Antibiotic Resistance Genes Detection in Several Local Cyanobacteria Isolates
Abstract
1. Introduction
2. Materials and Methods
2.1. Algal Isolates
2.2. Bacterial Isolates
2.3. Genomic DNA Extraction
2.4. Polymerase Chain Reaction
3. Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Reygaert, W.C. An overview of the antimicrobial resistance mechanisms of bacteria. AIMS Microbiol. 2018, 4, 482–501. [Google Scholar] [CrossRef] [PubMed]
- Jian, Z.; Zeng, L.; Xu, T.; Sun, S.; Yan, S.; Yang, L.; Huang, Y.; Jia, J. Antibiotic resistance genes in bacteria: Occurrence, spread, and control. J. Basic Microbiol. 2021, 61, 1049–1070. [Google Scholar] [CrossRef] [PubMed]
- Nwobodo, D.C.; Ugwu, M.C.; Anie, C.O.; Al-Ouqaili, M.T.S.; Ikem, J.C.; Chigozie, U.V.; Saki, M. Antibiotic resistance: The challenges and some emerging strategies for tackling a global menace. J. Clin. Lab. Anal. 2022, 36, e24655. [Google Scholar] [CrossRef] [PubMed]
- Timms, V.J.; Hassan, K.A.; Pearson, L.A.; Neilan, B.A. Cyanobacteria as a critical reservoir of the environmental antimicrobial resistome. Environ. Microbiol. 2023, 25, 2266–2276. [Google Scholar] [CrossRef] [PubMed]
- Cassier-Chauvat, C.; Veaudor, T.; Chauvat, F. Comparative Genomics of DNA Recombination and Repair in Cyanobacteria: Biotechnological Implications. Front. Microbiol. 2016, 7, 1809. [Google Scholar] [CrossRef]
- Labella, J.I.; Llop, A.; Contreras, A. The default cyanobacterial linked genome: An interactive platform based on cyanobacterial linkage networks to assist functional genomics. FEBS Lett. 2020, 594, 1661–1674. [Google Scholar] [CrossRef]
- MehdizadehAllaf, M.; Peerhossaini, H. Cyanobacteria: Model Microorganisms and Beyond. Microorganisms 2022, 10, 696. [Google Scholar] [CrossRef]
- Cassier-Chauvat, C.; Chauvat, F. Responses to oxidative and heavy metal stresses in cyanobacteria: Recent advances. Int. J. Mol. Sci. 2015, 16, 871–886. [Google Scholar] [CrossRef]
- Huisman, J.; Codd, G.A.; Paerl, H.W.; Ibelings, B.W.; Verspagen, J.M.H.; Visser, P.M. Cyanobacterial blooms. Nat. Rev. Microbiol. 2018, 16, 471–483. [Google Scholar] [CrossRef]
- Drury, B.; Scott, J.; Rosi-Marshall, E.J.; Kelly, J.J. Triclosan exposure increases triclosan resistance and influences taxonomic composition of benthic bacterial communities. Environ. Sci. Technol. 2013, 47, 8923–8930. [Google Scholar] [CrossRef]
- Serwecińska, L. Antimicrobials and Antibiotic-Resistant Bacteria: A Risk to the Environment and to Public Health. Water 2020, 12, 3313. [Google Scholar] [CrossRef]
- Povolo, V.R.; Ackermann, M. Disseminating antibiotic resistance during treatment. Science 2019, 364, 737–738. [Google Scholar] [CrossRef] [PubMed]
- Michaelis, C.; Grohmann, E. Horizontal Gene Transfer of Antibiotic Resistance Genes in Biofilms. Antibiotics 2023, 12, 328. [Google Scholar] [CrossRef] [PubMed]
- Lu, P.L.; Wu, Y.; Ding, H.; Zhan, W. The combined and second exposure effect of copper (II) and chlortetracycline on fresh water algae, Chlorellapyrenoidosa and Microcystisaeruginosa. Environ. Toxicol. Pharmacol. 2015, 40, 140–148. [Google Scholar] [CrossRef] [PubMed]
- Metcalf, J.S.; Tischbein, M.; Cox, P.A.; Stommel, E.W. Cyanotoxins and the Nervous System. Toxins 2021, 13, 660. [Google Scholar] [CrossRef]
- Mohammed, N.A.; Buniya, H.K. Some Active compounds in Local Isolate of Spirulinalaxa GM SMITH. Biochem. Cell. Arch. 2022, 22, 1145–1149. [Google Scholar]
- Hameed, S.G.; Buniya, H.K. Determining the genetic Relationship for some local Isolate of Oscillatoria species present in the local Environment using the Inter Simple Sequence Repeat (ISSR) Technique. Adv. Life Sci. 2024. (in process). [Google Scholar]
- Parvin, M.; Zannat, M.N.; Habib, M.N.B. Two Important Techniques for Isolation of Microalgae. Asian Fish. Sci. 2007, 20, 117–124. [Google Scholar] [CrossRef]
- Jacobsen, J.H.; Rosgaard, L. One step plasmid construction for generation of knock-out mutants in cyanobacteria: Studies of glycogen metabolism in Synechococcus sp. PCC 7002. Photosynth. Res. 2011, 107, 215–221. [Google Scholar] [CrossRef]
- Bellinger, E.G.; Sigee, D.C. Freshwater Algae: Identification and Use as Bioindicators, 1st ed.; John Wiley & Sons Ltd.: Hoboken, NJ, USA, 2010. [Google Scholar]
- Buniya, H.K.; Ahmaed, M.M.; Mohammed, N.A. Detection of the HEP gene responsible for the production of Hepatotoxin in Blue-green Algae using polymerase chain reaction (PCR) Technique. JUAPS 2025, in press.
- Ahmaed, M.M.; Buniya, H.K. Study of Antibiotic Resistance for some local isolates of Blue-green Algae. Biochem. Cell. Arch. 2022, 22, 711–714. [Google Scholar]
- Bănăduc, D.; Simić, V.; Cianfaglione, K.; Barinova, S.; Afanasyev, S.; Öktener, A.; McCall, G.; Simić, S.; Curtean-Bănăduc, A. Freshwater as a Sustainable Resource and Generator of Secondary Resources in the 21st Century: Stressors, Threats, Risks, Management and Protection Strategies, and Conservation Approaches. Int. J. Environ. Res. Public. Health 2022, 19, 16570. [Google Scholar] [CrossRef] [PubMed]
- Yadav, P.; Singh, R.P.; Rana, S.; Joshi, D.; Kumar, D.; Bhardwaj, N.; Gupta, R.K.; Kumar, A. Mechanisms of Stress Tolerance in Cyanobacteria under Extreme Conditions. Stresses 2022, 2, 531–549. [Google Scholar] [CrossRef]
- Kulik, K.; Lenart-Boroń, A.; Wyrzykowska, K. Impact of Antibiotic Pollution on the Bacterial Population within Surface Water with Special Focus on Mountain Rivers. Water 2023, 15, 975. [Google Scholar] [CrossRef]
- Du, Y.; Wang, J.; Zhu, F.; Mai, D.; Xiang, Z.; Chen, J.; Guo, R. Comprehensive assessment of three typical antibiotics on cyanobacteria (Microcystisaeruginosa): The impact and recovery capability. Ecotoxicol. Environ. Safe 2018, 160, 84–93. [Google Scholar] [CrossRef]
- Kraemer, S.A.; Ramachandran, A.; Perron, G.G. Antibiotic Pollution in the Environment: From Microbial Ecology to Public Policy. Microorganisms 2019, 7, 180. [Google Scholar] [CrossRef]
- Laureti, L.; Matic, I.; Gutierrez, A. Bacterial responses and genome instability induced by subinhibitory concentrations of antibiotics. Antibiotics 2013, 2, 100–114. [Google Scholar] [CrossRef]
- Andersson, D.I.; Hughes, D. Microbiological effects of sublethal levels of antibiotics. Nat. Rev. Microbiol. 2014, 12, 465–478. [Google Scholar] [CrossRef]
- Urbach, C.; Fastrez, J.; Soumillion, P. A new family of cyanobacterial penicillin-binding proteins, a missing link in the evolution of class A β-lactamases. J. Biol. Chem. 2008, 283, 32516–32526. [Google Scholar] [CrossRef]
- Prasanna, R.; Madhan, K.; Singh, R.N.; Chauhan, A.K.; Nain, L. Developing biochemical and molecular markers for cyanobacterial inoculants. Folia Microbiol. 2010, 55, 474–480. [Google Scholar] [CrossRef]
- Xin, R.; Zhang, Y.; Zhang, K.; Yang, Y.; Ma, Y.; Niu, Z. Investigation of the antimicrobial susceptibility patterns of marine cyanobacteria in Bohai Bay: Cyanobacteria may be important hosts of antibiotic resistance genes in marine environment. Sci. Total Environ. 2024, 909, 168516. [Google Scholar] [CrossRef] [PubMed]
- Jung, A.V.; Le Cann, P.; Roig, B.; Thomas, O.; Baurès, E.; Thomas, M.F. Microbial contamination detection in water resources: Interest of current optical methods, trends and needs in the context of climate change. Int. J. Environ. Res. Public. Health 2014, 11, 4292–4310. [Google Scholar] [CrossRef] [PubMed]
- Ghaly, T.M.; Gillings, M.R. New perspectives on mobile genetic elements: A paradigm shift for managing the antibiotic resistance crisis. Philos. Trans. R. Soc. Lond. B Biol. Sci. 2022, 377, 20200462. [Google Scholar] [CrossRef] [PubMed]
- Juwita, S.; Indrawati, A.; Damajanti, R.; SafikaMayasari, N.L.P.I. Multiple antibiotic resistance and virulence factors of Staphylococcus aureus strains isolated from dairy farms in South Sulawesi, Indonesia. Biodiversitas 2022, 23, 1015–1022. [Google Scholar] [CrossRef]
- Zhang, Q.; Zhang, Z.; Lu, T.; Peijnenburg, W.J.G.M.; Gillings, M.; Yang, X.; Chen, J.; Penuelas, J.; Zhu, Y.-G.; Zhou, N.-Y.; et al. Cyanobacterial blooms contribute to the diversity of antibiotic-resistance genes in aquatic ecosystems. Commun. Biol. 2020, 3, 737. [Google Scholar] [CrossRef]
- Dias, E.; Oliveira, M.; Jones-Dias, D.; Vasconcelos, V.; Ferreira, E.; Manageiro, V.; Caniça, M. Assessing the antibiotic susceptibility of freshwater Cyanobacteria spp. Front. Microbiol. 2015, 6, 799. [Google Scholar] [CrossRef]
- Hu, L.; Xiao, P.; Jiang, Y.; Dong, M.; Chen, Z.; Li, H.; Hu, Z.; Lei, A.; Wang, J. Transgenerational Epigenetic Inheritance Under Environmental Stress by Genome-Wide DNA Methylation Profiling in Cyanobacterium. Front. Microbiol. 2018, 9, 1479. [Google Scholar] [CrossRef]
- Li, W.X.; Mao, F.J.; Te, S.H.; He, Y.L.; Gin, K.Y.H. Impacts of Microcystis on the Dissemination of the Antibiotic Resistome in Cyanobacterial Blooms. Acs. Est. Water 2021, 1, 1263–1273. [Google Scholar] [CrossRef]
- Duan, X.; Zhang, C.; Struewing, I.; Li, X.; Allen, J.; Lu, J. Cyanotoxin-encoding genes as powerful predictors of cyanotoxin production during harmful cyanobacterial blooms in an inland freshwater lake: Evaluating a novel early-warning system. Sci. Total Environ. 2022, 830, 154568. [Google Scholar] [CrossRef]
- Ohdate, K.; Sakata, M.; Maeda, K.; Sakamaki, Y.; Nimura-Matsune, K.; Ohbayashi, R.; Hess, W.R.; Watanabe, S. Discovery of novel replication proteins for large plasmids in cyanobacteria and their potential applications in genetic engineering. Front. Microbiol. 2024, 15, 1311290. [Google Scholar] [CrossRef]
- Kim, M.J.; Kang, D.; Lee, G.D.; Kim, K.; Kim, J.; Shin, J.H.; Lee, S. Interplays between cyanobacterial blooms and antibiotic resistance genes. Environ. Int. 2023, 181, 108268. [Google Scholar] [CrossRef] [PubMed]
- Volk, A.; Lee, J. Cyanobacterial blooms: A player in the freshwater environmental resistome with public health relevance? Environ. Res. 2023, 216, 114612. [Google Scholar] [CrossRef] [PubMed]
- Wang, Z.; Chen, Q.; Zhang, J.; Guan, T.; Chen, Y.; Shi, W. Critical roles of cyanobacteria as reservoir and source for antibiotic resistance genes. Environ. Int. 2020, 144, 106034. [Google Scholar] [CrossRef] [PubMed]



| Gene | Primer Name | Primer Sequence (5′ 3′) | PCR Product Length (bp) |
|---|---|---|---|
| aacC1 (GmR) | gmr1 F | TCCAGAACCTTGACCGAAC | 654 |
| gmr R | ATCACTTCTTCCCGTATGCC | ||
| aadA (SpR) | aadA F | TACCAAGGCAACGCTATGTTC | 400 |
| aadA R | ATCAGAGGTAGTTGGCGTCAT | ||
| bla (ApR) | bla F | TTTGCCTTCCTGTTTTTGCTC | 593 |
| bla R | AACTTTATCCGCCTCCATCC | ||
| cat (CmR) | cat F | ATCCCAATGGCATCGTAAAG | 553 |
| cat R | ATCACAAACGGCATGATGAA | ||
| ermC (EmR) | erm F | CGCATCCGATTGCAGTATAA | 885 |
| erm R | TCGTCAATTCCTGCATGTTT | ||
| npt (KmR) | npt F | TGAATGAACTGCAGGACGAG | 515 |
| npt R | AATATCACGGGTAGCCAACG |
| Sample | Gene | |||||
|---|---|---|---|---|---|---|
| Bla | Cat | ermC | aacC1 | aadA | Npt | |
| S. laxa | + | + | + | - | + | + |
| L. epiphytica | + | - | + | - | - | + |
| C.minutes | + | - | + | - | + | - |
| O.princeps | + | - | + | - | - | - |
| O.proteus | + | - | - | + | + | + |
| O.terebriformis | + | + | + | + | + | - |
| E. coli | + | - | + | + | - | + |
| K. pneumonia | + | - | - | + | - | + |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Buniya, H.K.; Mohammed, N.A.; Al-Hayani, D.A. Antibiotic Resistance Genes Detection in Several Local Cyanobacteria Isolates. Limnol. Rev. 2024, 24, 568-576. https://doi.org/10.3390/limnolrev24040033
Buniya HK, Mohammed NA, Al-Hayani DA. Antibiotic Resistance Genes Detection in Several Local Cyanobacteria Isolates. Limnological Review. 2024; 24(4):568-576. https://doi.org/10.3390/limnolrev24040033
Chicago/Turabian StyleBuniya, Harith K., Nuha A. Mohammed, and Dhyauldeen Aftan Al-Hayani. 2024. "Antibiotic Resistance Genes Detection in Several Local Cyanobacteria Isolates" Limnological Review 24, no. 4: 568-576. https://doi.org/10.3390/limnolrev24040033
APA StyleBuniya, H. K., Mohammed, N. A., & Al-Hayani, D. A. (2024). Antibiotic Resistance Genes Detection in Several Local Cyanobacteria Isolates. Limnological Review, 24(4), 568-576. https://doi.org/10.3390/limnolrev24040033

