73 | 0 | 2 | M127 | 2 | 5 |
M20 | 0 | 5 | M74 | 0 | 2 | M128 | 3 | 5 |
M21 | 0 | 5 | M75 | 0 | 2 | M129 | 3 | 5 |
M22 | 0 | 5 | M76 | 0 | 2 | M130 | 3 | 5 |
M23 | 0 | 5 | M77 | 0 | 2 | M131 | 3 | 5 |
M24 | 0 | 5 | M78 | 0 | 2 | M132 | 3 | 5 |
M25 | 0 | 5 | M79 | 0 | 2 | M133 | 3 | 5 |
M26 | 0 | 5 | M80 | 0 | 2 | M134 | 3 | 5 |
M27 | 0 | 5 | M81 | 0 | 2 | M135 | 3 | 5 |
M28 | 0 | 5 | M82 | 0 | 1 | M136 | 3 | 5 |
M29 | 0 | 5 | M83 | 0 | 2 | M137 | 3 | 5 |
M30 | 0 | 5 | M84 | 0 | 2 | M138 | 3 | 5 |
M31 | 0 | 5 | M85 | 0 | 2 | M139 | 3 | 5 |
M32 | 0 | 5 | M86 | 0 | 2 | M140 | 3 | 5 |
M33 | 0 | 4 | M87 | 1 | 5 | M141 | 2 | 5 |
M34 | 0 | 4 | M88 | 1 | 5 | M142 | 3 | 5 |
M35 | 0 | 4 | M89 | 2 | 5 | M143 | 3 | 5 |
M36 | 0 | 4 | M90 | 1 | 5 | M144 | 3 | 5 |
M37 | 0 | 4 | M91 | 1 | 5 | M145 | 3 | 5 |
M38 | 0 | 4 | M92 | 1 | 5 | M146 | 3 | 5 |
M39 | 0 | 4 | M93 | 2 | 5 | M147 | 2 | 5 |
M40 | 0 | 4 | M94 | 2 | 5 | M148 | 3 | 5 |
M41 | 0 | 4 | M95 | 1 | 5 | M149 | 3 | 5 |
M42 | 0 | 4 | M96 | 1 | 5 | M150 | 3 | 5 |
M43 | 0 | 4 | M97 | 1 | 5 | M151 | 3 | 4 |
M44 | 0 | 4 | M98 | 1 | 5 | M152 | 3 | 4 |
M45 | 0 | 4 | M99 | 1 | 5 | M153 | 3 | 4 |
M46 | 0 | 4 | M100 | 2 | 5 | M154 | 2 | 4 |
M47 | 0 | 4 | M101 | 1 | 5 | M155 | 3 | 4 |
M48 | 0 | 4 | M102 | 1 | 5 | M156 | 3 | 4 |
M49 | 0 | 4 | M103 | 1 | 5 | M157 | 2 | 2 |
M50 | 0 | 3 | M104 | 1 | 5 | M158 | 3 | 2 |
M51 | 0 | 2 | M105 | 1 | 5 | M159 | 3 | 3 |
M52 | 0 | 3 | M106 | 1 | 5 | M160 | 3 | 5 |
M53 | 0 | 3 | M107 | 1 | 4 | M161 | 3 | 5 |
M54 | 0 | 3 | M108 | 1 | 4 | WT 3 | 5 | 5 |
IC phenotype | none | rare 1 | unmature 2 | slow | |||||
hyphal growth | normal | slow slightly | very slow | normal | slow slightly | normal | slow slightly | very slow | normal |
mutant number | 32 | 17 | 37 | 20 | 9 | 35 | 6 | 3 | 2 |
total number | 86 | 29 | 44 | 2 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tang, M.; Wang, K.; Zhang, P.; Hou, J.; Yu, X.; Wang, H.; Wang, Y.; Li, G. Establishment of a Mutant Library for Infection Cushion Development and Identification of a Key Regulatory Gene in Botrytis cinerea. J. Fungi 2025, 11, 16. https://doi.org/10.3390/jof11010016
Tang M, Wang K, Zhang P, Hou J, Yu X, Wang H, Wang Y, Li G. Establishment of a Mutant Library for Infection Cushion Development and Identification of a Key Regulatory Gene in Botrytis cinerea. Journal of Fungi. 2025; 11(1):16. https://doi.org/10.3390/jof11010016
Chicago/Turabian StyleTang, Maoyao, Kexin Wang, Pan Zhang, Jie Hou, Xiaoqian Yu, Hongfu Wang, Yangyizhou Wang, and Guihua Li. 2025. "Establishment of a Mutant Library for Infection Cushion Development and Identification of a Key Regulatory Gene in Botrytis cinerea" Journal of Fungi 11, no. 1: 16. https://doi.org/10.3390/jof11010016
APA StyleTang, M., Wang, K., Zhang, P., Hou, J., Yu, X., Wang, H., Wang, Y., & Li, G. (2025). Establishment of a Mutant Library for Infection Cushion Development and Identification of a Key Regulatory Gene in Botrytis cinerea. Journal of Fungi, 11(1), 16. https://doi.org/10.3390/jof11010016