Abstract
Background: Preeclampsia (PE) is a pregnancy-specific disease and hypertensive disorder with a multifactorial pathogenesis involving complex molecular regulatory networks. Recent studies highlight the critical role of non-coding RNAs, particularly miRNAs and lncRNAs, in PE development. This study investigates the molecular interaction between miR-7151-5p and the lncRNA KCNQ1OT1 and their functional contributions to PE pathogenesis. Methods: An integrative approach combining RNAhybrid-based bioinformatics, dual-luciferase reporter assays, qRT-PCR, Transwell migration and invasion assays, and RNA sequencing was employed to characterize the binding between miR-7151-5p and KCNQ1OT1 and assess their influence on trophoblast cell function and gene expression. Results: A bioinformatic analysis predicted a stable binding site between miR-7151-5p and KCNQ1OT1 (minimum free energy: –37.3 kcal/mol). The dual-luciferase reporter assay demonstrated that miR-7151-5p directly targets KCNQ1OT1, leading to suppressed transcriptional activity. In HTR8/SVneo cells, miR-7151-5p overexpression significantly downregulated both KCNQ1OT1 and Notch1 mRNA, whereas its inhibition showed no significant changes, suggesting additional regulatory mechanisms of Notch1 expression. Transwell assays indicated that miR-7151-5p overexpression suppressed trophoblast cell migration and invasion, whereas its inhibition enhanced these cellular behaviors. RNA-seq analysis further revealed that miR-7151-5p overexpression altered key signaling pathways, notably the TGF-β pathway, and significantly modulates PE-associated genes, including PLAC1, ANGPTL6, HIRA, GLA, HSF1, and BAG6. Conclusions: The regulatory effect of miR-7151-5p on KCNQ1OT1, along with its influence on trophoblast cell dynamics via Notch1 and TGF-β signaling pathways, highlights its role in PE pathogenesis and supports its potential as a biomarker in early PE screening.
1. Introduction
Preeclampsia (PE) is a gestational hypertensive disorder that typically emerges after 20 weeks, accompanied by proteinuria, and represents a major risk to the health of both the mother and fetus [1]. In severe cases, it can lead to maternal and fetal mortality. Affecting 3–8% of pregnancies globally, PE remains a significant contributor of maternal and perinatal complications [1]. Although its precise etiology remains unclear, placental dysfunction is widely recognized as a pivotal factor in its pathogenesis [2].
Exosomes play crucial roles in pregnancy-related processes [3]. Significant alterations in peripheral blood exosomal miRNA profiles among individuals with PE have been reported, highlighting their possible contribution to the condition’s progression [4,5,6,7]. These exosomal miRNAs have been implicated in impaired trophoblast invasion, the promotion of endothelial dysfunction, and impaired angiogenesis—key features of PE [8]. These results suggest that exosomal miRNAs hold potential as early screening markers and therapeutic targets for PE. In recent years, there has been rising recognition of the significant role played by non-coding RNAs (ncRNAs) in PE progression [9]. Dysregulated miRNA expression is frequently detected in PE patients and has been shown to influence trophoblast activity and placental development [2]. For instance, miR-210 is upregulated in PE and impairs trophoblast invasion by regulating the MAPK signaling pathway, thereby affecting trophoblast function and placental development; it is also regarded as an important serum biomarker for early PE prediction [10]. Similarly, miR-181 shows significant overexpression in PE [11]. As another example, miR-362-3p negatively regulates trophoblast proliferation, migration, and invasion by targeting Pax3 [12].
Our previous study identified the significant upregulation of miRNA-7151 in the exosomes of patients with PE, with lncRNA KCNQ1OT1 suggested as a potential downstream regulatory target. However, the precise function of miR-7151-5p in PE development has yet to be fully understood [13]. lncRNAs are associated with the control of vital cellular activities like proliferation, differentiation, and programmed cell death [14]. Among them, KCNQ1OT1 has emerged as an important regulatory molecule implicated in various diseases [15]. KCNQ1OT1 has been reported to control cellular processes such as proliferation, migration, and invasion by modulating miRNA levels [15]. Notably, KCNQ1OT1 has been recognized as a diagnostic and therapeutic biomarker of several diseases, including rectal cancer, cerebral ischemia–reperfusion injury, and diabetic nephropathy, where it is highly expressed in affected tissues [16,17,18].
In the context of PE, one study reported that KCNQ1OT1 negatively regulates miR-146a-3p, thereby activating the CXCL12/CXCR4 signaling pathway potentially contributing to disease pathogenesis [19]. Moreover, KCNQ1OT1 expression is transcriptionally regulated by multiple transcription factors, including β-catenin and c-Myc [20]. β-Catenin, for example, can bind directly to the KCNQ1OT1 promoter and enhance its transcription, influencing downstream genes [21]. Despite these insights, the regulatory mechanism of KCNQ1OT1 in remains incompletely understood [19].
Recent studies have increasingly highlighted the importance of miRNA–lncRNA interactions as key regulators in the development of PE, primarily by modulating trophoblast function, oxidative stress, ferroptosis, and placental development [2,22,23,24]. KCNQ1OT1 has emerged as a well-characterized lncRNA that acts as a competing endogenous RNA (ceRNA) in various diseases, including PE. It regulates ferroptosis-related genes such as SLC7A11 and GPX4, thereby influencing redox homeostasis and angiogenesis in the placenta [22,23]. Transcriptomic network analysis supports KCNQ1OT1 as a hub lncRNA within lncRNA–mRNA co-expression modules [24]. Based on this evidence, investigating the miR-7151-5p–KCNQ1OT1 axis offers novel insights into early-onset PE and provides a compelling rationale for further mechanistic exploration.
Our previous study provided preliminary evidence of a regulatory relationship between miR-7151-5p and KCNQ1OT1 in PE, suggesting their involvement in gene expression regulation associated with the disease [13]. However, it remains unclear whether miR-7151-5p directly binds to KCNQ1OT1, whether this interaction exerts functional effects on gene regulation in early-onset PE, and which disease-related signaling pathways are involved. The objective of this research is to elucidate the interaction between miR-7151-5p and the lncRNA KCNQ1OT1, characterize their biological functions in the context of PE, and uncover the signaling mechanisms involved. This work intends to advance current knowledge of PE pathophysiology and offer a foundation for future early screening strategies.
2. Materials and Methods
2.1. Human Chorionic Trophoblast Cell Culture
The HTR-8/SVneo cell line, derived from human extravillous trophoblast (hereafter referred to as HTR-8) was obtained from Shanghai Yizefeng Biotechnology Co., Ltd. (Shanghai, China). For culture, cells were cultured in RPMI-1640 medium (Gibco, Billings, MT, USA), which was supplemented with 10% fetal bovine serum (FBS), 100 U/mL penicillin, and 100 μg/mL streptomycin [25]. When cells reached 80–90% confluence, they were detached using 0.25% trypsin-EDTA [25].
2.2. Bioinformatics Prediction of the Binding Sites Between miR-7151-5p and KCNQ1OT1
RNAhybrid software(version 2.1.2) was utilized to conduct a bioinformatic analysis to identify potential binding sites between miR-7151-5p and the lncRNA KCNQ1OT1 [26]. The mature sequence of miR-7151-5p was obtained from the miRBase database(version 22.0) [27], and the full nucleotide sequence of KCNQ1OT1 was accessed via the Ensembl database(version 110) [28]. Base pairing predictions were performed using the RNAhybrid online tool [26], which calculated the minimum free energy (MFE) of hybridization to assess binding potential.
Binding predictions were validated based on two criteria: a free energy threshold of ΔG ≤ −20 kcal/mol and strong base pairing within the miRNA seed region [26]. The candidate binding sites identified by RNAhybrid were subsequently selected for functional validation using dual-luciferase reporter assays [26].
2.3. Dual-Luciferase Reporter Assay
To verify the interaction between miR-7151-5p and the predicted sites on lncRNA KCNQ1OT1, a dual-luciferase reporter assay was performed [29]. The WT fragment of KCNQ1OT1 with the putative miR-7151-5p-binding site was subcloned into the pMIR-REPORT luciferase vector (Ambion, Austin, TX, USA) [29]. To assess binding specificity, a mutant (MUT) construct with point substitutions at the target sites was generated in parallel [29]. HTR-8 cells in 24-well plates were co-transfected with 500 ng of either KCNQ1OT1-WT or MUT luciferase constructs and 50 nM miR-7151-5p mimic or NC mimic (Lipofectamine 3000, Invitrogen, Carlsbad, CA, USA) [30]. The internal control was a Renilla luciferase plasmid (pRL-TK, Promega, Madison, WI, USA) [30]. Firefly/Renilla ratios were calculated with a GloMax luminometer [31].
2.4. miR-7151-5p Overexpression and Inhibition Experiments
To explore the functional effects of miR-7151-5p in the trophoblast cells, miR-7151-5p mimics and inhibitors (2′-O-Methyl modified, chemically synthesized) were purchased from Platinum Biosciences Co., Ltd. (Shanghai, China) [32]. When HTR-8/SVneo cells reached approximately 80% confluence, they were trypsinized with 0.25% trypsin-EDTA, reseeded at a 30% density in 24-well plates, and incubated overnight for attachment [33]. The following day, when the cells reached ~60% confluence, which was widely recommended to ensure optimal cell health and transfection efficiency, while minimizing cytotoxicity and overgrowth during post-transfection incubation periods [34], Lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA) was used for miRNA transfection [35]. The study included four experimental groups, each performed in triplicate: blank control, fluorescent NC control, miR-7151-5p mimic, and miR-7151-5p inhibitor [35].
For each replicate, two 1.5 mL centrifuge tubes were prepared, each containing 50 μL of Opti-MEM serum-free medium (Gibco, Billings, MT, USA). In one tube, 2 μL of Lipofectamine 3000 was added; in the other, the mimic or inhibitor was added to 100 nM, consistent with concentrations commonly used in functional miRNA assays [36].
The culture medium in each well was refreshed with complete medium, followed by the dropwise addition of 100 μL of the transfection complex [36]. The plates were gently agitated to ensure uniform distribution and then incubated for 6 h [36]. Cells were maintained for an additional 48 h before proceeding with subsequent experiments [36].
2.5. Total RNA Extraction and qRT-PCR
RNA was isolated from HTR-8/SVneo cells using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) [37]. The RNA concentration and purity were measured using a NanoDrop (Thermo Fisher, Waltham, MA, USA) [37]. cDNA was generated using the PrimeScript™ RT Kit (Takara, Osaka, Japan) [37]. QRT-PCR was performed on a Bio-Rad CFX96 system, with TB Green® Premix Ex Taq™ II (Takara, Osaka, Japan) [37]. GAPDH was used as the internal reference, and relative expression was calculated based on the 2−ΔΔCt method [37]. Primers were as follows: KCNQ1OT1, forward: AGGGTGACAGTGTTTCATAGGCT, reverse: GAGGCACATTCATTCGTTGGT; NOTCH1, forward: AGAGGCGTGGCAGACT, reverse: TGTACTCCGTCAGCGTGAG; GAPDH, forward: GAAAGCCTGCCGGTGACTAA, reverse: TTCCCGTTCTCAGCCTTGAC.
2.6. Assessment of the Effects of Overexpression or Knockdown of Candidate miRNAs on Migration and Invasion of Chorionic Trophoblast Cells
HTR-8/SVneo cells were transfected with either miR-7151-5p mimics or inhibitors [35]. Forty-eight hours later, the cells were subjected to Transwell experiments to assess their migratory and invasive behavior [35]. These experiments were assessed with 24-well Transwell chambers (Corning, Corning, NY, USA, Cat#3422) [38]. HTR-8/SVneo cells (5 × 104) in serum-free RPMI-1640 were added to the upper chamber, while 10% FBS-containing medium was placed in the lower chamber [38]. After 24 h, non-migrated cells were removed; migrated cells were fixed, stained with crystal violet, and counted in five random 200× fields [38]. The experiment was set up with three replicate wells and repeated three times independently [38]. For the invasion experiment, the difference was that the upper chamber membrane was pre-coated with 1:8-diluted Matrigel gel (Corning, Corning, NY, USA, Cat#356234), and the other procedure was the same as that of the migration experiment [38].
Images were analyzed and cells were counted using ImageJ software (version 1.51) (NIH, Bethesda, MD, USA) [39]. Counts were averaged from five random fields per well [39]. Data were shown as the mean ± SD [39]. One-way ANOVA was used for analysis in GraphPad Prism 9.0, with p < 0.05 deemed significant [39].
2.7. RNA Extraction and Transcriptome Sequencing
In order to study the influence of miR-7151-5p overexpression and inhibition on global gene expression, transcriptome sequencing was conducted on HTR-8/SVneo cells transfected with miR-7151-5p mimics or inhibitors [34].
Total RNA was isolated 48 h after transfection using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) [37]. The RNA quality and concentration were measured with a NanoDrop, and integrity was checked using an Agilent 2100 Bioanalyzer [37]. Only samples meeting quality standards were used for subsequent sequencing [37]. RNA libraries were prepared from each sample, and sequencing was performed on an Illumina NovaSeq 6000, with PE150 (Illumina, San Diego, CA, USA) [37]. Quality control procedures were applied prior to library preparation and sequencing [37].
2.8. Data Preprocessing and Differentially Expressed Gene Analysis
The raw sequencing data quality was evaluated using FastQC [40]. Adapter sequences along with low-quality reads were trimmed using Trimmomatic (v0.39) [40]. Cleaned reads were mapped to the human reference genome (hg 19) with Hisat2 (v2.1.0), followed by transcript assembly and gene expression quantification with StringTie (v2.1.4) [41]. DESeq2 (v1.28.1) was used to identify significantly DEGs, defined by a |log2 fold change| > 1 and p < 0.05 [42].
2.9. Functional Annotation and Pathway Enrichment Analysis
DEG functional enrichment was analyzed using Kyoto Encyclopedia of Genes and Genomes (KEGG) and Gene Ontology (GO) databases [43] to identify signaling pathways potentially regulated by miR-7151-5p. The clusterProfiler R package (version 4.3.1) was used to perform enrichment analysis, applying the Benjamini–Hochberg method to adjust p-values [44]. p-values below 0.05 were used [44].
3. Results
3.1. Bioinformatics Prediction of the Binding Sites Between miR-7151-5p and KCNQ1OT1
To explore whether miR-7151-5p directly targets the IncRNA KCNQ1OT1, the RNAhybrid tool was used [26]. The analysis revealed a stable and complementary interaction between miR-7151-5p and the wild-type (WT) sequence of KCNQ1OT1, with an MFE of −37.3 kcal/mol, which indicates a high binding affinity (Figure 1A). The predicted binding region and detailed base-pairing interactions are illustrated in Figure 1B.
Figure 1.
Validation of the interaction between miR-7151-5p and KCNQ1OT1 through bioinformatic prediction and dual-luciferase reporter assay. (A) Prediction of binding sites between miR-7151-5p and the target gene KCNQ1OT1 using RNAhybrid software; (B) sequence of the predicted binding site; (C) dual-luciferase reporter assay validating the interaction between miR-7151-5p and KCNQ1OT1. WT: wild-type sequence; Mutant: mutated sequence; The psiCHECK2 plasmid was used for vector construction. Significance: p < 0.01 (**), not significant (ns).
3.2. Dual-Luciferase Reporter Assay Validates Direct Binding Between miR-7151-5p and KCNQ1OT1
The KCNQ1OT1 3′UTR fragment containing the putative miR-7151-5p-binding site was inserted into the psiCHECK2 vector. Both wild-type and mutant constructs were co-transfected with miR-7151-5p mimics or the negative control into HEK293T cells. As illustrated in Figure 1C, luciferase activity was inhibited in the KCNQ1OT1-WT co-transfected with miR-7151-5p group compared to the KCNQ1OT1-WT + NC group (p < 0.01), indicating that miR-7151-5p can directly bind to and suppresses KCNQ1OT1 expression. Conversely, the mutant construct showed no significant change in luciferase activity (KCNQ1OT1-Mutant) following co-transfection with miR-7151-5p mimics (p > 0.05), suggesting that the introduced mutation disrupted the miRNA-binding site.
3.3. miR-7151-5p Overexpression and Inhibition Experiments
To explore the regulatory effect of miR-7151-5p on its predicted target gene KCNQ1OT1 and the downstream gene Notch1 in human chorionic trophoblast cells (HTR8/SVneo), four experimental groups were established: miR-7151-5p overexpression group (mimic), miR-7151-5p inhibition group (inhibitor), negative control group (NC), and untreated control, as illustrated in Figure 2. The control group (HTR-8) consisted of untreated cells to provide a baseline for the comparison. A negative control group (HTR-8 + NC mimic) was transfected with a fluorescently labeled non-targeting miRNA mimic to control for nonspecific transfection effects. To induce overexpression, the miR-7151-5p mimic group was transfected with synthetic miR-7151-5p molecules, whereas the miR-7151-5p inhibitor group received specific inhibitors to downregulate endogenous miR-7151-5p activity. All groups were analyzed 48 h after transfection for downstream molecular and phenotypic assays. qRT-PCR was used to quantify the mRNA levels of miR-7151-5p and its target genes, with each experiment conducted in triplicate.
Figure 2.
Experimental groups and transfection strategy using the chorionic trophoblast cell line HTR-8/SVneo. To investigate the functional role of miR-7151-5p in trophoblast cells, four experimental groups were established and transfected accordingly: (A) HTR-8 (control group): untreated blank control group, used to assess baseline cell behavior without any transfection reagents. (B) HTR-8 + NC mimic (fluorescently labeled negative control): cells were transfected with a non-targeting miRNA mimic labeled with a fluorescent dye. (C) miR-7151-5p mimic group (overexpression group): cells were transfected with chemically synthesized miR-7151-5p mimics to artificially increase its intracellular levels. (D) miR-7151-5p inhibitor group (inhibition group): cells were transfected with miR-7151-5p inhibitors to reduce endogenous miR-7151-5p activity. All groups were analyzed 48 h post-transfection for subsequent phenotypic and molecular assays.
Figure 3A–C demonstrate that KCNQ1OT1 expression was significantly decreased in the miR-7151-5p mimic group (p < 0.001), whereas the inhibitor group showed no notable difference (p > 0.05), implying that miR-7151-5p exerts a suppressive effect on KCNQ1OT1 expression. Likewise, Notch1 expression was significantly downregulated in the miR-7151-5p mimic group (Figure 3D–F, p < 0.001), while no notable difference was observed following miR-7151-5p inhibition (p > 0.05). These results imply that miR-7151-5p may regulate Notch1 expression either directly or through alternative pathways, independent of KCNQ1OT1.
Figure 3.
Regulatory relationship between miRNAs and candidate target genes. This figure illustrates the expression changes of KCNQ1OT1, a predicted direct target of miR-7151-5p, and its downstream effector Notch1, a known regulator of trophoblast function and placental development. Experimental groups included miR-7151-5p overexpression (mimic) and knockdown (inhibitor), along with their respective negative controls. (A–C) Expression levels of the candidate target gene KCNQ1OT1 regulated by miR-7151-5p. (D–F) Expression levels of the downstream target gene Notch1 of KCNQ1OT1, regulated by miR-7151-5p. Significance: p < 0.001 (***), p < 0.01 (**), p < 0.05 (*), not significant (ns).
The miR-7151-5p inhibitor group showed no significant change in target gene expression, possibly due to compensatory mechanisms or low baseline miR-7151-5p levels.
3.4. Assessment of the Effects of Overexpression or Knockdown of Candidate miRNAs on Migration and Invasion of Chorionic Trophoblast Cells
Four experimental groups were included: miRNA-7151 overexpression group (mimic-miRNA-7151), mimic negative control (mimic-NC), miRNA-7151 inhibition group (inhibitor-miRNA-7151), and inhibitor negative control (inhibitor-NC). Following Transwell incubation, cells were visualized using crystal violet staining, visualized with a microscope at 400× magnification (Figure 4A), and subjected to quantitative analysis (Figure 4B,C).
Figure 4.
MiR-7151-5p regulates migration and invasion in chorionic trophoblast cells. (A) Representative images from Transwell migration (upper) and invasion (lower) assays of HTR-8/SVneo cells transfected with miR-7151-5p mimic or inhibitor. Cells were stained with crystal violet after 48 h post-transfection. (B) Quantification of migrated cells. (C) Quantification of invaded cells. Y-axis represents the relative number of cells (fold change) normalized to the corresponding negative control group. Experimental groups: mimic-NC: negative control for mimic; mimic-miR-7151-5p: cells overexpressing miR-7151-5p; inhibitor-NC: negative control for inhibitor; inhibitor-miR-7151-5p: cells with miR-7151-5p knockdown. One-way ANOVA with Tukey’s post hoc test was used for statistical comparisons: In (B): mimic-NC vs. mimic-miR-7151-5p: p < 0.01 (**), inhibitor-NC vs. inhibitor-miR-7151-5p: p < 0.0001 (****). In (C): mimic-NC vs. mimic-miR-7151-5p: p < 0.01 (**), inhibitor-NC vs. inhibitor-miR-7151-5p: p < 0.001 (***). Data are shown as the mean ± SD from three independent experiments. Magnification: 400×. Significance: p < 0.0001 (****), p < 0.001 (***), p < 0.01 (**).
The results indicated that miRNA-7151 overexpression significantly suppressed the migration and invasion capabilities of trophoblast cells. The mimic-miR-7151-5p group showed a significant decrease in the number of migrating and invading cells (p < 0.01 for both). In contrast, the inhibition of miRNA-7151 expression markedly enhanced HTR8 cell migration and invasion. In the inhibitor-miRNA-7151 group, the number of migrating cells increased significantly compared to the inhibitor-NC group (p < 0.001), along with a substantial rise in invading cells (p < 0.001).
3.5. RNA Extraction and Transcriptome Sequencing
Comparative transcriptomic analysis revealed a distinct set of DEGs in the miRNA-7151 mimic group relative to the control. A heatmap of these genes (Figure 5A) showed clear differential gene expression patterns, with clustering analysis distinctly separating the mimic and NC samples. These findings indicate that miRNA-7151 overexpression induced a specific transcriptional response in trophoblast cells. Several genes related to transcriptional transduction, chromatin remodeling, and metabolic regulation were significantly up- or downregulated.
Figure 5.
Transcriptomic and pathway analysis of HTR-8/SVneo cells transfected with miR-7151-5p mimic versus negative control (mimic_NC). To investigate the global transcriptomic changes induced by miR-7151-5p overexpression in trophoblast cells, RNA-seq was performed on HTR-8/SVneo cells transfected with either a miR-7151-5p mimic or mimic-NC. DEGs were identified and subjected to functional enrichment analysis, which was used to explore the underlying biological pathways potentially regulated by miR-7151-5p. (A) DEGs in the mimic_NC group, the thresholds for statistical significance were set at an adjusted p < 0.05 and |log2FC| ≥ 1. (B) KEGG pathway enrichment analysis for the mimic_NC group, pathways with adjusted p < 0.05 (Benjamini–Hochberg corrected), which were considered significantly enriched.
3.6. Gene Function Annotation and Enrichment Analysis
KEGG pathway enrichment analysis of DEGs between the mimic and mimic-NC groups showed significant enrichment in the TGF-β signaling pathway (Figure 5B). The TGF-β signaling pathway was essential for controlling cell proliferation and differentiation, migration, and immune modulation and has been reported to have key regulatory functions in the development of PE [45]. These results suggest that miRNA-7151 may influence trophoblast function via the TGF-β signaling pathway, thereby participating in PE pathogenesis.
Further DEG screening identified six genes in the mimic group closely associated with PE: PLAC1, ANGPTL6, HIRA, GLA, HSF1, and BAG6 (Table 1). Among these, PLAC1 (log2FC = 3.51), ANGPTL6 (log2FC = 2.32), and HIRA (log2FC = 1.44) were significantly upregulated, while GLA (log2FC = −1.41), HSF1 (log2FC = −1.92), and BAG6 (log2FC = −4.51) were significantly downregulated (p < 0.05 for all). These genes are known to be involved in pregnancy-related pathological processes, placental development abnormalities, or maternal–fetal interface immune regulation [46,47,48,49,50,51,52], suggesting they may serve as key downstream effectors in miRNA-7151-mediated PE pathogenesis.
Table 1.
DEGs for miR-7151-5p mimic and NC group links with PE.
In summary, miRNA-7151 may participate in the pathological process of PE by regulating both the TGF-β signaling pathway and critical PE-associated genes.
3.7. PPI Analysis
Based on the RNA-seq results, a set of DEGs was used to construct a PPI network utilizing the STRING database (Figure 6A). The analysis showed that histone family members (such as H4C6) formed a highly interconnected core module within the network, suggesting that the chromatin structure and epigenetic regulation may play crucial roles in the biological processes modulated by miR-7151-5p. Additionally, genes such as EMG1 and CHD1L were found to be connected—either directly or indirectly—with the core module, indicating their potential involvement in chromatin regulation-related processes.
Figure 6.
PPI network and TGF-β signaling pathway analysis of the miR-7151-5p mimic vs. NC group. To further elucidate the molecular mechanisms by which miR-7151-5p regulates trophoblast function, we analyzed the PPI networks and enriched signaling pathways based on the DEGs identified from transcriptome sequencing. (A) PPI network analysis of the mimic_NC group. (B) TGF-β receptor signaling pathway analysis.
3.8. Functional Enrichment Analysis
Further functional enrichment analysis confirmed that the TGF-β signaling pathway was significantly enriched among DEGs (Figure 6B). The pathway diagram revealed the involvement of several key components of this pathway, including TGFβ1, BMP4 ligands, TGFBR receptors, and SMAD family members, all of which are central to TGF-β pathway activity. Downstream co-regulatory factors such as FOS and FOXH1 were also differentially expressed, suggesting their participation in the transcriptional regulation of TGF-β-target genes [59]. Additionally, the presence of inhibitory regulators such as SMAD6 and SMAD7 suggests that the TGF-β pathway has a complex feedback regulation mechanism.
4. Discussion
Our study systematically illustrated that miR-7151-5p suppressed the migration and invasion of trophoblast cell by directly binding the lncRNA KCNQ1OT1, negatively regulating the Notch1 signaling pathway and affecting the TGF-β pathway. Our results uniquely demonstrate that miR-7151-5p modulates TGF-β signaling in trophoblast cells, potentially altering placental function in PE.
Using RNAhybrid prediction and the dual-luciferase reporter assays, we noticed that miR-7151-5p can target to the 3′UTR of KCNQ1OT1, which significantly suppresses its expression. These results aligns with previous studies; miR-146a-3p interacts with KCNQ1OT1 to regulate trophoblast function via the CXCL12/CXCR4 pathway [19]. But the link between miR-7151-5p and KCNQ1OT1 has not been previously reported. Our study is the first to identify this regulatory relationship, thereby filling an important gap in the understanding of lncRNA–miRNA interactions in PE pathogenesis.
Further analysis showed that the overexpression of miR-7151-5p not only suppresses KCNQ1OT1 but also significantly reduces Notch1 mRNA levels. The Notch1 signaling pathway is linked to placental development and trophoblast cell function [60]. Its dysregulation contributes to the development of PE [2]. Our research demonstrates that miR-7151-5p might be associated with the pathogenesis of PE by modulating Notch1 signaling.
The results of the transwell assay illustrated that the overexpression of miR-7151-5p could markedly inhibit the invasion and migration of HTR8/SVneo trophoblast cells, whereas miR-7151-5p inhibition promotes these abilities. Our results aligned with previously published studies on miRNAs such as miR-210 and miR-362-3p, which also regulate trophoblast function in PE [13]. However, the specific mechanisms of miR-7151-5p in modulating trophoblast motility had not been previously characterized. Our study provides novel experimental evidence supporting its involvement in PE pathogenesis. Our evidence indicates that miRNA-7151 may play a key role in regulating signaling pathways related to cell motility, supporting the stability of the placental structure and influencing the invasion processes. It also provides an experimental basis for further research into its potential mechanisms in pregnancy-related disorders, such as preeclampsia and placenta accrete [61].
RNA sequencing and KEGG pathway analysis revealed that miR-7151-5p overexpression significantly impacts the TGF-β signaling pathway and regulates the expression of multiple PE-related genes, including PLAC1, ANGPTL6, HIRA, GLA, HSF1, and BAG6 [46,47,48,49,50,51,52]. They are known to play important roles in placental development, immune regulation, and apoptosis, and their aberrant expression may contribute to the pathogenesis of PE [62]. By linking miR-7151-5p to both the TGF-β signaling pathway and a network of PE-related genes, this study expands our understanding of the molecular mechanisms through which miR-7151-5p may play a role in trophoblast dysfunction and the pathogenesis of PE.
Unlike previous research focusing on miRNAs such as miR-210 or miR-181, this research was the first to systematically explore the function and molecular mechanisms of miR-7151-5p in PE. We not only confirmed the direct interaction between miR-7151-5p and KCNQ1OT1, but also revealed that miR-7151-5p modulates trophoblast cell function through regulation of the Notch1 and TGF-β pathways, potentially contributing to PE pathogenesis. These findings suggest novel targets for the early screening and therapeutic intervention of PE.
5. Limitations
Although our study provides valuable insights, there are several limitations that need to be acknowledged. Firstly, all functional assays used the HTR-8/SVneo cell line, an immortalized first-trimester trophoblast model. While widely used, this in vitro system cannot fully recapitulate the complex architecture, heterogeneity, and maternal–fetal interactions present in the human placenta [63]. Therefore, the observed effects of miR-7151-5p on trophoblast migration and invasion should be interpreted with caution when extrapolating to in vivo placental development. Second, no primary placental tissues or clinical PE samples were included in this study. This limits the immediate translational applicability of our findings, and highlights the need for future validation in patient-derived placental tissues across different gestational stages and preeclampsia subtypes (e.g., early-onset vs. late-onset PE) [64]. Moreover, the study did not include the in vivo functional validation of miR-7151-5p’s role in placentation or PE pathogenesis. Future research should employ relevant rodent models of PE, such as transgenic and knockout mouse models that modulate miRNA expression in trophoblasts [65]. These systems would allow for the evaluation of the physiological consequences of miR-7151-5p dysregulation in vivo. Finally, although a transcriptomic analysis identified six DEGs as potential downstream effectors of miR-7151-5p, we did not perform qPCR or Western blot validation of these targets. Future studies should confirm the expression and functional roles of these DEGs to strengthen the mechanistic link between miR-7151-5p and PE pathogenesis.
In conclusion, the workflow and key results of the study are shown in Figure 7. This study revealed the critical role of miR-7151-5p in the pathogenesis of PE. miR-7151-5p directly targets the lncRNA KCNQ1OT1, regulates the Notch1 signaling pathway, and affects trophoblast cell invasion and migration. Additionally, it modulates the expression of PE-related genes via the TGF-β signaling pathway, thereby contributing to the disease’s development. Together, these findings provide novel mechanistic insights and suggest that miR-7151-5p might be utilized as a predictive marker for the early screening of PE.
Figure 7.
Workflow and key results of the study. An integrative approach combining RNAhybrid-based bioinformatic prediction (A), dual-luciferase reporter assays (B), qRT-PCR (C), transwell migration and invasion assays (D), and RNA-seq (E) was employed to systematically analyze the interaction between miR-7151-5p and KCNQ1OT1 and assess their effects on trophoblast cell function behavior and gene expression. Significance: p < 0.001 (***), p < 0.01 (**), not significant (ns).
Author Contributions
P.T. and S.Q. conceived the original design and contributed to manuscript revision. W.W. drafted the manuscript and conducted data analysis. P.T., W.Z., X.W., and J.G. were responsible for biological sample collection. L.C. performed critical manuscript revisions, and both L.C. and X.S. contributed to language editing. All authors have read and agreed to the published version of the manuscript.
Funding
This research was funded by the Science and Technology Bureau of Jiaxing, China (2022AY10028), the Medical and Health Technology Program of Zhejiang Province, China (Grant No. 2021KY357), and Medical and Health Technology Project of Zhejiang, China (2023KY1220). This work was additionally funded by the Guangzhou Postdoctoral Research Foundation.
Institutional Review Board Statement
This study was reviewed and approved by the Medical Ethics Committee of Jiaxing Maternal and Child Health Hospital (Approval No. KY-2023-003; approval date: 02 February 2023 ).
Informed Consent Statement
Written informed consent was obtained from all participants involved in the study, including consent for publication.
Data Availability Statement
Raw data were generated at the Bio-X Institutes, Shanghai Jiao Tong University, and are available from the corresponding author upon request.
Acknowledgments
We would like to thank all attendees of this work, especially Haifeng Li, Weijia Tang, Hao Wu, Na Zhang, Cong Huai, Wen Ren, Xiwen Xue, and Lu Shen, for their valuable suggestions regarding data analysis and the experiment procedures.
Conflicts of Interest
The authors declare no conflicts of interest.
References
- Mol, B.W.J.; Roberts, C.T.; Thangaratinam, S.; Magee, L.A.; De Groot, C.J.M.; Hofmeyr, G.J. Pre-Eclampsia. Lancet 2016, 387, 999–1011. [Google Scholar] [CrossRef] [PubMed]
- Sun, N.; Qin, S.; Zhang, L.; Liu, S. Roles of Noncoding RNAs in Preeclampsia. Reprod. Biol. Endocrinol. 2021, 19, 100. [Google Scholar] [CrossRef] [PubMed]
- Tannetta, D.; Collett, G.; Vatish, M.; Redman, C.; Sargent, I. Syncytiotrophoblast Extracellular Vesicles–Circulating Biopsies Reflecting Placental Health. Placenta 2017, 52, 134–138. [Google Scholar] [CrossRef] [PubMed]
- Salomon, C.; Guanzon, D.; Scholz-Romero, K.; Longo, S.; Correa, P.; Illanes, S.E.; Rice, G.E. Placental Exosomes as Early Biomarker of Preeclampsia: Potential Role of Exosomalmicrornas across Gestation. J. Clin. Endocrinol. Metab. 2017, 102, 3182–3194. [Google Scholar] [CrossRef] [PubMed]
- Li, H.; Ouyang, Y.; Sadovsky, E.; Parks, W.T.; Chu, T.; Sadovsky, Y. Unique microRNA Signals in Plasma Exosomes from Pregnancies Complicated by Preeclampsia. Hypertension 2020, 75, 762–771. [Google Scholar] [CrossRef] [PubMed]
- Pillay, P.; Vatish, M.; Duarte, R.; Moodley, J.; Mackraj, I. Exosomal microRNA Profiling in Early and Late Onset Preeclamptic Pregnant Women Reflects Pathophysiology. Int. J. Nanomed. 2019, 14, 5637–5657. [Google Scholar] [CrossRef] [PubMed]
- Kasimanickam, R.; Kasimanickam, V. MicroRNAs in the Pathogenesis of Preeclampsia—A Case-Control In Silico Analysis. Curr. Issues Mol. Biol. 2024, 46, 3438–3459. [Google Scholar] [CrossRef] [PubMed]
- Shen, L.; Li, Y.; Li, R.; Diao, Z.; Yany, M.; Wu, M.; Sun, H.; Yan, G.; Hu, Y. Placenta-Associated Serum Exosomal miR-155 Derived from Patients with Preeclampsia Inhibits eNOS Expression in Human Umbilical Vein Endothelial Cells. Int. J. Mol. Med. 2018, 41, 1731–1739. [Google Scholar] [CrossRef] [PubMed]
- Munjas, J.; Sopić, M.; Stefanović, A.; Košir, R.; Ninić, A.; Joksić, I.; Antonić, T.; Spasojević-Kalimanovska, V.; Prosenc Zmrzljak, U. Non-Coding RNAs in Preeclampsia—Molecular Mechanisms and Diagnostic Potential. Int. J. Mol. Sci. 2021, 22, 10652. [Google Scholar] [CrossRef] [PubMed]
- Anton, L.; Olarerin-George, A.O.; Schwartz, N.; Srinivas, S.; Bastek, J.; Hogenesch, J.B.; Elovitz, M.A. MiR-210 Inhibits Trophoblast Invasion and Is a Serum Biomarker for Preeclampsia. Am. J. Pathol. 2013, 183, 1437–1445. [Google Scholar] [CrossRef] [PubMed]
- Koushki, M.; Amiri-Dashatan, N.; Khodadadi, M.; Masnavi, E.; Doustimotlagh, A.H. The Potential Predictive Value of miR-181 in Women with Preeclampsia: A Systematic Review and Meta-Analysis. BMC Pregnancy Childbirth 2025, 25, 474. [Google Scholar] [CrossRef] [PubMed]
- Wang, N.; Feng, Y.; Xu, J.; Zou, J.; Chen, M.; He, Y.; Liu, H.; Xue, M.; Gu, Y. miR-362-3p Regulates Cell Proliferation, Migration and Invasion of Trophoblastic Cells under Hypoxia through Targeting Pax3. Biomed. Pharmacother. 2018, 99, 462–468. [Google Scholar] [CrossRef] [PubMed]
- Wang, W.; Zhang, W.; Chen, L.; Wu, X.; Gu, J.; Yang, F.; Wang, B.; Qin, S.; Tang, P. Identification of Differentially Expressed miRNAs in Plasma Exosomes from Patients with Early-Onset Pre-Eclampsia Using next Generation Sequencing. Heliyon 2024, 10, e24543. [Google Scholar] [CrossRef] [PubMed]
- Ponting, C.P.; Oliver, P.L.; Reik, W. Evolution and Functions of Long Noncoding RNAs. Cell 2009, 136, 629–641. [Google Scholar] [CrossRef] [PubMed]
- Taheri, M.; Shirvani-Farsani, Z.; Harsij, A.; Fathi, M.; Khalilian, S.; Ghafouri-Fard, S.; Baniahmad, A. A Review on the Role of KCNQ1OT1 lncRNA in Human Disorders. Pathol.-Res. Pract. 2024, 255, 155188. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Yi, M.; Wang, D.; Zhang, Q.; Yang, L.; Yang, C. LncRNA KCNQ1OT1 Regulates Endoplasmic Reticulum Stress to Affect Cerebral Ischemia-Reperfusion Injury Through Targeting miR-30b/GRP78. Inflammation 2020, 43, 2264–2275. [Google Scholar] [CrossRef] [PubMed]
- Huang, X.; Tan, J.; Li, Y.; Su, H.; Huang, M.; Huang, F.; Huang, P. Expression of LncRNA KCNQ1Ot1 in Diabetic Nephropathy and Its Correlation with MEK/ERK Signaling Pathway. Am. J. Transl. Res. 2022, 14, 1796–1806. [Google Scholar] [PubMed]
- Zhao, L.; Chen, H.; Wu, L.; Li, Z.; Zhang, R.; Zeng, Y.; Yang, T.; Ruan, H. LncRNA KCNQ1OT1 Promotes the Development of Diabetic Nephropathy by Regulating miR-93-5p/ROCK2 Axis. Diabetol. Metab. Syndr. 2021, 13, 108. [Google Scholar] [CrossRef] [PubMed]
- Chen, F.R.; Zheng, L.M.; Wu, D.C.; Gong, H.M.; Cen, H.; Chen, W.C. Regulatory Relationship between lncRNA KCNQ1OT1 and miR-146a-3p in Preeclampsia. Zhonghua Fu Chan Ke Za Zhi 2020, 55, 535–543. [Google Scholar] [PubMed]
- Rapetti-Mauss, R.; Bustos, V.; Thomas, W.; McBryan, J.; Harvey, H.; Lajczak, N.; Madden, S.F.; Pellissier, B.; Borgese, F.; Soriani, O.; et al. Bidirectional KCNQ1:β-Catenin Interaction Drives Colorectal Cancer Cell Differentiation. Proc. Natl. Acad. Sci. USA 2017, 114, 4159–4164. [Google Scholar] [CrossRef] [PubMed]
- Sunamura, N.; Ohira, T.; Kataoka, M.; Inaoka, D.; Tanabe, H.; Nakayama, Y.; Oshimura, M.; Kugoh, H. Regulation of Functional KCNQ1OT1 lncRNA by β-Catenin. Sci. Rep. 2016, 6, 20690. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Zhang, J.; Chen, S.; Li, M.; Yang, J.; Tan, J.; He, B.; Zhu, L. Unveiling the Network Regulatory Mechanism of ncRNAs on the Ferroptosis Pathway: Implications for Preeclampsia. Int. J. Womens Health 2024, 16, 1633–1651. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.; Zhang, Y.; Xie, S.; Zhou, X.; Zhu, L.; Cao, Y. Establishment of a Placental lncRNA-mRNA Expression Network for Early-Onset Preeclampsia. BMC Pregnancy Childbirth 2024, 24, 329. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Z.; Wang, P.; Zhang, L.; Huang, C.; Gao, J.; Li, Y.; Yang, B. Identification of Key Genes and Long Noncoding RNA-Associated Competing Endogenous RNA (ceRNA) Networks in Early-Onset Preeclampsia. BioMed Res. Int. 2020, 2020, 1673486. [Google Scholar] [CrossRef] [PubMed]
- Novoa-Herran, S.; Umaña-Perez, A.; Canals, F.; Sanchez-Gomez, M. Serum Depletion Induces Changes in Protein Expression in the Trophoblast-Derived Cell Line HTR-8/SVneo. Cell. Mol. Biol. Lett. 2016, 21, 22. [Google Scholar] [CrossRef] [PubMed]
- Kruger, J.; Rehmsmeier, M. RNAhybrid: MicroRNA Target Prediction Easy, Fast and Flexible. Nucleic Acids Res. 2006, 34, W451–W454. [Google Scholar] [CrossRef] [PubMed]
- MicroRNA Protocols. Methods in Molecular Biology; Ying, S.-Y., Ed.; Humana Press: Totowa, NJ, USA, 2006; ISBN 978-1-58829-581-1. [Google Scholar]
- Hubbard, T. The Ensembl Genome Database Project. Nucleic Acids Res. 2002, 30, 38–41. [Google Scholar] [CrossRef] [PubMed]
- Li, L.; Lv, G.; Wang, B.; Ma, H. Long Non-Coding RNA KCNQ1OT1 Promotes Multidrug Resistance in Chordoma by Functioning as a Molecular Sponge of miR-27b-3p and Subsequently Increasing ATF2 Expression. Cancer Manag. Res. 2020, 12, 7847–7853. [Google Scholar] [CrossRef] [PubMed]
- Kuhn, D.E.; Martin, M.M.; Feldman, D.S.; Terry, A.V., Jr.; Elton, T.S. Experimental Validation of miRNA Targets. Methods 2008, 44, 47–54. [Google Scholar] [CrossRef] [PubMed]
- Sherf, B.A.; Navarro, S.L.; Hannah, R.R.; Wood, K.V. Dual-LuciferaseTM Reporter Assay: An Advanced Co-Reporter Technology Integrating Firefly and Renilla Luciferase Assays. Promega Notes 1996, 57, 2–8. [Google Scholar]
- Esau, C.C. Inhibition of microRNA with Antisense Oligonucleotides. Methods 2008, 44, 55–60. [Google Scholar] [CrossRef] [PubMed]
- Luo, R.; Shao, X.; Xu, P.; Liu, Y.; Wang, Y.; Zhao, Y.; Liu, M.; Ji, L.; Li, Y.; Chang, C.; et al. MicroRNA-210 Contributes to Preeclampsia by Downregulating Potassium Channel Modulatory Factor 1. Hypertension 2014, 64, 839–845. [Google Scholar] [CrossRef] [PubMed]
- Muralimanoharan, S.; Maloyan, A.; Mele, J.; Guo, C.; Myatt, L.G.; Myatt, L. MIR-210 Modulates Mitochondrial Respiration in Placenta with Preeclampsia. Placenta 2012, 33, 816–823. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Liu, Y.; Liu, X.; Yang, J.; Teng, G.; Zhang, L.; Zhou, C. miR-124 Inhibits Cell Proliferation, Migration and Invasion by Directly Targeting SOX9 in Lung Adenocarcinoma. Oncol. Rep. 2016, 35, 3115–3121. [Google Scholar] [CrossRef] [PubMed]
- Lin, S.; Que, Y.; Que, C.; Li, F.; Deng, M.; Xu, D. Exosome miR-3184-5p Inhibits Gastric Cancer Growth by Targeting XBP1 to Regulate the AKT, STAT3, and IRE1 Signalling Pathways. Asia-Pac. J. Clncl Oncol. 2023, 19, e27–e38. [Google Scholar] [CrossRef] [PubMed]
- Chomczynski, P.; Sacchi, N. The Single-Step Method of RNA Isolation by Acid Guanidinium Thiocyanate–Phenol–Chloroform Extraction: Twenty-Something Years On. Nat. Protoc. 2006, 1, 581–585. [Google Scholar] [CrossRef] [PubMed]
- Fan, M.; Xu, Y.; Hong, F.; Gao, X.; Xin, G.; Hong, H.; Dong, L.; Zhao, X. Rac1/β-Catenin Signalling Pathway Contributes to Trophoblast Cell Invasion by Targeting Snail and MMP9. Cell. Physiol. Biochem. 2016, 38, 1319–1332. [Google Scholar] [CrossRef] [PubMed]
- Schneider, C.A.; Rasband, W.S.; Eliceiri, K.W. NIH Image to ImageJ: 25 Years of Image Analysis. Nat. Methods 2017, 9, 671–675. [Google Scholar] [CrossRef] [PubMed]
- Bonfield, J.K.; Mahoney, M.V. Compression of FASTQ and SAM Format Sequencing Data. PLoS ONE 2013, 8, e59190. [Google Scholar] [CrossRef] [PubMed]
- Pertea, M.; Pertea, G.M.; Antonescu, C.M.; Chang, T.-C.; Mendell, J.T.; Salzberg, S.L. StringTie Enables Improved Reconstruction of a Transcriptome from RNA-Seq Reads. Nat. Biotechnol. 2015, 33, 290–295. [Google Scholar] [CrossRef] [PubMed]
- Love, M.I.; Huber, W.; Anders, S. Moderated Estimation of Fold Change and Dispersion for RNA-Seq Data with DESeq2. Genome Biol. 2014, 15, 550. [Google Scholar] [CrossRef] [PubMed]
- Chen, L.; Zhang, Y.-H.; Lu, G.; Huang, T.; Cai, Y.-D. Analysis of Cancer-Related lncRNAs Using Gene Ontology and KEGG Pathways. Artif. Intell. Med. 2017, 76, 27–36. [Google Scholar] [CrossRef] [PubMed]
- Ferreira, J.A.; Zwinderman, A.H. On the Benjamini–Hochberg Method. Ann. Stat. 2006, 34, 1827–1849. [Google Scholar] [CrossRef]
- Prijanti, A.R.; Oktavia, N.T.; Iswanti, F.C.; Mudjihartini, N.; Purwosunu, Y. Increase in Transforming Growth Factor-β Didnot Affect Trombospondin1 in Preeclampsia Placentas. Turk. J. Obstet. Gynecol. 2023, 20, 22–28. [Google Scholar] [CrossRef] [PubMed]
- Wan, L.; Sun, D.; Xie, J.; Du, M.; Wang, P.; Wang, M.; Lei, Y.; Wang, H.; Wang, H.; Dong, M. Declined Placental PLAC1 Expression Is Involved in Preeclampsia. Medicine 2019, 98, e17676. [Google Scholar] [CrossRef] [PubMed]
- Hian Tan, K.; Sim Tan, S.; Sze, S.K.; Ryan Lee, W.K.; Jack Ng, M.; Kiang Lim, S. Plasma Biomarker Discovery in Preeclampsia Using a Novel Differential Isolation Technology for Circulating Extracellular Vesicles. Am. J. Obstet. Gynecol. 2014, 211, 380.e1–380.e13. [Google Scholar] [CrossRef] [PubMed]
- Park, Y.; Cho, G.J.; Kim, L.Y.; Lee, T.-S.; Oh, M.-J.; Kim, Y.-H. Preeclampsia Increases the Incidence of Postpartum Cerebrovascular Disease in Korean Population. J. Korean Med. Sci. 2018, 33, e35. [Google Scholar] [CrossRef] [PubMed]
- Tang, N.; He, Y.; Karatela, S.; Zhong, J.; Zeng, X.; Lu, Q.; Zhao, F.; Cai, L. Association between Erythrocyte Polyunsaturated Fatty Acids and Gestational Diabetes Mellitus in Chinese Pregnant Women. Eur. J. Nutr. 2025, 64, 87. [Google Scholar] [CrossRef] [PubMed]
- Pan, H.; Wan, J. Serum HSF1 Is Upregulated in Endometriosis Patients and Serves as a Potential Diagnostic Biomarker. Kaohsiung J. Med. Sci. 2023, 39, 1045–1051. [Google Scholar] [CrossRef] [PubMed]
- Liu, H.; Wang, Z.; Li, Y.; Chen, Q.; Jiang, S.; Gao, Y.; Wang, J.; Chi, Y.; Liu, J.; Wu, X.; et al. Hierarchical lncRNA Regulatory Network in Early-Onset Severe Preeclampsia. BMC Biol. 2024, 22, 159. [Google Scholar] [CrossRef] [PubMed]
- Manoharan, A.; Ballambattu, V.B.; Palani, R. Genetic Architecture of Preeclampsia. Clin. Chim. Acta 2024, 558, 119656. [Google Scholar] [CrossRef] [PubMed]
- Heldin, C.-H.; Moustakas, A. Signaling Receptors for TGF-β Family Members. Cold Spring Harb. Perspect. Biol. 2016, 8, a022053. [Google Scholar] [CrossRef] [PubMed]
- Haider, S.; Meinhardt, G.; Saleh, L.; Fiala, C.; Pollheimer, J.; Knöfler, M. Notch1 Controls Development of the Extravillous Trophoblast Lineage in the Human Placenta. Proc. Natl. Acad. Sci. USA 2016, 113, E7710–E7719. [Google Scholar] [CrossRef] [PubMed]
- Knöfler, M.; Haider, S.; Saleh, L.; Pollheimer, J.; Gamage, T.K.J.B.; James, J. Human Placenta and Trophoblast Development: Key Molecular Mechanisms and Model Systems. Cell. Mol. Life Sci. 2019, 76, 3479–3496. [Google Scholar] [CrossRef] [PubMed]
- Ghosh, S.; Thamotharan, S.; Fong, J.; Lei, M.Y.Y.; Janzen, C.; Devaskar, S.U. Circulating Extracellular Vesicular microRNA Signatures in Early Gestation Show an Association with Subsequent Clinical Features of Pre-Eclampsia. Sci. Rep. 2024, 14, 16770. [Google Scholar] [CrossRef] [PubMed]
- James, J.L.; Carter, A.M.; Chamley, L.W. Human Placentation from Nidation to 5 Weeks of Gestation. Part I: What Do We Know about Formative Placental Development Following Implantation? Placenta 2012, 33, 327–334. [Google Scholar] [CrossRef] [PubMed]
- Rana, S.; Lemoine, E.; Granger, J.P.; Karumanchi, S.A. Preeclampsia: Pathophysiology, Challenges, and Perspectives. Circ. Res. 2019, 124, 1094–1112. [Google Scholar] [CrossRef] [PubMed]
- Frazier, S.; McBride, M.W.; Mulvana, H.; Graham, D. From Animal Models to Patients: The Role of Placental microRNAs, miR-210, miR-126, and miR-148a/152 in Preeclampsia. Clin. Sci. 2020, 134, 1001–1025. [Google Scholar] [CrossRef] [PubMed]
- Fant, M.; Weisoly, D.L.; Cocchia, M.; Huber, R.; Khan, S.; Lunt, T.; Schlessinger, D. PLAC1, a Trophoblast-specific Gene, Is Expressed throughout Pregnancy in the Human Placenta and Modulated by Keratinocyte Growth Factor. Mol. Reprod. Devel 2002, 63, 430–436. [Google Scholar] [CrossRef] [PubMed]
- Maynard, S.E.; Karumanchi, S.A. Angiogenic Factors and Preeclampsia. In Seminars in Nephrology; Elsevier: Amsterdam, The Netherlands, 2011. [Google Scholar]
- Lee, B.-K.; Salamah, J.; Cheeran, E.; Adu-Gyamfi, E.A. Dynamic and Distinct Histone Modifications Facilitate Human Trophoblast Lineage Differentiation. Sci. Rep. 2024, 14, 4505. [Google Scholar] [CrossRef] [PubMed]
- Jebbink, J.M.; Boot, R.G.; Keijser, R.; Moerland, P.D.; Aten, J.; Veenboer, G.J.M.; Van Wely, M.; Buimer, M.; Ver Loren Van Themaat, E.; Aerts, J.M.F.G.; et al. Increased Glucocerebrosidase Expression and Activity in Preeclamptic Placenta. Placenta 2015, 36, 160–169. [Google Scholar] [CrossRef] [PubMed]
- Padmini, E.; Lavanya, S. Over Expression of HSP70 and HSF1 in Endothelial Cells during Pre-Eclamptic Placental Stress: Pre-Eclamptic Stress and HSP70-HSF1 Expression. Aust. N. Z. J. Obstet. Gynaecol. 2011, 51, 47–52. [Google Scholar] [CrossRef] [PubMed]
- Kukor, Z. Nutrigenetic Investigations in Preeclampsia. Nutrients 2024, 16, 3248. [Google Scholar] [CrossRef] [PubMed]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).