Microbe-Friendly Plants Enable Beneficial Interactions with Soil Rhizosphere Bacteria by Lowering Their Defense Responses
Abstract
1. Introduction
2. Results
2.1. Identification of Bacterial Isolates and Plant Beneficial Traits
2.2. Broccoli Pot Trials
2.3. Cucumber Pot Trials
2.4. Tomato Pot Trials
2.5. Tomato Gene Expression
3. Discussion
3.1. Functional Properties of the Identified PGPR
3.2. Role of Plant Genotype for Beneficial PGPR Interactions
3.3. Role of Host Defense Genes for Beneficial Tomato–B. velezensis UQ9000N Interactions
3.3.1. ROS Signaling
3.3.2. SA Signaling
3.3.3. JA and ET Signaling
3.3.4. ABA, GA and CK Phytohormones
3.3.5. Nutrient Acquisition
3.4. Should We Restore “Microbe-Friendly” Traits in Crop Breeding Programs?
4. Conclusions
5. Materials and Methods
5.1. Bacterial Cultivation and Inoculum Preparation
5.2. Bacterial DNA Isolation and Identification via 16S rDNA Gene Amplicon Sequencing
5.3. Phylogeny Analysis
5.4. Plant Growth Promotion Traits
5.4.1. Indoleacetic Acid Production
5.4.2. Biofilm Production
5.4.3. Nitrogen Fixation
5.4.4. Phosphorus Solubilization
5.5. Plant Treatments
5.5.1. Broccoli Plant Cultivation
5.5.2. Tomato and Cucumber Cultivation
5.6. Tomato Defense Gene Expression Analysis
5.7. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Blair, A.; Ritz, B.; Wesseling, C.; Beane Freeman, L. Pesticides and human health. Occupat. Environm. Med. 2015, 72, 81–82. [Google Scholar] [CrossRef] [PubMed]
- Duncan, J.A.; Pascucci, S. Circular Solutions for Linear Problems: Principles for sustainable food futures. Solutions 2016, 7, 58–65. [Google Scholar]
- Saritha, M.; Tollamadugu, N.P. The status of research and application of biofertilizers and biopesticides: Global scenario. In Recent Developments in Applied Microbiology and Biochemistry; Academic Press: Cambridge, MA, USA, 2019; pp. 195–207. [Google Scholar]
- Arif, I.; Batool, M.; Schenk, P.M. Plant Microbiome Engineering: Expected Benefits for Improved Crop Growth and Resilience. Trends Biotechnol. 2020, 38, 1385–1396. [Google Scholar] [CrossRef] [PubMed]
- Shao, Z.; Arkhipov, A.; Batool, M.; Muirhead, S.R.; Harry, M.S.; Ji, X.; Mirzaee, H.; Carvalhais, L.C.; Schenk, P.M. Rhizosphere bacteria biofertiliser formulations improve lettuce growth and yield under nursery and field conditions. Agriculture 2023, 13, 1911. [Google Scholar] [CrossRef]
- Balog, A.; Hartel, T.; Loxdale, H.D.; Wilson, K. Differences in the progress of the biopesticide revolution between the EU and other major crop-growing regions. Pest Managem. Sci. 2017, 73, 2203–2208. [Google Scholar] [CrossRef]
- Harrington, R.; Anton, C.; Dawson, T.P.; de Bello, F.; Feld, C.K.; Haslett, J.R.; Kluvánkova-Oravská, T.; Kontogianni, A.; Lavorel, S.; Luck, G.W.; et al. Ecosystem services and biodiversity conservation: Concepts and a glossary. Biodivers. Conserv. 2010, 19, 2773–2790. [Google Scholar] [CrossRef]
- Beneduzi, A.; Ambrosini, A.; Passaglia, L.M.P. Plant growth-promoting rhizobacteria (PGPR): Their potential as antagonists and biocontrol agents. Genet. Mol. Biol. 2012, 35, 1044–1051. [Google Scholar] [CrossRef]
- Gouda, S.; Kerry, R.G.; Das, G.; Paramithiotis, S.; Shin, H.-S.; Patra, J.K. Revitalization of plant growth promoting rhizobacteria for sustainable development in agriculture. Microbiol. Res. 2018, 206, 131–140. [Google Scholar] [CrossRef]
- Marschner, P.; Crowley, D.; Rengel, Z. Rhizosphere interactions between microorganisms and plants govern iron and phosphorus acquisition along the root axis—Model and research methods. Soil Biol. Biochem. 2011, 43, 883–894. [Google Scholar] [CrossRef]
- Pii, Y.; Mimmo, T.; Tomasi, N.; Terzano, R.; Cesco, S.; Crecchio, C. Microbial interactions in the rhizosphere: Beneficial influences of plant growth-promoting rhizobacteria on nutrient acquisition process. A review. Biol. Fertil. Soils 2015, 51, 403–415. [Google Scholar] [CrossRef]
- White, P.; Brown, P. Plant nutrition for sustainable development and global health. Ann. Bot. 2010, 105, 1073–1080. [Google Scholar] [CrossRef] [PubMed]
- Basu, A.; Prasad, P.; Das, S.N.; Kalam, S.; Sayyed, R.Z.; Reddy, M.S.; El Enshasy, H. Plant Growth Promoting Rhizobacteria (PGPR) as Green Bioinoculants: Recent Developments, Constraints, and Prospects. Sustainability 2021, 13, 1140. [Google Scholar] [CrossRef]
- Jetten, M.S. Microbial nitrogen cycle. Environ. Microbiol. 2008, 10, 2903–2909. [Google Scholar] [CrossRef] [PubMed]
- Singh, J.S.; Raghubanshi, A.S.; Singh, R.S.; Srivastava, S.C. Microbial biomass acts as a source of plant nutrients in dry tropical forest and savanna. Nature 1989, 338, 499–500. [Google Scholar] [CrossRef]
- Singh, J.S.; Gupta, V.K. Soil microbial biomass: A key soil driver in management of ecosystem functioning. Sci. Total Environ. 2018, 634, 497–500. [Google Scholar] [CrossRef]
- Trivedi, P.; Schenk, P.M.; Wallenstein, M.D.; Singh, B.K. Tiny Microbes, Big Yields: Enhancing food crop production with biological solutions. Microb. Biotechnol. 2017, 10, 999–1003. [Google Scholar] [CrossRef]
- Wallenstein, M.D. Managing and manipulating the rhizosphere microbiome for plant health: A systems approach. Rhizosphere 2017, 3, 230–232. [Google Scholar] [CrossRef]
- Wintermans, P.C.; Bakker, P.A.; Pieterse, C.M. Natural genetic variation in Arabidopsis for responsiveness to plant growth-promoting rhizobacteria. Plant Mol. Biol. 2016, 90, 623–634. [Google Scholar] [CrossRef]
- Bulgarelli, D.; Garrido-Oter, R.; Münch, P.; Weiman, A.; Dröge, J.; Pan, Y.; McHardy, A.; Schulze-Lefert, P. Structure and Function of the Bacterial Root Microbiota in Wild and Domesticated Barley. Cell Host Microbe 2015, 17, 392–403. [Google Scholar] [CrossRef]
- Peiffer, J.A.; Spor, A.; Koren, O.; Jin, Z.; Tringe, S.G.; Dangl, J.L.; Buckler, E.S.; Ley, R.E. Diversity and heritability of the maize rhizosphere microbiome under field conditions. Proc. Natl. Acad. Sci. USA 2013, 110, 6548–6553. [Google Scholar] [CrossRef]
- Perez-Jaramillo, J.E.; Mendes, R.; Raaijmakers, J. Impact of plant domestication on rhizosphere microbiome assembly and functions. Plant Mol. Biol. 2016, 90, 635–644. [Google Scholar] [CrossRef] [PubMed]
- Haney, C.H.; Samuel, B.S.; Bush, J.; Ausubel, F.M. Associations with rhizosphere bacteria can confer an adaptive advantage to plants. Nat. Plants 2015, 1, 15051. [Google Scholar] [CrossRef] [PubMed]
- Pieterse, C.M.J.; de Jonge, R.; Berendsen, R.L. The soil-borne supremacy. Trends Plant Sci. 2016, 21, 171–173. [Google Scholar] [CrossRef] [PubMed]
- Chanway, C.; Nelson, L.; Holl, F. Cultivar-specific growth promotion of spring wheat (Triticum aestivum L.) by coexistent Bacillus species. Can. J. Microbiol. 1988, 34, 925–929. [Google Scholar] [CrossRef]
- Delfin, E.F.; Rodriguez, F.M.; Paterno, E.S. Biomass partitioning, yield, nitrogen and phosphorus uptake of PGPR inoculated tomato (Lycopersicum esculentum L.) under field condition. Philipp. J. Crop Sci. 2015, 40, 59–65. [Google Scholar]
- Drogue, B.; Sanguin, H.; Chamam, A.; Mozar, M.; Llauro, C.; Panaud, O.; Prigent-Combaret, C.; Picault, N.; Wisniewski-Dyé, F. Plant root transcriptome profiling reveals a strain-dependent response during Azospirillum-rice cooperation. Front. Plant Sci. 2014, 5, 607. [Google Scholar] [CrossRef]
- Khalid, A.Z.E.E.M.; Arshad, M.; Zahir, Z.A. Growth and yield response of wheat to inoculation with auxin producing plant growth promoting rhizobacteria. Pak. J. Bot. 2003, 35, 483–498. [Google Scholar]
- Rozier, C.; Gerin, F.; Czarnes, S.; Legendre, L. Biopriming of maize germination by the plant growth-promoting rhizobacterium Azospirillum lipoferum CRT1. J. Plant Physiol. 2019, 237, 111–119. [Google Scholar] [CrossRef]
- Sasaki, K.; Ikeda, S.; Eda, S.; Mitsui, H.; Hanzawa, E.; Kisara, C.; Kazama, Y.; Kushida, A.; Shinano, T.; Minamisawa, K.; et al. Impact of plant genotype and nitrogen level on rice growth response to inoculation with Azospirillum sp. strain B510 under paddy field conditions. Soil Sci. Plant Nutr. 2010, 56, 636–644. [Google Scholar] [CrossRef]
- Uribe, D.; Sánchez-Nieves, J.; Vanegas, J. Role of microbial biofertilizers in the development of a sustainable agriculture in the tropics. In Soil Biology and Agriculture in the Tropics; Springer: Berlin/Heidelberg, Germany, 2010; pp. 235–250. [Google Scholar]
- Calvo-Polanco, M.; Sánchez-Romera, B.; Aroca, R.; Asins, M.J.; Declerck, S.; Dodd, I.C.; Martínez-Andújar, C.; Albacete, A.; Ruiz-Lozano, J.M. Exploring the use of recombinant inbred lines in combination with beneficial microbial inoculants (AM fungus and PGPR) to improve drought stress tolerance in tomato. Environ. Exp. Bot. 2016, 131, 47–57. [Google Scholar] [CrossRef]
- Philippot, L.; Raaijmakers, J.; Lemanceau, P.; Van der Putten, W. Going back to the roots: The microbial ecology of the rhizosphere. Nat. Rev. Microbiol. 2013, 11, 789–799. [Google Scholar] [CrossRef] [PubMed]
- Batool, M.; Carvalhais, L.C.; Fu, B.; Schenk, P.M. Customized plant microbiome engineering for food security. Trends Plant Sci. 2024, 29, 482–494. [Google Scholar] [CrossRef] [PubMed]
- Schmidt, J.E.; Bowles, T.M.; Gaudin, A.C. Using ancient traits to convert soil health into crop yield: Impact of selection on maize root and rhizosphere function. Front. Plant Sci. 2016, 7, 373. [Google Scholar] [CrossRef]
- Menda, N.; Strickler, S.R.; Mueller, L.A. Advances in tomato research in the post-genome era. Plant Biotechnol. 2013, 30, 243–256. [Google Scholar] [CrossRef]
- Jiao, X.; Takishita, Y.; Zhou, G.; Smith, D.L. Plant associated rhizobacteria for biocontrol and plant growth enhancement. Front. Plant Sci. 2021, 12, 634796. [Google Scholar] [CrossRef]
- Kumar, M.; Giri, V.P.; Pandey, S.; Gupta, A.; Patel, M.K.; Bajpai, A.B.; Jenkins, S.; Siddique, K.H.M. Plant-growth-promoting rhizobacteria emerging as an effective bioinoculant to improve the growth, production, and stress tolerance of vegetable crops. Int. J. Mol. Sci. 2021, 22, 12245. [Google Scholar] [CrossRef]
- Bargmann, B.O.R.; Estelle, M. Auxin perception: In the IAA of the beholder. Physiol. Plant. 2014, 151, 52–61. [Google Scholar] [CrossRef]
- Shao, J.; Xu, Z.; Zhang, N.; Shen, Q.; Zhang, R. Contribution of indole-3-acetic acid in the plant growth promotion by the rhizospheric strain Bacillus amyloliquefaciens SQR9. Biol. Fertil. Soils 2015, 51, 321–330. [Google Scholar] [CrossRef]
- Ahmad, I.; Husain, F.M. Biofilms: An Overview of Their Significance in Plant and Soil Health. In Biofilms in Plant and Soil Health; John Wiley & Sons: Hoboken, NJ, USA, 2017; pp. 1–25. [Google Scholar]
- Flemming, H.-C.; Wingender, J.; Szewzyk, U.; Steinberg, P.; Rice, S.A.; Kjelleberg, S. Biofilms: An emergent form of bacterial life. Nat. Rev. Microbiol. 2016, 14, 563–575. [Google Scholar] [CrossRef]
- Vlamakis, H.; Chai, Y.; Beauregard, P.; Losick, R.; Kolter, R. Sticking together: Building a biofilm the Bacillus subtilis way. Nat. Reviews. Microbiol. 2013, 11, 157–168. [Google Scholar] [CrossRef]
- Adhikari, P.; Jain, R.; Sharma, A.; Pandey, A. Plant growth promotion at low temperature by phosphate-solubilizing Pseudomonas spp. isolated from high-altitude Himalayan soil. Microb. Ecol. 2021, 82, 677–687. [Google Scholar] [CrossRef]
- Ansari, F.A.; Jabeen, M.; Ahmad, I. Pseudomonas azotoformans FAP5, a novel biofilm-forming PGPR strain, alleviates drought stress in wheat plant. Int. J. Environ. Sci. Technol. 2021, 18, 3855–3870. [Google Scholar] [CrossRef]
- Cui, L.; Yang, C.; Wang, Y.; Ma, T.; Cai, F.; Wei, L.; Jin, M.; Osei, R.; Zhang, J.; Tang, M. Potential of an endophytic bacteria Bacillus amyloliquefaciens 3–5 as biocontrol agent against potato scab. Microb. Pathog. 2022, 163, 105382. [Google Scholar] [CrossRef]
- Dolkar, D.; Dolkar, P.; Angmo, S.; Chaurasia, O.P.; Stobdan, T. Stress tolerance and plant growth promotion potential of Enterobacter ludwigii PS1 isolated from Seabuckthorn rhizosphere. Biocatal. Agric. Biotechnol. 2018, 14, 438–443. [Google Scholar] [CrossRef]
- Goryluk-Salmonowicz, A.; Orzeszko-Rywka, A.; Piórek, M.; Rekosz-Burlaga, H.; Otłowska, A.O.; Gozdowski, D.; Błaszczyk, M. Plant growth promoting bacterial endophytes isolated from Polish herbal plants. Acta Sci. Pol. Hortorum Cultus 2018, 17, 101–110. [Google Scholar] [CrossRef]
- Goudarzi, T.; Tabrizi, L.; Alikhani, H.A.; Nazeri, V.; Najafi, F. Phytostimulation properties of indigenous plant growth-promoting bacteria from licorice (Glycyrrhiza glabra L.): Benefits for seed germination and seedling growth. Int. J. Hortic. Sci. Technol. 2023, 10, 53–68. [Google Scholar]
- Haque, M.M.; Mosharaf, M.K.; Khatun, M.; Haque, M.A.; Biswas, M.S.; Islam, M.S.; Islam, M.M.; Shozib, H.B.; Miah, M.M.U.; Molla, A.H.; et al. Biofilm producing rhizobacteria with multiple plant growth-promoting traits promote growth of tomato under water-deficit stress. Front. Microbiol. 2020, 11, 542053. [Google Scholar] [CrossRef]
- Houida, S.; Yakkou, L.; Kaya, L.O.; Bilen, S.; Fadil, M.; Raouane, M.; El Harti, A.; Amghar, S. Biopriming of maize seeds with plant growth-promoting bacteria isolated from the earthworm Aporrectodea molleri: Effect on seed germination and seedling growth. Lett. Appl. Microbiol. 2022, 75, 61–69. [Google Scholar] [CrossRef]
- Hui, C.; Sun, P.; Guo, X.; Jiang, H.; Zhao, Y.; Xu, L. Shifts in microbial community structure and soil nitrogen mineralization following short-term soil amendment with the ammonifier Bacillus amyloliquefaciens DT. Int. Biodeterior. Biodegrad. 2018, 132, 40–48. [Google Scholar] [CrossRef]
- Kapoor, R.; Gupta, M.K.; Kumar, N.; Kanwar, S.S. Analysis of nhaA gene from salt tolerant and plant growth promoting Enterobacter ludwigii. Rhizosphere 2017, 4, 62–69. [Google Scholar] [CrossRef]
- Luo, L.; Zhao, C.; Wang, E.; Raza, A.; Yin, C. Bacillus amyloliquefaciens as an excellent agent for biofertilizer and biocontrol in agriculture: An overview for its mechanisms. Microbiol. Res. 2022, 259, 127016. [Google Scholar] [CrossRef]
- Torres, M.; Llamas, I.; Torres, B.; Toral, L.; Sampedro, I.; Béjar, V. Growth promotion on horticultural crops and antifungal activity of Bacillus velezensis XT1. Appl. Soil Ecol. A Sect. Agric. Ecosyst. Environ. 2020, 150, 103453. [Google Scholar] [CrossRef]
- Vinci, G.; Cozzolino, V.; Mazzei, P.; Monda, H.; Savy, D.; Drosos, M.; Piccolo, A. Effects of Bacillus amyloliquefaciens and different phosphorus sources on maize plants as revealed by NMR and GC-MS based metabolomics. Plant Soil 2018, 429, 437–450. [Google Scholar] [CrossRef]
- Wu, L.; Li, X.; Ma, L.; Borriss, R.; Wu, Z.; Gao, X. Acetoin and 2, 3-butanediol from Bacillus amyloliquefaciens induce stomatal closure in Arabidopsis thaliana and Nicotiana benthamiana. J. Exp. Bot. 2018, 69, 5625–5635. [Google Scholar] [CrossRef]
- Zhang, Y.; Wang, X.; Liang, S.; Shi, Y.; Chen, X.; Liu, J.; Wang, A. Fermentation optimization, fungistatic effects and tomato growth promotion of four biocontrol bacterial strains. Agriculture 2021, 11, 686. [Google Scholar] [CrossRef]
- Schenk, P.M.; Batool, M.; Mirzaee, H.; Abbott, A. Customized plant growth promotion with soil-and cultivar-compatible microbial biofertilizers. Agronomy 2024, 14, 1915. [Google Scholar] [CrossRef]
- Hsu, C.; Micallef, S.A. Plant-mediated restriction of Salmonella enterica on tomato and spinach leaves colonized with Pseudomonas plant growth-promoting rhizobacteria. Int. J. Food Microbiol. 2017, 259, 1–6. [Google Scholar] [CrossRef]
- Shahzad, R.; Tayade, R.; Shahid, M.; Hussain, A.; Ali, M.W.; Yun, B.W. Evaluation potential of PGPR to protect tomato against Fusarium wilt and promote plant growth. Peer J. 2021, 9, e11194. [Google Scholar]
- Lukyanenko, A.N. Disease resistance in tomato. In Genetic Improvement of Tomato; Springer: Berlin/Heidelberg, Germany, 1991; pp. 99–119. [Google Scholar]
- Rodriguez, P.A.; Rothballer, M.; Chowdhury, S.P.; Nussbaumer, T.; Gutjahr, C.; Falter-Braun, P. Systems biology of plant-microbiome interactions. Mol. Plant 2019, 12, 804–821. [Google Scholar] [CrossRef]
- Zamioudis, C.; Pieterse, C.M. Modulation of host immunity by beneficial microbes. Mol. Plant-Microbe Interact. 2012, 25, 139–150. [Google Scholar] [CrossRef]
- Yang, M.; Bu, F.; Huang, W.; Chen, L. Multiple regulatory levels shape autophagy activity in plants. Front. Plant Sci. 2019, 10, 532. [Google Scholar] [CrossRef] [PubMed]
- Albrecht, T.; Argueso, C.T. Should I fight or should I grow now? The role of cytokinins in plant growth and immunity and in the growth–defence trade-off. Ann. Bot. 2017, 119, 725–735. [Google Scholar] [CrossRef] [PubMed]
- Huot, B.; Yao, J.; Montgomery, B.L.; He, S.Y. Growth-defense tradeoffs in plants: A balancing act to optimize fitness. Mol. Plant 2014, 7, 1267–1287. [Google Scholar] [CrossRef]
- Fujita, M.; Fujita, Y.; Noutoshi, Y.; Takahashi, F.; Narusaka, Y.; Yamaguchi-Shinozaki, K.; Shinozaki, K. Crosstalk between abiotic and biotic stress responses: A current view from the points of convergence in the stress signaling networks. Curr. Opin. Plant Biol. 2006, 9, 436–442. [Google Scholar] [CrossRef]
- Huang, H.; Ullah, F.; Zhou, D.-X.; Yi, M.; Zhao, Y. Mechanisms of ROS regulation of plant development and stress responses. Front. Plant Sci. 2009, 10, 800. [Google Scholar] [CrossRef]
- Nath, M.; Bhatt, D.; Prasad, R.; Gill, S.S.; Anjum, N.A.; Tuteja, N. Reactive oxygen species generation-scavenging and signaling during plant-arbuscular mycorrhizal and Piriformospora indica interaction under stress condition. Front. Plant Sci. 2006, 7, 1574. [Google Scholar] [CrossRef]
- Zeng, J.; Dong, Z.; Wu, H.; Tian, Z.; Zhao, Z. Redox regulation of plant stem cell fate. EMBO J. 2017, 36, 2844–2855. [Google Scholar] [CrossRef]
- Lee, D.; Lal, N.K.; Lin, Z.-J.D.; Ma, S.; Liu, J.; Castro, B.; Toruno, T.; Dinesh-Kumar, S.P.; Coaker, G. Regulation of reactive oxygen species during plant immunity through phosphorylation and ubiquitination of RBOHD. Nat. Commun. 2020, 11, 1838. [Google Scholar] [CrossRef]
- Suzuki, N.; Miller, G.; Morales, J.; Shulaev, V.; Torres, M.A.; Mittler, R. Respiratory burst oxidases: The engines of ROS signaling. Curr. Opin. Plant Biol. 2011, 14, 691–699. [Google Scholar] [CrossRef]
- Wang, W.; Chen, D.; Zhang, X.; Liu, D.; Cheng, Y.; Shen, F. Role of plant respiratory burst oxidase homologs in stress responses. Free Radic. Res. 2018, 52, 826–839. [Google Scholar] [CrossRef]
- Dixit, R.; Agrawal, L.; Singh, S.P.; Singh, P.C.; Prasad, V.; Chauhan, P.S. Paenibacillus lentimorbus induces autophagy for protecting tomato from Sclerotium rolfsii infection. Microbiol. Res. 2018, 215, 164–174. [Google Scholar] [CrossRef]
- Harrison-Lowe, N.J.; Olsen, L.J. Autophagy protein 6 (ATG6) is required for pollen germination in Arabidopsis thaliana. Autophagy 2008, 4, 339–348. [Google Scholar] [CrossRef]
- Liu, Y.; Schiff, M.; Czymmek, K.; Tallóczy, Z.; Levine, B.; Dinesh-Kumar, S.P. Autophagy regulates programmed cell death during the plant innate immune response. Cell 2005, 121, 567–577. [Google Scholar] [CrossRef]
- Yue, J.; Sun, H.; Zhang, W.; Pei, D.; He, Y.; Wang, H. Wheat homologs of yeast ATG6 function in autophagy and are implicated in powdery mildew immunity. BMC Plant Biol. 2015, 15, 95. [Google Scholar] [CrossRef]
- Choudhury, F.K.; Rivero, R.M.; Blumwald, E.; Mittler, R. Reactive oxygen species, abiotic stress and stress combination. Plant J. Cell Mol. Biol. 2017, 90, 856–867. [Google Scholar] [CrossRef]
- Mhamdi, A.; Van Breusegem, F. Reactive oxygen species in plant development. Development 2018, 145, dev164376. [Google Scholar] [CrossRef]
- Saleem, M.; Fariduddin, Q.; Castroverde, C.D.M. Salicylic acid: A key regulator of redox signalling and plant immunity. Plant Physiol. Biochem. 2021, 168, 381–397. [Google Scholar] [CrossRef]
- Waszczak, C.; Carmody, M.; Kangasjärvi, J. Reactive oxygen species in plant signaling. Annu. Rev. Plant Biol. 2018, 69, 209–236. [Google Scholar] [CrossRef]
- Alscher, R.G.; Erturk, N.; Heath, L.S. Role of superoxide dismutases (SODs) in controlling oxidative stress in plants. J. Exp. Bot. 2002, 53, 1331–1341. [Google Scholar] [CrossRef]
- Tyagi, S.; Shumayla Singh, S.P.; Upadhyay, S.K. Role of superoxide dismutases (SODs) in stress tolerance in plants. In Molecular Approaches in Plant Biology and Environmental Challenges; Springer: Singapore, 2019; pp. 51–77. [Google Scholar]
- Czarnocka, W.; Karpiński, S. Friend or foe? Reactive oxygen species production, scavenging and signaling in plant response to environmental stresses. Free Radic. Biol. Med. 2018, 122, 4–20. [Google Scholar] [CrossRef]
- Desikan, R.; Reynolds, A.; Hancock, J.T.; Neill, S.J. Harpin and hydrogen peroxide both initiate programmed cell death but have differential effects on defence gene expression in Arabidopsis suspension cultures. Biochem. J. 1998, 330, 115–120. [Google Scholar] [CrossRef]
- Gayoso, C.; Pomar, F.; Novo-Uzal, E.; Merino, F.; de Ilárduya, O.M. The Ve-mediated resistance response of the tomato to Verticillium dahliae involves H2O2, peroxidase and lignins and drives PAL gene expression. BMC Plant Biol. 2010, 10, 232. [Google Scholar] [CrossRef]
- Kim, D.S.; Hwang, B.K. An important role of the pepper phenylalanine ammonia-lyase gene (PAL1) in salicylic acid-dependent signalling of the defence response to microbial pathogens. J. Exp. Bot. 2014, 65, 2295–2306. [Google Scholar] [CrossRef]
- Backer, R.; Naidoo, S.; van den Berg, N. The NONEXPRESSOR OF PATHOGENESIS-RELATED GENES 1 (NPR1) and related family: Mechanistic insights in plant disease resistance. Front. Plant Sci. 2019, 10, 102. [Google Scholar] [CrossRef]
- Balasubramanian, V.; Vashisht, D.; Cletus, J.; Sakthivel, N. Plant β-1,3-glucanases: Their biological functions and transgenic expression against phytopathogenic fungi. Biotechnol. Lett. 2012, 34, 1983–1990. [Google Scholar] [CrossRef]
- Maier, F.; Zwicker, S.; Hückelhoven, A.; Meissner, M.; Funk, J.; Pfitzner, A.J.P.; Pfitzner, U.M. NONEXPRESSOR OF PATHOGENESIS-RELATED PROTEINS1 (NPR1) and some NPR1-related proteins are sensitive to salicylic acid. Mol. Plant Pathol. 2011, 12, 73–91. [Google Scholar] [CrossRef]
- Krüger, J.; Thomas, C.M.; Golstein, C.; Dixon, M.S.; Smoker, M.; Tang, S.; Mulder, L.; Jonathan, D.G. Jones. A tomato cysteine protease required for Cf-2-dependent disease resistance and suppression of autonecrosis. Science 2002, 296, 744–747. [Google Scholar] [CrossRef]
- Kovács, J.; Poór, P.; Szepesi, Á.; Tari, I. Salicylic acid induced cysteine protease activity during programmed cell death in tomato plants. Acta Biol. Hung. 2016, 67, 148–158. [Google Scholar] [CrossRef]
- Sahu, P.P.; Rai, N.K.; Chakraborty, S.; Singh, M.; Chandrappa, P.H.; Ramesh, B.; Chattopadhyay, D.; Prasad, M. Tomato cultivar tolerant to Tomato leaf curl New Delhi virus infection induces virus-specific short interfering RNA accumulation and defence-associated host gene expression. Mol. Plant Pathol. 2010, 11, 531–544. [Google Scholar] [CrossRef]
- Liu, H.; Hu, M.; Wang, Q.; Cheng, L.; Zhang, Z. Role of papain-like cysteine proteases in plant development. Front. Plant Sci. 2018, 9, 1717. [Google Scholar] [CrossRef]
- Afzal, A.; Wood, A.; Lightfoot, D. Plant receptor-like serine threonine kinases: Roles in signaling and plant defense. Mol. Plant-Microbe Interact. 2008, 21, 507–517. [Google Scholar] [CrossRef]
- Newman, M.-A.; Sundelin, T.; Nielsen, J.T.; Erbs, G. MAMP (microbe-associated molecular pattern) triggered immunity in plants. Front. Plant Sci. 2013, 4, 139. [Google Scholar] [CrossRef]
- Afroz, A.; Khan, M.R.; Ahsan, N.; Komatsu, S. Comparative proteomic analysis of bacterial wilt susceptible and resistant tomato cultivars. Peptides 2009, 30, 1600–1607. [Google Scholar] [CrossRef]
- Barbosa, V.; da Silva Netol, M. Incidencia de mancha bacteriana (Xanthomonas vesicatoria) em tomateiro industrial no Estado de Sao Paulo. Proceedings of the Tropical Region. J. Am. Soc. Hortic. Sci. 1982, 25, 461–464. [Google Scholar]
- He, X.; Jiang, J.; Wang, C.; Dehesh, K. ORA59 and EIN3 interaction couples jasmonate-ethylene synergistic action to antagonistic salicylic acid regulation of PDF expression. J. Integr. Plant Biol. 2017, 59, 275–287. [Google Scholar] [CrossRef]
- Jang, G.; Yoon, Y.; Choi, Y.D. Crosstalk with jasmonic acid integrates multiple responses in plant development. Int. J. Mol. Sci. 2020, 21, 305. [Google Scholar] [CrossRef]
- Cheng, M.-C.; Liao, P.-M.; Kuo, W.-W.; Lin, T.-P. The Arabidopsis ETHYLENE RESPONSE FACTOR1 regulates abiotic stress-responsive gene expression by binding to different cis-acting elements in response to different stress signals. Plant Physiol. 2013, 162, 1566–1582. [Google Scholar] [CrossRef]
- Chung, H.S.; Koo, A.J.; Gao, X.; Jayanty, S.; Thines, B.; Jones, A.D.; Howe, G.A. Regulation and function of Arabidopsis JASMONATE ZIM-domain genes in response to wounding and herbivory. Plant Physiol. 2008, 146, 952–964. [Google Scholar] [CrossRef]
- Huang, P.-Y.; Catinot, J.; Zimmerli, L. Ethylene response factors in Arabidopsis immunity. J. Exp. Bot. 2016, 67, 1231–1241. [Google Scholar] [CrossRef] [PubMed]
- Major, I.T.; Yoshida, Y.; Campos, M.L.; Kapali, G.; Xin, X.; Sugimoto, K.; Oliveira Ferreira, D.; He, S.Y.; Howe, G.A. Regulation of growth–defense balance by the JASMONATE ZIM-DOMAIN (JAZ)-MYC transcriptional module. New Phytol. 2017, 215, 1533–1547. [Google Scholar] [CrossRef] [PubMed]
- Mao, J.-L.; Miao, Z.-Q.; Wang, Z.; Yu, L.-H.; Cai, X.-T.; Xiang, C.-B. Arabidopsis ERF1 mediates cross-talk between ethylene and auxin biosynthesis during primary root elongation by regulating ASA1 expression. PLoS Genet. 2016, 12, e1006076. [Google Scholar] [CrossRef] [PubMed]
- Wan, S.; Xin, X.-F. Regulation and integration of plant jasmonate signaling: A comparative view of monocot and dicot. J. Genet. Genom. 2022, 49, 704–714. [Google Scholar] [CrossRef] [PubMed]
- Pieterse, C.M.; Van der Does, D.; Zamioudis, C.; Leon-Reyes, A.; Van Wees, S.C. Hormonal Modulation of Plant Immunity. Annu. Rev. Cell Dev. Biol. 2012, 28, 489–521. [Google Scholar] [CrossRef] [PubMed]
- O’Donnell, P.J.; Calvert, C.; Atzorn, R.; Wasternack, C.; Leyser, H.M.; Bowles, D. Ethylene as a signal mediating the wound response of tomato plants. Science 1996, 274, 1914–1917. [Google Scholar] [CrossRef] [PubMed]
- Pena-Cortes, H.; Fisahn, J.; Willmitzer, L. Signals involved in wound-induced proteinase inhibitor II gene expression in tomato and potato plants. Proc. Natl. Acad. Sci. USA 1995, 92, 4106–4113. [Google Scholar] [CrossRef]
- Rehman, S.; Aziz, E.; Akhtar, W.; Ilyas, M.; Mahmood, T. Structural and functional characteristics of plant proteinase inhibitor-II (PI-II) family. Biotechnol. Lett. 2017, 39, 647–666. [Google Scholar] [CrossRef]
- Mieslerova, B.; Lebeda, A.; Chetelat, R. Variation in response of wild Lycopersicon and Solanum spp. against tomato powdery mildew (Oidium lycopersici). J. Phytopathol. 2000, 148, 303–311. [Google Scholar] [CrossRef]
- Satková, P.; Starý, T.; Plešková, V.; Zapletalová, M.; Kašparovský, T.; Činčalová-Kubienová, L.; Luhová, L.; Mieslerová, B.; Mikulík, J.; Lochman, J.; et al. Diverse responses of wild and cultivated tomato to BABA, oligandrin and Oidium neolycopersici infection. Ann. Bot. 2017, 119, 829–840. [Google Scholar]
- Anderson, J.; Badruzsaufari, E.; Schenk, P.; Manners, J.; Desmond, O.; Ehlert, C.; Maclean, D.; Ebert, P.; Kazan, K. Antagonistic interaction between abscisic acid and jasmonate-ethylene signaling pathways modulates defense gene expression and disease resistance in Arabidopsis. Plant Cell 2004, 16, 3460–3479. [Google Scholar] [CrossRef]
- Harshavardhan, V.T.; Van Son, L.; Seiler, C.; Junker, A.; Weigelt-Fischer, K.; Klukas, C.; Altmann, T.; Sreenivasulu, N.; Bäumlein, H.; Kuhlmann, M. AtRD22 and AtUSPL1, members of the plant-specific BURP domain family involved in Arabidopsis thaliana drought tolerance. PLoS ONE 2014, 9, e110065. [Google Scholar] [CrossRef]
- Sah, S.K.; Reddy, K.R.; Li, J. Abscisic acid and abiotic stress tolerance in crop plants. Front. Plant Sci. 2016, 7, 571. [Google Scholar] [CrossRef] [PubMed]
- Bostock, R.M.; Pye, M.F.; Roubtsova, T.V. Predisposition in plant disease: Exploiting the nexus in abiotic and biotic stress perception and response. Annu. Rev. Phytopathol. 2014, 52, 517–549. [Google Scholar] [CrossRef]
- Kazan, K.; Manners, J.M. MYC2 The Master in Action. Mol. Plant 2013, 6, 686–703. [Google Scholar] [CrossRef]
- Campos, M.L.; Yoshida, Y.; Major, I.T.; de Oliveira Ferreira, D.; Weraduwage, S.M.; Froehlich, J.E.; Johnson, B.F.; Kramer, D.M.; Jander, G.; Sharkey, T.D.; et al. Rewiring of jasmonate and phytochrome B signalling uncouples plant growth-defense tradeoffs. Nat. Commun. 2016, 7, 12570. [Google Scholar] [CrossRef]
- Panda, S.; Jozwiak, A.; Sonawane, P.; Szymanski, J.; Kazachkova, Y.; Vainer, A.; Vasuki Kilambi, H.; Almekias-Siegl, E.; Dikaya, V.; Bocobza, S.; et al. Steroidal alkaloids defence metabolism and plant growth are modulated by the joint action of gibberellin and jasmonate signalling. New Phytol. 2022, 233, 1220–1237. [Google Scholar] [CrossRef] [PubMed]
- Yang, D.L.; Yao, J.; Mei, C.S.; Tong, X.H.; Zeng, L.J.; Li, Q.; Xiao, L.T.; Sun, T.P.; Li, J.; Deng, X.W.; et al. Plant hormone jasmonate prioritizes defense over growth by interfering with gibberellin signaling cascade. Proc. Natl. Acad. Sci. USA 2012, 109, E1192–E1200. [Google Scholar] [CrossRef] [PubMed]
- Major, I.T.; Guo, Q.; Zhai, J.; Kapali, G.; Kramer, D.M.; Howe, G.A. A phytochrome B-independent pathway restricts growth at high levels of jasmonate defense. Plant Physiol. 2020, 183, 733–749. [Google Scholar] [CrossRef]
- Alonso-Ramírez, A.; Rodríguez, D.; Reyes, D.; Jiménez, J.A.; Nicolás, G.; López-Climent, M.; Gómez-Cadenas, A.; Nicolás, C. Evidence for a role of gibberellins in salicylic acid-modulated early plant responses to abiotic stress in Arabidopsis seeds. Plant Physiol. 2009, 150, 1335–1344. [Google Scholar] [CrossRef]
- Bari, R.; Jone, J.D.G. Role of plant hormones in plant defence responses. Plant Mol. Biol. 2009, 69, 473–488. [Google Scholar] [CrossRef]
- Colebrook, E.H.; Thomas, S.G.; Phillips, A.L.; Hedden, P. The role of gibberellin signalling in plant responses to abiotic stress. J. Exp. Biol. 2014, 217, 67–75. [Google Scholar] [CrossRef]
- Hedden, P. The current status of research on gibberellin biosynthesis. Plant Cell Physiol. 2020, 61, 1832–1849. [Google Scholar] [CrossRef] [PubMed]
- Yimer, H.Z.; Nahar, K.; Kyndt, T.; Haeck, A.; Van Meulebroek, L.; Vanhaecke, L.; Demeestere, K.; Höfte, M.; Gheysen, G. Gibberellin antagonizes jasmonate-induced defense against Meloidogyne graminicola in rice. New Phytol. 2018, 218, 646–660. [Google Scholar] [CrossRef] [PubMed]
- Hong, G.-J.; Xue, X.-Y.; Mao, Y.-B.; Wang, L.-J.; Chen, X.-Y. Arabidopsis MYC2 interacts with DELLA proteins in regulating sesquiterpene synthase gene expression. Plant Cell 2012, 24, 2635–2648. [Google Scholar] [CrossRef] [PubMed]
- Qi, T.; Huang, H.; Wu, D.; Yan, J.; Qi, Y.; Song, S.; Xie, D. Arabidopsis DELLA and JAZ proteins bind the WD-Repeat/bHLH/MYB complex to modulate gibberellin and jasmonate signaling synergy. Plant Cell 2014, 26, 1118–1133. [Google Scholar] [CrossRef]
- Ding, Y.; Wei, W.; Wu, W.; Davis, R.E.; Jiang, Y.; Lee, I.-M.; Hammond, R.W.; Shen, L.; Sheng, J.-P.; Zhao, Y. Role of gibberellic acid in tomato defence against potato purple top phytoplasma infection. Ann. Appl. Biol. 2013, 162, 191–199. [Google Scholar] [CrossRef]
- Liu, Y.; Zhang, M.; Meng, Z.; Wang, B.; Chen, M. Research Progress on the Roles of Cytokinin in Plant Response to Stress. Int. J. Mol. Sci. 2020, 21, 6574. [Google Scholar] [CrossRef]
- Bao, A.; Zhao, Z.; Ding, G.; Shi, L.; Xu, F.; Cai, H. The stable level of glutamine synthetase 2 plays an important role in rice growth and in carbon-nitrogen metabolic balance. Int. J. Mol. Sci. 2015, 16, 12713–12736. [Google Scholar] [CrossRef]
- Žižková, E.; Dobrev, P.I.; Muhovski, Y.; Hošek, P.; Hoyerová, K.; Haisel, D.; Procházková, D.; Lutts, S.; Motyka, V.; Hichri, I. Tomato (Solanum lycopersicum L.) SlIPT3 and SlIPT4 isopentenyltransferases mediate salt stress response in tomato. BMC Plant Biol. 2015, 15, 85. [Google Scholar] [CrossRef]
- Németh, E.; Nagy, Z.; Pécsváradi, A. Chloroplast glutamine synthetase, the key regulator of nitrogen metabolism in wheat, performs its role by fine regulation of enzyme activity via negative cooperativity of its subunits. Front. Plant Sci. 2018, 9, 191. [Google Scholar] [CrossRef]
- Cai, H.; Zhou, Y.; Xiao, J.; Li, X.; Zhang, Q.; Lian, X. Overexpressed glutamine synthetase gene modifies nitrogen metabolism and abiotic stress responses in rice. Plant Cell Rep. 2009, 28, 527–537. [Google Scholar] [CrossRef]
- Berger, S.; Sinha, A.K.; Roitsch, T. Plant physiology meets phytopathology: Plant primary metabolism and plant-pathogen interactions. J. Exp. Bot. 2007, 58, 4019–4026. [Google Scholar] [CrossRef] [PubMed]
- Massad, T.J.; Dyer, L.A.; Vega, C. G Costs of defense and a test of the carbon-nutrient balance and growth-differentiation balance hypotheses for two co-occurring classes of plant defense. PLoS ONE 2012, 7, e47554. [Google Scholar] [CrossRef] [PubMed]
- Vega, A.; Canessa, P.; Hoppe, G.; Retamal, I.; Moyano, T.C.; Canales, J.; Gutiérrez, R.A.; Rubilar, J. Transcriptome analysis reveals regulatory networks underlying differential susceptibility to Botrytis cinerea in response to nitrogen availability in Solanum lycopersicum. Front. Plant Sci. 2015, 6, 911. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Z.; Schwartz, S.; Wagner, L.; Miller, W. A greedy algorithm for aligning DNA sequences. J. Comput. Biol. 2000, 7, 203–214. [Google Scholar] [CrossRef] [PubMed]
- Larkin, M.A.; Blackshields, G.; Brown, N.P.; Chenna, R.; McGettigan, P.A.; McWilliam, H.; Valentin, F.; Wallace, I.M.; Wilm, A.; Lopez, R.; et al. Clustal W and Clustal X version 2.0. Bioinformatics 2007, 23, 2947–2948. [Google Scholar] [CrossRef] [PubMed]
- Tamura, K.; Stecher, G.; Kumar, S. MEGA11: Molecular evolutionary genetics analysis version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef]
- Felsenstein, J. Confidence limits on phylogenies: An approach using the bootstrap. Evolution 1985, 39, 783–791. [Google Scholar] [CrossRef]
- Saitou, N.; Nei, M. The neighbor-joining method: A new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 1987, 4, 406–425. [Google Scholar]
- Uwaremwe, C.; Yue, L.; Wang, Y.; Tian, Y.; Zhao, X.; Liu, Y.; Zhou, Q.; Zhang, Y.; Wang, R. An endophytic strain of Bacillus amyloliquefaciens suppresses Fusarium oxysporum infection of Chinese wolfberry by altering its rhizosphere bacterial community. Front. Microbiol. 2022, 12, 3927. [Google Scholar] [CrossRef]
- Gordon, S.A.; Robert, P. Weber. Colorimetric estimation of indole acetic acid. Plant Physiol. 1951, 26, 192–195. [Google Scholar] [CrossRef]
- Syed-Ab-Rahman, S.F.; Carvalhais, L.C.; Chua, E.; Xiao, Y.; Wass, T.J.; Schenk, P.M. Identification of Soil Bacterial Isolates Suppressing Different Phytophthora spp. and Promoting Plant Growth. Front. Plant Sci. 2018, 9, 1502. [Google Scholar] [CrossRef] [PubMed]
- Erriu, M.; Genta, G.; Tuveri, E.; Orrù, G.; Barbato, G.; Levi, R. Microtiter spectrophotometric biofilm production assay analyzed with metrological methods and uncertainty evaluation. Meas. J. Int. Meas. Confed. 2012, 45, 1083–1088. [Google Scholar] [CrossRef]
- Dobereiner, J.; Marriel, I.; Nery, M. Ecological distribution of Spirillum lipoferum Beijerinck. Can. J. Microbiol. 1976, 22, 1464–1473. [Google Scholar] [CrossRef] [PubMed]
- Goswami, D.; Parmar, S.; Vaghela, H.; Dhandhukia, P.; Thakker, J.N. Describing Paenibacillus mucilaginosus strain N3 as an efficient plant growth promoting rhizobacteria (PGPR). Cogent Food Agric. 2015, 1, 1000714. [Google Scholar] [CrossRef]
- Pikovskaya, R.I. Mobilization of phosphorus in soil in connection with vital activity of some microbial species. Mikrobiologiya 1948, 17, 362–370. [Google Scholar]
- Meena, R.K.; Singh, R.K.; Singh, N.P.; Meena, S.K.; Meena, V.S. Isolation of low temperature surviving plant growth—Promoting rhizobacteria (PGPR) from pea (Pisum sativum L.) and documentation of their plant growth promoting traits. Biocatal. Agric. Biotechnol. 2015, 4, 806–811. [Google Scholar] [CrossRef]
- Khanna, K.; Jamwal, V.L.; Kohli, S.K.; Gandhi, S.G.; Ohri, P.; Bhardwaj, R.; Abd_Allah, E.F.; Hashem, A.; Ahmad, P. Plant growth promoting rhizobacteria induced Cd tolerance in Lycopersicon esculentum through altered antioxidative defense expression. Chemosphere 2019, 217, 463–474. [Google Scholar] [CrossRef]
- Abbasi, S.; Safaie, N.; Sadeghi, A.; Shamsbakhsh, M. Streptomyces strains induce resistance to Fusarium oxysporum f. sp. lycopersici Race 3 in tomato through different molecular mechanisms. Front. Microbiol. 2019, 10, 1505. [Google Scholar] [CrossRef]
- Beris, D.; Theologidis, I.; Skandalis, N.; Vassilakos, N. Bacillus amyloliquefaciens strain MBI600 induces salicylic acid dependent resistance in tomato plants against Tomato spotted wilt virus and Potato virus Y. Sci. Rep. 2018, 8, 10320. [Google Scholar] [CrossRef]
- Chini, A.; Ben-Romdhane, W.; Hassairi, A.; Aboul-Soud, M.A. Identification of TIFY/JAZ family genes in Solanum lycopersicum and their regulation in response to abiotic stresses. PLoS ONE 2017, 12, e0177381. [Google Scholar] [CrossRef]
- Chen, S.; Wang, X.; Zhang, L.; Lin, S.; Liu, D.; Wang, Q.; Cai, S.; El-Tanbouly, R.; Gan, L.; Wu, H.; et al. Identification and characterization of tomato gibberellin 2-oxidases (GA2oxs) and effects of fruit-specific SlGA2ox1 overexpression on fruit and seed growth and development. Hortic. Res. 2016, 3, 16059. [Google Scholar] [CrossRef] [PubMed]
- Zouari, I.; Salvioli, A.; Chialva, M.; Novero, M.; Miozzi, L.; Tenore, G.C.; Bagnaresi, P.; Bonfante, P. From root to fruit: RNA-Seq analysis shows that arbuscular mycorrhizal symbiosis may affect tomato fruit metabolism. BMC Genom. 2014, 15, 1–19. [Google Scholar] [CrossRef] [PubMed]
- Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001, 29, e45. [Google Scholar] [CrossRef] [PubMed]
PGPR Isolate | 16S rDNA Sequencing Alignment | IAA Production | Biofilm Production | Nitrogen Fixation | Phosphate Solubilization |
---|---|---|---|---|---|
33YE | Bacillus amyloliquefaciens | √ | √ | √ | √ |
UQ2077A | Enterobacter ludwigii | √ | √ | √ | √ |
UQ4510An | Pseudomonas azotoformans | √ | √ | √ | - |
UQ9000N | Bacillus velezensis | √ | √ | √ | - |
Target Gene | Forward Primer (5’-3’) | Reverse Primer (5’-3’) | Reference |
---|---|---|---|
SlRBOHD SlATG6 SlSOD SlPAL1 SlNPR1 SlPR2 SlCP SlSTPK SlRD22 SlJAZ1 SlERF1 SlPI-II SlGA3ox1 SlIPT2 SlGS SlACTIN | TCAGGTCAAGCATCAAAGCCGTT CCCATGCAGTCAAACAATTC CAAGATGATGATGGTCCAAC CATTGTACAGGTTGGTGAGAG TGTGGGAAAGATAGCAGCACG TTTCGATGCCCTTGTGGATTC TCCGAAGGCCCCAATAGG TGCATTGCAAACAGCAACAA ACGTGGCGTTATTTTTTCCTG TTCCCTCAAGGTGGAATGAAGGCT AGACTTGGGAGTTGAATTA CTTCTTCCAACTTCCTTTG GAATCCCATGCATGGACATCAT CCTTCTTGCACAAAGTTGCT CGCCGCCCAGCTTCAAACAT AGGCAGGATTTGCTGGTGATGATGCT | TGGTGAAACCGCAGCACAGT CCCTCATGCATTCAAGACAC CTCCATGTGTCAATTTATTCGG CATCTCTTGAGACACTCCA GTCCACACAAAACACACACATC GGCCAACCACTTTCCGATAC CACTGGGAGTGAAGGCAATGA CCAAGAGATCCTTCACCAATGAG ATCTCCGGCATCTTCTCTGA TCCGAAACTCGGAACCACCAAATC TACATTGCGATCTTGATTA TGTTTTCCTTCGCACATC TGTTATCGAGGTCGATCACTGG TGAGGTTATTGAATATTAGCAAATA CCTCAAGGGTTGGCTCCCACA ATACGCATCCTTCTGTCCCATTCCGA | [75] [75] [152] [153] [154] [135] [99] [99] This study [155] [153] [111] [156] [133] [157] This study |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Arkhipov, A.; Shao, Z.; Muirhead, S.R.; Harry, M.S.; Batool, M.; Mirzaee, H.; Carvalhais, L.C.; Schenk, P.M. Microbe-Friendly Plants Enable Beneficial Interactions with Soil Rhizosphere Bacteria by Lowering Their Defense Responses. Plants 2024, 13, 3065. https://doi.org/10.3390/plants13213065
Arkhipov A, Shao Z, Muirhead SR, Harry MS, Batool M, Mirzaee H, Carvalhais LC, Schenk PM. Microbe-Friendly Plants Enable Beneficial Interactions with Soil Rhizosphere Bacteria by Lowering Their Defense Responses. Plants. 2024; 13(21):3065. https://doi.org/10.3390/plants13213065
Chicago/Turabian StyleArkhipov, Alexander, Ziyu Shao, Sean R. Muirhead, Muchineripi S. Harry, Maria Batool, Hooman Mirzaee, Lilia C. Carvalhais, and Peer M. Schenk. 2024. "Microbe-Friendly Plants Enable Beneficial Interactions with Soil Rhizosphere Bacteria by Lowering Their Defense Responses" Plants 13, no. 21: 3065. https://doi.org/10.3390/plants13213065
APA StyleArkhipov, A., Shao, Z., Muirhead, S. R., Harry, M. S., Batool, M., Mirzaee, H., Carvalhais, L. C., & Schenk, P. M. (2024). Microbe-Friendly Plants Enable Beneficial Interactions with Soil Rhizosphere Bacteria by Lowering Their Defense Responses. Plants, 13(21), 3065. https://doi.org/10.3390/plants13213065