Tea Polyphenols Relieve the Fluoride-Induced Oxidative Stress in the Intestinal Porcine Epithelial Cell Model
Abstract
1. Introduction
2. Materials and Methods
2.1. Cells and Reagents
2.2. Establishment of NaF-Treated Cell Model and Determination of Working Concentration of TPs
2.3. Cell Treatment
2.4. Determination of Antioxidant-Related Parameters
2.5. Intracellular ROS, Cell Apoptosis, and Mitochondrial Membrane Potential (MMP) Detection
2.6. Lactate Dehydrogenase (LDH) Detection
2.7. Quantitative Real-Time PCR (RT-qPCR)
2.8. Statistical Analysis
3. Results
3.1. TPs Increased the Viability of IPEC-J2 Cells Induced by F
3.2. Effect of TPs on REDOX-Related Indexes in F-Induced IPEC-J2 Cells
3.3. Effects of TPs on the Cell Injury-Related Indexes in F-Induced IPEC-J2 Cells
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Ferreira, M.K.M.; Aragão, W.A.B.; Bittencourt, L.O.; Puty, B.; Dionizio, A.; de Souza, M.P.C.; Buzalaf, M.A.R.; de Oliveira, E.H.; Crespo-Lopez, M.E.; Lima, R.R. Fluoride exposure during pregnancy and lactation triggers oxidative stress and molecular changes in hippocampus of offspring rats. Ecotoxicol. Environ. Saf. 2021, 208, 111437. [Google Scholar] [CrossRef]
- Srivastava, S.; Flora, S.J.S. Fluoride in Drinking Water and Skeletal Fluorosis: A Review of the Global Impact. Curr. Environ. Health Rep. 2020, 7, 140–146. [Google Scholar] [CrossRef]
- Das, S.S.; Maiti, R.; Ghosh, D. Fluoride-induced immunotoxicity in adult male albino rat: A correlative approach to oxidative stress. J. Immunotoxicol. 2006, 3, 49–55. [Google Scholar] [CrossRef]
- Reddy, Y.P.; Tiwari, S.K.; Shaik, A.P.; Alsaeed, A.; Sultana, A.; Reddy, P.K. Effect of sodium fluoride on neuroimmunological parameters, oxidative stress and antioxidative defenses. Toxicol. Mech. Methods 2014, 24, 31–36. [Google Scholar] [CrossRef]
- Goschorska, M.; Gutowska, I.; Baranowska-Bosiacka, I.; Piotrowska, K.; Metryka, E.; Safranow, K.; Chlubek, D. Influence of Acetylcholinesterase Inhibitors Used in Alzheimer’s Disease Treatment on the Activity of Antioxidant Enzymes and the Concentration of Glutathione in THP-1 Macrophages Under Fluoride-Induced Oxidative Stress. Int. J. Environ. Res. Public Health 2019, 16, 10. [Google Scholar] [CrossRef]
- Wang, J.J.; Wei, Z.-K.; Han, Z.; Liu, Z.-Y.; Zhang, Y.; Zhu, X.-Y.; Li, X.-W.; Wang, K.; Yang, Z.-T. Sodium fluoride exposure triggered the formation of neutrophil extracellular traps. Environ. Pollut. 2020, 257, 113583. [Google Scholar] [CrossRef]
- Song, C.; Zhao, J.; Fu, B.; Li, D.; Mao, T.; Peng, W.; Wu, H.; Zhang, Y. Melatonin-mediated upregulation of Sirt3 attenuates sodium fluoride-induced hepatotoxicity by activating the MT1-PI3K/AKT-PGC-1alpha signaling pathway. Free Radic. Biol. Med. 2017, 112, 616–630. [Google Scholar] [CrossRef]
- Li, H.; Hao, Z.; Wang, L.; Yang, J.; Zhao, Y.; Cheng, X.; Yuan, H.; Wang, J. Dietary Calcium Alleviates Fluorine-Induced Liver Injury in Rats by Mitochondrial Apoptosis Pathway. Biol. Trace Elem. Res. 2022, 200, 271–280. [Google Scholar] [CrossRef]
- Li, M.; Wang, J.; Wu, P.; Manthari, R.K.; Zhao, Y.; Li, W.; Wang, J. Self-recovery study of the adverse effects of fluoride on small intestine: Involvement of pyroptosis induced inflammation. Sci. Total Environ. 2020, 742, 140533. [Google Scholar] [CrossRef]
- Dai, Y.-H.; Wei, J.-R.; Chen, X.-Q. Interactions between tea polyphenols and nutrients in food. Compr. Rev. Food Sci. Food Saf. 2023, 18 (Suppl. S1), 21. [Google Scholar] [CrossRef]
- Prasanth, M.I.; Sivamaruthi, B.S.; Chaiyasut, C.; Tencomnao, T. A Review of the Role of Green Tea (Camellia sinensis) in Antiphotoaging, Stress Resistance, Neuroprotection, and Autophagy. Nutrients 2019, 11, 474. [Google Scholar] [CrossRef]
- Khan, N.; Mukhtar, H. Tea Polyphenols in Promotion of Human Health. Nutrients 2019, 11, 39. [Google Scholar] [CrossRef]
- Qi, G.; Mi, Y.; Wang, Y.; Li, R.; Huang, S.; Li, X.; Liu, X. Neuroprotective action of tea polyphenols on oxidative stress-induced apoptosis through the activation of the TrkB/CREB/BDNF pathway and Keap1/Nrf2 signaling pathway in SH-SY5Y cells and mice brain. Food Funct. 2017, 8, 4421–4432. [Google Scholar] [CrossRef]
- Simos, Y.V.; Verginadis, I.I.; Toliopoulos, I.K.; Velalopoulou, A.P.; Karagounis, I.V.; Karkabounas, S.C.; Evangelou, A.M. Effects of catechin and epicatechin on superoxide dismutase and glutathione peroxidase activity, in vivo. Redox Rep. 2012, 17, 181–186. [Google Scholar] [CrossRef]
- Winiarska-Mieczan, A. Protective effect of tea against lead and cadmium-induced oxidative stress-a review. Biometals 2018, 31, 909–926. [Google Scholar] [CrossRef]
- Garcia-Rodriguez, M.D.C.; Hernández-Cortés, L.M.; Mendoza-Núñez, V.M.; Arenas-Huertero, F. Effects of green tea polyphenols against metal-induced genotoxic damage: Underlying mechanistic pathways. J. Toxicol. Environ. Health B Crit. Rev. 2023, 26, 371–386. [Google Scholar] [CrossRef]
- Londero, A.S.; Arana, M.R.; Perdomo, V.G.; Tocchetti, G.N.; Zecchinati, F.; Ghanem, C.I.; Ruiz, M.L.; Rigalli, J.P.; Mottino, A.D.; García, F.; et al. Intestinal multidrug resistance-associated protein 2 is down-regulated in fructose-fed rats. J. Nutr. Biochem. 2017, 40, 178–186. [Google Scholar] [CrossRef]
- Diaz de Barboza, G.; Guizzardi, S.; Moine, L.; Tolosa de Talamoni, N. Oxidative stress, antioxidants and intestinal calcium absorption. World J. Gastroenterol. 2017, 23, 2841–2853. [Google Scholar] [CrossRef]
- Hermes, R.G.; Manzanilla, E.G.; Martín-Orúe, S.M.; Pérez, J.F.; Klasing, K.C. Influence of dietary ingredients on in vitro inflammatory response of intestinal porcine epithelial cells challenged by an enterotoxigenic Escherichia coli (K88). Comp. Immunol. Microbiol. Infect. Dis. 2011, 34, 479–488. [Google Scholar] [CrossRef]
- Kang, R.; Li, R.; Dai, P.; Li, Z.; Li, Y.; Li, C. Deoxynivalenol induced apoptosis and inflammation of IPEC-J2 cells by promoting ROS production. Environ. Pollut. 2019, 251, 689–698. [Google Scholar] [CrossRef]
- Tveden-Nyborg, P.; Bergmann, T.K.; Jessen, N.; Simonsen, U.; Lykkesfeldt, J. BCPT 2023 policy for experimental and clinical studies. Basic Clin. Pharmacol. Toxicol. 2023, 133, 391–396. [Google Scholar] [CrossRef]
- Yuksek, V.; Dede, S.; Çetin, S.; Usta, A.; Taşpınar, M. Vitamin D may assist the UPR against sodium fluoride-induced damage by reducing RIPK1, ATG5, BECN1, oxidative stress and increasing caspase-3 in the osteoblast MC3T3-E1 cell line. J. Trace Elem. Med. Biol. 2023, 80, 127293. [Google Scholar] [CrossRef]
- Korkmaz, R.; Yuksek, V.; Dede, S. The Effects of Sodium Fluoride (NaF) Treatment on the PI3K/Akt Signal Pathway in NRK-52E Cells. Biol. Trace Elem. Res. 2022, 200, 3294–3302. [Google Scholar] [CrossRef]
- Yang, F.; Oz, H.S.; Barve, S.; De Villiers, W.J.; McClain, C.J.; Varilek, G.W. The green tea polyphenol (-)-epigallocatechin-3-gallate blocks nuclear factor-kappa B activation by inhibiting I kappa B kinase activity in the intestinal epithelial cell line IEC-6. Mol. Pharmacol. 2001, 60, 528–533. [Google Scholar] [CrossRef]
- Wang, F.; Li, Y.; Tang, D.; Yang, B.; Tian, T.; Tian, M.; Meng, N.; Xie, W.; Zhang, C.; He, Z.; et al. Exploration of the SIRT1-mediated BDNF-TrkB signaling pathway in the mechanism of brain damage and learning and memory effects of fluorosis. Front. Public Health 2023, 11, 1247294. [Google Scholar] [CrossRef]
- Souza-Monteiro, D.; Ferreira, M.K.M.; Bittencourt, L.O.; Aragão, W.A.B.; Oliveira, I.G.d.; Maia, C.S.F.; Freire, M.A.M.; Zohoori, F.V.; Buzalaf, M.A.R.; Lima, R.R. Intrauterine and Postnatal Exposure to High Levels of Fluoride Is Associated with Motor Impairments, Oxidative Stress, and Morphological Damage in the Cerebellum of Offspring Rats. Int. J. Mol. Sci. 2022, 23, 8556. [Google Scholar] [CrossRef]
- Fan, X.; Xiao, X.; Mao, X.; Chen, D.; Yu, B.; Wang, J.; Yan, H. Tea bioactive components prevent carcinogenesis via anti-pathogen, anti-inflammation, and cell survival pathways. IUBMB Life 2021, 73, 328–340. [Google Scholar] [CrossRef]
- Liu, L.Q.; Nie, S.P.; Shen, M.Y.; Hu, J.L.; Yu, Q.; Gong, D.; Xie, M.Y. Tea Polysaccharides Inhibit Colitis-Associated Colorectal Cancer via Interleukin-6/STAT3 Pathway. J. Agric. Food Chem. 2018, 66, 4384–4393. [Google Scholar] [CrossRef]
- Yang, J.; Chen, B.; Gu, Y. Pharmacological evaluation of tea polysaccharides with antioxidant activity in gastric cancer mice. Carbohydr. Polym. 2012, 90, 943–947. [Google Scholar] [CrossRef]
- Almajano, M.P.; Vila, I.; Gines, S. Neuroprotective effects of white tea against oxidative stress-induced toxicity in striatal cells. Neurotox. Res. 2011, 20, 372–378. [Google Scholar] [CrossRef]
- Braud, L.; Peyre, L.; De Sousa, G.; Armand, M.; Rahmani, R.; Maixent, J.-M. Effect of Brewing Duration on the Antioxidant and Hepatoprotective Abilities of Tea Phenolic and Alkaloid Compounds in a t-BHP Oxidative Stress-Induced Rat Hepatocyte Model. Molecules 2015, 20, 14985–15002. [Google Scholar] [CrossRef] [PubMed]
- Ivanov, A.V.; Bartosch, B.; Isaguliants, M.G. Oxidative Stress in Infection and Consequent Disease. Oxidative Med. Cell. Longev. 2017, 2017, 3496043. [Google Scholar] [CrossRef] [PubMed]
- Babu, S.; Manoharan, S.; Ottappilakkil, H.; Perumal, E. Role of oxidative stress-mediated cell death and signaling pathways in experimental fluorosis. Chem. Biol. Interact. 2022, 365, 110106. [Google Scholar] [CrossRef]
- Bhattacharyya, A.; Chattopadhyay, R.; Mitra, S.; Crowe, S.E. Oxidative stress: An essential factor in the pathogenesis of gastrointestinal mucosal diseases. Physiol. Rev. 2014, 94, 329–354. [Google Scholar] [CrossRef]
- Perez-Torres, I.; Castrejón-Téllez, V.; Soto, M.E.; Rubio-Ruiz, M.E.; Manzano-Pech, L.; Guarner-Lans, V. Oxidative Stress, Plant Natural Antioxidants, and Obesity. Int. J. Mol. Sci. 2021, 22, 1786. [Google Scholar] [CrossRef]
- Jones, D.P. Radical-free biology of oxidative stress. Am. J. Physiol. Cell Physiol. 2008, 295, C849–C868. [Google Scholar] [CrossRef]
- Redza-Dutordoir, M.; Averill-Bates, D.A. Activation of apoptosis signalling pathways by reactive oxygen species. Biochim. Biophys. Acta 2016, 1863, 2977–2992. [Google Scholar] [CrossRef]
- Lash, L.H. Mitochondrial GSH transport and intestinal cell injury: A commentary on “Contribution of mitochondrial GSH transport to matrix GSH status and colonic epithelial cell apoptosis”. Free Radic. Biol. Med. 2008, 44, 765–767. [Google Scholar] [CrossRef]
- Rivoira, M.A.; Marchionatti, A.M.; Centeno, V.A.; de Barboza, G.E.D.; López, M.E.P.; de Talamoni, N.G.T. Sodium deoxycholate inhibits chick duodenal calcium absorption through oxidative stress and apoptosis. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 2012, 162, 397–405. [Google Scholar] [CrossRef]
- Li, L.; Xin, J.; Wang, H.; Wang, Y.; Peng, W.; Sun, N.; Huang, H.; Zhou, Y.; Liu, X.; Lin, Y.; et al. Fluoride disrupts intestinal epithelial tight junction integrity through intracellular calcium-mediated RhoA/ROCK signaling and myosin light chain kinase. Ecotoxicol. Environ. Saf. 2023, 257, 114940. [Google Scholar] [CrossRef]
- Jin, Y.; Gao, X.Y.; Zhao, J.; Tian, W.S.; Zhang, Y.L.; Tian, E.J.; Zhou, B.H.; Wang, H.W. Estrogen deficiency aggravates fluoride-induced small intestinal mucosa damage and junctional complexes proteins expression disorder in rats. Ecotoxicol. Environ. Saf. 2022, 246, 114181. [Google Scholar] [CrossRef] [PubMed]
- Chen, C.; Wang, H.; Hong, T.; Huang, X.; Xia, S.; Zhang, Y.; Chen, X.; Zhong, Y.; Nie, S. Effects of tea polysaccharides in combination with polyphenols on dextran sodium sulfate-induced colitis in mice. Food Chem. X 2022, 13, 100190. [Google Scholar] [CrossRef] [PubMed]




| Gene | ID | Primer Sequence (5′-3′) | Length (bp) |
|---|---|---|---|
| GAPDH | NM_007393.5 | F: TGTCCACCTTCCAGCAGATGT | 101 |
| R: AGCTCAGTAACAGTCCGCCTAGA | |||
| GPX1 | NM_214201.1 | F: TGGGGAGATCCTGAATTG | 184 |
| R: GATAAACTTGGGGTCGGT | |||
| GPX2 | NM_001115136.1 | F: TGCAACCAATTTGGACATCAG | 122 |
| R: TTCACGTCACACTTCTGGATAAGG | |||
| GPX3 | NM_001115155.1 | F: AAACAGGAACCGGGAGACAA | 156 |
| R: AGGACAGGCGTTCTTCAGGAA | |||
| GPX4 | NM_214407.1 | F: GATTCTGGCCTTCCCTTGC | 173 |
| R: TCCCCTTGGGCTGGACTTT | |||
| CAT | XM_021081498.1 | F: CGAAGGCGAAGGTGTTTG | 370 |
| R: AGTGTGCGATCCATATCC | |||
| SOD | XM_021100523.1 | F: ATGCTGACGCTGCTCTGTGCTTA | 143 |
| R: TCCTGCCAGATCTCCGTCACTTT | |||
| Occludin | NM_001360536.1 | F: CCCCTCTTTCCTTAGGCGAC | 168 |
| R: TTCAAAAGGCCTCACGGACA | |||
| Claudin-1 | NM_008770.3 | F: TGGTGGACATCCTCATCCTT | 190 |
| R: GCCAGCAGAATAAGGAGCAC | |||
| ZO-1 | NM_001417374.1 | F: GAGCAGGCTTTGGAGGAGAC | 162 |
| R: TGGGACAAAAGTCCGGGAAG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Xie, C.; Niu, S.; Tian, W. Tea Polyphenols Relieve the Fluoride-Induced Oxidative Stress in the Intestinal Porcine Epithelial Cell Model. Toxics 2025, 13, 83. https://doi.org/10.3390/toxics13020083
Xie C, Niu S, Tian W. Tea Polyphenols Relieve the Fluoride-Induced Oxidative Stress in the Intestinal Porcine Epithelial Cell Model. Toxics. 2025; 13(2):83. https://doi.org/10.3390/toxics13020083
Chicago/Turabian StyleXie, Chunyan, Shuyi Niu, and Wen Tian. 2025. "Tea Polyphenols Relieve the Fluoride-Induced Oxidative Stress in the Intestinal Porcine Epithelial Cell Model" Toxics 13, no. 2: 83. https://doi.org/10.3390/toxics13020083
APA StyleXie, C., Niu, S., & Tian, W. (2025). Tea Polyphenols Relieve the Fluoride-Induced Oxidative Stress in the Intestinal Porcine Epithelial Cell Model. Toxics, 13(2), 83. https://doi.org/10.3390/toxics13020083

