The Crossregulation Triggered by Bacillus Strains Is Strain-Specific and Improves Adaptation to Biotic and Abiotic Stress in Arabidopsis
Abstract
1. Introduction
2. Results
2.1. Selection of PGPR: 16S rRNA Analysis and Biological Assay to Biotic and Abiotic Stress
2.2. Effects of Stress Challenge on Photosynthetic Performance with Selected Strains
2.3. Signal Transduction Pathway
3. Discussion
4. Materials and Methods
4.1. Plant Material
4.2. Bacterial Strains and Inoculum Preparation
4.3. Bacterial Strain Partial Sequencing of 16S rRNA Gene and Phylogenetic Tree
4.4. Experimental Set-Up
4.4.1. Screening for the Most Effective Isolates
4.4.2. Study of the Signal Transduction Pathway Involved in Protection
4.5. Photosynthesis
4.6. Statistics
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Daryanto, S.; Wang, L.; Jacinthe, P. Global synthesis of drought effects on cereal, legume, tuber and root crops production: A review. Agric. Water Manag. 2017, 179, 18–33. [Google Scholar] [CrossRef]
- He, H.; Van Breusegem, F.; Mhamdi, A. Redox-dependent control of nuclear transcription in plants. J. Exp. Bot. 2018, 69, 3359–3372. [Google Scholar] [CrossRef]
- Yang, X.; Lu, M.; Wang, Y.; Wang, Y.; Liu, Z.; Chen, S. Response mechanism of plants to drought stress. Horticulturae 2021, 7, 50. [Google Scholar] [CrossRef]
- Behzadi Rad, P.; Roozban, M.R.; Karimi, S.; Ghahremani, R.; Vahdati, K. Osmolyte accumulation and sodium compartmentation has a key role in salinity tolerance of pistachios rootstocks. Agriculture 2021, 11, 708. [Google Scholar] [CrossRef]
- Nxele, X.; Klein, A.; Ndimba, B. Drought and salinity stress alters ROS accumulation, water retention, and osmolyte content in sorghum plants. S. Afr. J. Bot. 2017, 108, 261–266. [Google Scholar] [CrossRef]
- García-Villaraco, A.; Lucas, J.A.; Ramos-Solano, B.; Gutierrez-Mañero, F.J. Biotechnological Applications of Bioeffectors Derived From the Plant Microbiome to Improve Plant’s Physiological Response for a Better Adaptation to Biotic and Abiotic Stress: Fundamentals and Case Studies. In Nitrogen Cycle; CRC Press: Boca Raton, FL, USA, 2021; pp. 102–123. [Google Scholar]
- Waszczak, C.; Carmody, M.; Kangasjärvi, J. Reactive oxygen species in plant signaling. Annu. Rev. Plant Biol. 2018, 69, 209–236. [Google Scholar] [CrossRef] [PubMed]
- Kumar, M.; Patel, A.K.; Shah, A.V.; Raval, J.; Rajpara, N.; Joshi, M.; Joshi, C.G. First proof of the capability of wastewater surveillance for COVID-19 in India through detection of genetic material of SARS-CoV-2. Sci. Total Environ. 2020, 746, 141326. [Google Scholar] [CrossRef] [PubMed]
- Mohamed, H.I.; El-Shazly, H.H.; Badr, A. Role of salicylic acid in biotic and abiotic stress tolerance in plants. In Plant Phenolics in Sustainable Agriculture; Springer: Berlin/Heidelberg, Germany, 2020; pp. 533–554. [Google Scholar]
- Airaki, M.; Leterrier, M.; Mateos, R.M.; Valderrama, R.; Chaki, M.; Barroso, J.B.; Del Rio, L.A.; Palma, J.M.; Corpas, F.J. Metabolism of reactive oxygen species and reactive nitrogen species in pepper (Capsicum annuum L.) plants under low temperature stress. Plant Cell Environ. 2012, 35, 281–295. [Google Scholar] [CrossRef]
- Ryals, J.A.; Neuenschwander, U.H.; Willits, M.G.; Molina, A.; Steiner, H.Y.; Hunt, M.D. Systemic Acquired Resistance. Plant Cell 1996, 8, 1809–1819. [Google Scholar] [CrossRef] [PubMed]
- Van Loon, L.; Bakker, P.; Pieterse, C. Systemic resistance induced by rhizosphere bacteria. Annu. Rev. Phytopathol. 1998, 36, 453–483. [Google Scholar] [CrossRef]
- Wang, Y.; Mostafa, S.; Zeng, W.; Jin, B. Function and mechanism of jasmonic acid in plant responses to abiotic and biotic stresses. Int. J. Mol. Sci. 2021, 22, 8568. [Google Scholar] [CrossRef] [PubMed]
- Martinez-Medina, A.; Flors, V.; Heil, M.; Mauch-Mani, B.; Pieterse, C.M.; Pozo, M.J.; Ton, J.; van Dam, N.M.; Conrath, U. Recognizing plant defense priming. Trends Plant Sci. 2016, 21, 818–822. [Google Scholar] [CrossRef]
- Bashan, Y. Inoculants of plant growth-promoting bacteria for use in agriculture. Biotechnol. Adv. 1998, 16, 729–770. [Google Scholar] [CrossRef]
- Barriuso, J.; Pereyra, M.; García, J.L.; Megias, M.; Manero, F.G.; Ramos, B. Screening for putative PGPR to improve establishment of the symbiosis Lactarius deliciosus-Pinus sp. Microb. Ecol. 2005, 50, 82–89. [Google Scholar] [CrossRef] [PubMed]
- Barriuso, J.; Solano, B.R.; Gutiérrez Mañero, F. Protection against pathogen and salt stress by four plant growth-promoting rhizobacteria isolated from Pinus sp. on Arabidopsis thaliana. Phytopathology 2008, 98, 666–672. [Google Scholar] [CrossRef] [PubMed]
- Pellegrini, M.; Djebaili, R.; Pagnani, G.; del Gallo, M. Role of Actinomycetes in mitigating the impact of climate change: Mechanisms of action and perspectives. In Secondary Metabolites and Volatiles of PGPR in Plant-Growth Promotion; Springer International Publishing: Cham, Switzerland, 2022; pp. 153–171. [Google Scholar]
- Gamir, J.; Sánchez-Bel, P.; Flors, V. Molecular and physiological stages of priming: How plants prepare for environmental challenges. Plant Cell Rep. 2014, 33, 1935–1949. [Google Scholar] [CrossRef]
- Liu, H.; Able, A.J.; Able, J.A. Priming crops for the future: Rewiring stress memory. Trends Plant Sci. 2021, 27, 699–716. [Google Scholar] [CrossRef] [PubMed]
- Gutiérrez-Albanchez, E.; Gradillas, A.; García, A.; García-Villaraco, A.; Gutierrez-Mañero, F.J.; Ramos-Solano, B. Elicitation with Bacillus QV15 reveals a pivotal role of F3H on flavonoid metabolism improving adaptation to biotic stress in blackberry. PLoS ONE 2020, 15, e0232626. [Google Scholar] [CrossRef]
- Pieterse, C.M.; Van Loon, L. NPR1: The spider in the web of induced resistance signaling pathways. Curr. Opin. Plant Biol. 2004, 7, 456–464. [Google Scholar] [CrossRef] [PubMed]
- Khan, N.; Bano, A.; Ali, S.; Babar, M.A. Crosstalk amongst phytohormones from planta and PGPR under biotic and abiotic stresses. Plant Growth Regul. 2020, 90, 189–203. [Google Scholar] [CrossRef]
- Ilangumaran, G.; Smith, D.L. Plant growth promoting rhizobacteria in amelioration of salinity stress: A systems biology perspective. Front. Plant Sci. 2017, 8, 1768. [Google Scholar] [CrossRef] [PubMed]
- Ramos-Solano, B.; Lucas García, J.A.; Garcia-Villaraco, A.; Algar, E.; Garcia-Cristobal, J.; Gutierrez Mañero, F.J. Siderophore and chitinase producing isolates from the rhizosphere of Nicotiana glauca Graham enhance growth and induce systemic resistance in Solanum lycopersicum L. Plant Soil 2010, 334, 189–197. [Google Scholar] [CrossRef]
- Van Hulten, M.; Pelser, M.; Van Loon, L.; Pieterse, C.M.; Ton, J. Costs and benefits of priming for defense in Arabidopsis. Proc. Natl. Acad. Sci. USA 2006, 103, 5602–5607. [Google Scholar] [CrossRef] [PubMed]
- Van Wees, S.C.; Van der Ent, S.; Pieterse, C.M. Plant immune responses triggered by beneficial microbes. Curr. Opin. Plant Biol. 2008, 11, 443–448. [Google Scholar] [CrossRef] [PubMed]
- Whipps, J.M. Microbial interactions and biocontrol in the rhizosphere. J. Exp. Bot. 2001, 52 (Suppl. 1), 487–511. [Google Scholar] [CrossRef]
- Sultana, S.; Alam, S.; Karim, M.M. Screening of siderophore-producing salt-tolerant rhizobacteria suitable for supporting plant growth in saline soils with iron limitation. J. Agric. Food Res. 2021, 4, 100150. [Google Scholar] [CrossRef]
- Conrath, U.; Beckers, G.J.; Langenbach, C.J.; Jaskiewicz, M.R. Priming for enhanced defense. Annu. Rev. Phytopathol. 2015, 53, 97–119. [Google Scholar] [CrossRef] [PubMed]
- Mauch-Mani, B.; Baccelli, I.; Luna, E.; Flors, V. Defense priming: An adaptive part of induced resistance. Annu. Rev. Plant Biol. 2017, 68, 485–512. [Google Scholar] [CrossRef]
- Hossain, M.A.; Li, Z.; Hoque, T.S.; Burritt, D.J.; Fujita, M.; Munné-Bosch, S. Heat or cold priming-induced cross-tolerance to abiotic stresses in plants: Key regulators and possible mechanisms. Protoplasma 2018, 255, 399–412. [Google Scholar] [CrossRef] [PubMed]
- Safdar, H.; Amin, A.; Shafiq, Y.; Ali, A.; Yasin, R.; Shoukat, A.; Hussan, M.U.; Sarwar, M.I. A review: Impact of salinity on plant growth. Nat. Sci. 2019, 17, 34–40. [Google Scholar]
- Galicia-Campos, E.; García-Villaraco Velasco, A.; Montero-Palmero, M.B.; Gutiérrez-Mañero, F.J.; Ramos-Solano, B. Modulation of photosynthesis and ROS scavenging response by beneficial bacteria in Olea europaea plantlets under salt stress conditions. Plants 2022, 11, 2748. [Google Scholar] [CrossRef]
- Samaniego-Gámez, B.Y.; Garruña, R.; Tun-Suárez, J.M.; Kantun-Can, J.; Reyes-Ramírez, A.; Cervantes-Díaz, L. Bacillus spp. inoculation improves photosystem II efficiency and enhances photosynthesis in pepper plants. Chil. J. Agric. Res. 2016, 76, 409–416. [Google Scholar] [CrossRef]
- Berg, G.; Rybakova, D.; Grube, M.; Köberl, M. The plant microbiome explored: Implications for experimental botany. J. Exp. Bot. 2016, 67, 995–1002. [Google Scholar] [CrossRef] [PubMed]
- Dastogeer, K.M.; Tumpa, F.H.; Sultana, A.; Akter, M.A.; Chakraborty, A. Plant microbiome—An account of the factors that shape community composition and diversity. Curr. Plant Biol. 2020, 23, 100161. [Google Scholar] [CrossRef]
- Vlot, A.C.; Sales, J.H.; Lenk, M.; Bauer, K.; Brambilla, A.; Sommer, A.; Chen, Y.; Wenig, M.; Nayem, S. Systemic propagation of immunity in plants. New Phytol. 2020, 229, 1234–1250. [Google Scholar] [CrossRef]
- Bell, E.; Creelman, R.A.; Mullet, J.E. A chloroplast lipoxygenase is required for wound-induced jasmonic acid accumulation in Arabidopsis. Proc. Natl. Acad. Sci. USA 1995, 92, 8675–8679. [Google Scholar] [CrossRef]
- Yu, Y.-H.; Jiao, Z.-L.; Bian, L.; Wan, Y.-T.; Yu, K.-K.; Zhang, G.-H.; Guo, D.-L. Overexpression of Vitis vinifera VvbZIP60 enhances Arabidopsis resistance to powdery mildew via the salicylic acid signaling pathway. Sci. Hortic. 2019, 256, 108640. [Google Scholar] [CrossRef]
- Martin-Rivilla, H.; Garcia-Villaraco, A.; Ramos-Solano, B.; Gutierrez-Mañero, F.J.; Lucas, J.A. Extracts from cultures of Pseudomonas fluorescens induce defensive patterns of gene expression and enzyme activity while depressing visible injury and reactive oxygen species in Arabidopsis thaliana challenged with pathogenic Pseudomonas syringae. AoB Plants 2019, 11, plz049. [Google Scholar] [CrossRef] [PubMed]
- Kollist, H.; Zandalinas, S.I.; Sengupta, S.; Nuhkat, M.; Kangasjärvi, J.; Mittler, R. Rapid responses to abiotic stress: Priming the landscape for the signal transduction network. Trends Plant Sci. 2019, 24, 25–37. [Google Scholar] [CrossRef] [PubMed]
- Cameron, R.K.; Paiva, N.L.; Lamb, C.J.; Dixon, R.A. Accumulation of salicylic acid and PR-1 gene transcripts in relation to the systemic acquired resistance (SAR) response induced by Pseudomonas syringae pv. tomato in Arabidopsis. Physiol. Mol. Plant Pathol. 1999, 55, 121–130. [Google Scholar] [CrossRef]
- Remans, T.; Smeets, K.; Opdenakker, K.; Mathijsen, D.; Vangronsveld, J.; Cuypers, A. Normalisation of real-time RT-PCR gene expression measurements in Arabidopsis thaliana exposed to increased metal concentrations. Planta 2008, 227, 1343–1349. [Google Scholar] [CrossRef]
- Heuer, H.; Krsek, M.; Baker, P.; Smalla, K.; Wellington, E. Analysis of actinomycete communities by specific amplification of genes encoding 16S rRNA and gel-electrophoretic separation in denaturing gradients. Appl. Environ. Microbiol. 1997, 63, 3233–3241. [Google Scholar] [CrossRef] [PubMed]
- Martin-Rivilla, H.; Garcia-Villaraco, A.; Ramos-Solano, B.; Gutierrez-Manero, F.J.; Lucas, J.A. Improving flavonoid metabolism in blackberry leaves and plant fitness by using the bioeffector Pseudomonas fluorescens N 21.4 and its metabolic elicitors: A biotechnological approach for a more sustainable crop. J. Agric. Food Chem. 2020, 68, 6170–6180. [Google Scholar] [CrossRef]
- Chen, J.; Mohan, R.; Zhang, Y.; Li, M.; Chen, H.; Palmer, I.A.; Chang, M.; Qi, G.; Spoel, S.H.; Mengiste, T.; et al. NPR1 promotes its own and target gene expression in plant defense by recruiting CDK8. Plant Physiol. 2019, 181, 289–304. [Google Scholar] [CrossRef]
- Genty, B.; Briantais, J.; Baker, N.R. The relationship between the quantum yield of photosynthetic electron transport and quenching of chlorophyll fluorescence. Biochim. Biophys. Acta BBA Gen. Subj. 1989, 990, 87–92. [Google Scholar] [CrossRef]
Dry Weight No Stress (mg) | Dry Weight Salt Stress (mg) | |
---|---|---|
Control | 9.87 ± 0.92 | 6.13 ± 0.79 |
L24 | 12.87 ± 1.85 | 12.53 ± 1.37 * |
L44 | 6.17 ± 0.34 * | 7.60 ± 1.37 |
K8 | 8.93 ± 0.69 | 13.20 ± 0.98 * |
G7 | 13.50 ± 1.44 * | 11.93 ± 1.2 * |
L56 | 4.10 ± 0.86 * | 13.75 ± 4.24 |
H47 | 5.70 ± 0.49 * | 6.93 ± 0.74 |
L36 | 9.65 ± 0.95 | 15.67 ± 1.60 * |
L79 | 6.17 ± 0.92 * | 11.03 ± 1.83 |
(A) | |||
---|---|---|---|
Control vs. H47 | Salt vs. H47-Salt | Pathogen vs. H47-Pathogen | |
NPR1 | 0.05 | −2.01 | 1.12 |
PDF1 | −1.75 | 1.18 | −0.06 |
LOX2 | 1.52 | −1.18 | 1.78 |
PR1 | −0.36 | 1.09 | 0.20 |
(B) | |||
Control vs. L44 | Salt vs. L44-Salt | Pathogen vs. L44-Pathogen | |
NPR1 | 0.60 | −0.74 | −0.40 |
PDF1 | −2.59 | 3.00 | −1.37 |
LOX2 | 2.37 | −0.40 | 0.29 |
PR1 | 0.85 | 0.77 | 1.09 |
(C) | |||
Control vs. G7 | Salt vs. G7-Salt | Pathogen vs. G7-Pathogen | |
NPR1 | −1.01 | 1.72 | 0.72 |
PDF1 | −1.52 | −3.53 | 0.84 |
LOX2 | 0.76 | 2.60 | 0.39 |
PR1 | 0.36 | 3.32 | 2.23 |
Gene Identifier | Gene | Forward Primer | Reverse Primer |
---|---|---|---|
AtPDF1 | PDF1 [46] | 5′-TTGTTCTCTTTGCTGCTTTCGA | 5′-TTGGCTTCTCGCACAACTTCT |
AtPR1 | PR1 [46] | 5′-AGTTGTTTGGAGAAAGTCAG | 5′-GTTCACATAATTCCCACGA |
AtLOX2 | LOX2 [46] | 5′ACTTGCTCGTCCGGTAATTGG | 5′-GTACGGCCTTGCCTGTGAATG |
At NPR1 | NPR1 [47] | 5′-TTTGGAAGGTAGAACCGCAC | 5′-ACATTCAACCGCCATAGTGG |
AtSAND | SAND (AT2G28390) | 5′-CTGTCTTCTCATCTCTTGTC | 5′-TCTTGCAATATGGTTCCTG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Galicia-Campos, E.; Velasco, A.G.-V.; Lucas, J.A.; Gutiérrez-Mañero, F.J.; Ramos-Solano, B. The Crossregulation Triggered by Bacillus Strains Is Strain-Specific and Improves Adaptation to Biotic and Abiotic Stress in Arabidopsis. Plants 2024, 13, 3565. https://doi.org/10.3390/plants13243565
Galicia-Campos E, Velasco AG-V, Lucas JA, Gutiérrez-Mañero FJ, Ramos-Solano B. The Crossregulation Triggered by Bacillus Strains Is Strain-Specific and Improves Adaptation to Biotic and Abiotic Stress in Arabidopsis. Plants. 2024; 13(24):3565. https://doi.org/10.3390/plants13243565
Chicago/Turabian StyleGalicia-Campos, Estrella, Ana García-Villaraco Velasco, Jose Antonio Lucas, F. Javier Gutiérrez-Mañero, and Beatriz Ramos-Solano. 2024. "The Crossregulation Triggered by Bacillus Strains Is Strain-Specific and Improves Adaptation to Biotic and Abiotic Stress in Arabidopsis" Plants 13, no. 24: 3565. https://doi.org/10.3390/plants13243565
APA StyleGalicia-Campos, E., Velasco, A. G.-V., Lucas, J. A., Gutiérrez-Mañero, F. J., & Ramos-Solano, B. (2024). The Crossregulation Triggered by Bacillus Strains Is Strain-Specific and Improves Adaptation to Biotic and Abiotic Stress in Arabidopsis. Plants, 13(24), 3565. https://doi.org/10.3390/plants13243565