Next Article in Journal
Genome-Wide Analysis of Fruit Color and Carotenoid Content in Capsicum Core Collection
Previous Article in Journal
Optimization of Ultrasonic-Assisted Extraction of Phenolic Compounds and Antioxidant Activity from Araticum Peel Using Response Surface Methodology
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Assessment of Population Genetic Diversity of Medicinal Meconopsis integrifolia (Maxim.) Franch. Using Newly Developed SSR Markers

1
Fujian Provincial Key Laboratory of Haixia Applied Plant Systems Biology, Haixia Institute of Science and Technology, College of Forestry, Fujian Agriculture and Forestry University, Fuzhou 350002, China
2
Southwest Research Center for Engineering Technology of Landscape Architecture (State Forestry and Grassland Administration), Yunnan Engineering Research Center for Functional Flower Resources and Industrialization, College of Landscape Architecture and Horticulture Science, Southwest Forestry University, Kunming 650224, China
*
Authors to whom correspondence should be addressed.
These authors contributed equally to this work.
Plants 2024, 13(18), 2561; https://doi.org/10.3390/plants13182561
Submission received: 24 July 2024 / Revised: 9 September 2024 / Accepted: 10 September 2024 / Published: 12 September 2024
(This article belongs to the Section Plant Genetics, Genomics and Biotechnology)

Abstract

Meconopsis integrifolia is an endangered Tibetan medicinal plant with significant medicinal and ornamental value. Understanding its genetic diversity and structure is crucial for its sustainable utilization and effective conservation. Here, we develop a set of SSR markers based on transcriptome data to analyze the genetic diversity and structure of 185 individuals from 16 populations of M. integrifolia. The results indicate that M. integrifolia exhibits relatively high genetic diversity at the species level (the percentage of polymorphic bands PPB = 91.67%, Nei’s genetic diversity index He = 0.2989, Shannon’s information index I = 0.4514) but limited genetic variation within populations (PPB = 12.08%, He = 0.0399, I = 0.0610). The genetic differentiation among populations is relatively high (the coefficient of gene differentiation GST = 0.6902), and AMOVA analysis indicates that 63.39% of the total variation occurs among populations. This suggests that maintaining a limited number of populations is insufficient to preserve the overall diversity of M. integrifolia. Different populations are categorized into four representative subclusters, but they do not cluster strictly according to geographical distribution. Limited gene flow (Nm = 0.2244) is likely the main reason for the high differentiation among these populations. Limited seed and pollen dispersal abilities, along with habitat fragmentation, may explain the restricted gene flow among populations, highlighting the necessity of conserving as many populations in the wild as possible.

1. Introduction

The genus Meconopsis, belonging to the Papaveraceae family, encompasses approximately 49 species, 38 of which are found in China [1,2]. Many species within the genus are traditionally used in Tibetan medicine for their properties such as heat-clearing, detoxification, diuresis, anti-inflammatory, and analgesic effects, as documented in the Pharmacopoeia of Traditional Tibetan Medicine of the People’s Republic of China, Volume I [3]. Additionally, Meconopsis is renowned for its large flowers, vibrant colors, and graceful appearance, making it one of the most striking mountain flowers [4]. It holds significance as the national flower of Bhutan and is recognized as one of the eight famous flowers of Yunnan province, representing a noteworthy genus of high-altitude wildflowers with substantial breeding potential. Among these, M. integrifolia (Maxim.) Franch. thrives in shrubs or forests at elevations ranging from 2700 to 5100 m. Its erect stature and its large and beautiful yellow flowers render it highly ornamental, showcasing considerable potential for landscaping applications (Figure 1). Moreover, it is classified as a first-level endangered Tibetan medicinal plant, underscoring its high economic value [5]. However, in recent years, changes in natural environments compounded by anthropogenic factors have led to alterations in the habitat of Meconopsis. Consequently, there has been a gradual decline in both the variety and quantity of these species, with many facing imminent endangerment.
Understanding genetic diversity is crucial for plant breeding programs and the preservation of genetic resources [6]. Numerous studies have investigated the genetic diversity of Meconopsis using various molecular markers. For instance, random amplified polymorphic DNA (RAPD) markers were used to assess the genetic diversity of M. paniculata and M. simplicifolia, revealing very low or no genetic polymorphism in both species among and within populations [7]. RAPD markers were also used to analyze the genetic diversity and population structure of 16 M. quintuplinervia populations, showing a relatively high rate of genetic variation at the species level (total genetic diversity Ht = 0.2954, Shannon’s information index I = 0.4371) and a relatively high level of genetic differentiation within populations (the coefficient of gene differentiation GST = 0.2320; analysis of molecular variance (AMOVA) revealed 78.3% of the variation within populations) [8,9]. Fluorescent amplified fragment length polymorphism (AFLP) markers were previously applied to analyze the genetic diversity and structure of M. integrifolia, revealing relatively high genetic variation at the species level (the percentage of polymorphic bands PPB = 82.0%, Nei’s genetic diversity index He = 0.2356, and I = 0.3695) but extremely low genetic diversity at the population level (He = 0.0317, I = 0.0480) [10]. Genetic structure analysis indicated that their genetic differentiation mainly existed among populations (GST = 0.8636), with three main genetic groups aligning with their geographical distribution [10]. Similarly, significant population differentiation was also observed in M. integrifolia populations based on the chloroplast DNA (cpDNA) analysis (GST = 0.843) [9]. Despite several investigations on genetic diversity in Meconopsis plants, considerable variation exists in the distribution and intraspecific differentiation of different species within the genus Meconopsis. Consequently, current genetic knowledge remains limited, impeding the genetic conservation and enhancement of these endangered yet economically and ornamentally significant Chinese medicinal herbs.
Simple Sequence Repeats (SSRs), also referred to as microsatellites, consist of short tandem repeats of 1–6 base pairs that are widely distributed across eukaryotic genomes [11]. SSR markers are characterized by their abundance, co-dominant inheritance, high polymorphism, high resolution, and transferability among closely related species, rendering them widely applicable in genetic diversity studies across diverse plant species [12,13]. The broad application of transcriptome sequencing has yielded abundant data for developing SSR markers in non-model species. SSR markers generated from transcriptome data have been widely deployed in numerous studies of non-model plants such as Siberian wildrye (Elymus sibiricus L.) [14], Perennial ryegrass (Lolium perenne L.) [15]. Our team previously investigated the mechanism of floral color formation in Meconopsis “Lingholm” using transcriptome data [16]. SSRs derived from one species can be used to discern diversity in related species and even in other genera within the same family [17]. Here, SSR markers were newly developed and used for the assessment of population genetic diversity and phylogenetic relationships among 16 populations comprising 185 individuals of wild-collected M. integrifolia (Table S1). Our work could provide valuable information for the systematic utilization and conservation of M. integrifolia germplasm resources.

2. Results

2.1. SSR Markers’ Development and Their Characterizations

Utilizing our transcriptome data obtained previously [16], a total of 91,615 unigenes were assembled for Meconopsis “Lingholm”. A total of 91,615 unigenes were scanned using the MISA software, and 15,165 SSR loci were detected in 12,455 unigenes (Table 1 and Table S2). The SSR locus in the transcriptome had six types, and the numbers of each repeat type varied greatly. Of all detected SSR loci, tri-nucleotide repeats with 10,022 loci accounting for 66.09% ranked as the most abundant type, followed by di-nucleotide repeats with 3360 loci (22.16%), hexa-nucleotide repeats with 806 loci (5.31%), penta-nucleotide repeats with 436 loci (2.88%), tetra-nucleotide repeats with 315 loci (2.08%), and mono-nucleotide repeats was the least abundant type with 226 loci (1.49%) (Table 1 and Table S2).
The length of repeats in SSR loci ranged from 12 to 108 bp, with most of them (8327 loci, 54.9%) distributed between 12 and 15 bp (Figure 2A). The repeat unit frequencies of SSRs ranged from 5 to 29 times, with SSR loci having 5 to 10 repeats totaling 14,600 (96.27% of the total). Among these, SSR loci with 5 to 6 repeats were the most abundant, accounting for 67.56%. Only 15 SSR loci had repeats exceeding 21 times, representing a mere 0.09% (Figure 2B). The most abundant di-nucleotide repeats were AG/CT (1106; 32.92%) followed by GA/TC (956; 28.45%), AT/AT (509; 15.15%), and TA/TA (480; 14.29%). The most abundant tri-nucleotide repeats were GAA/TTC (1575; 15.72%) followed by AGA/TCT (1407; 14.04%) and AAG/CTT (1074; 10.72%). Meanwhile, the most affluent tetra-repeat motif types were AAGA/TCTT (27; 8.57%). The numbers of hexa- and penta-nucleotide motifs were 436 (2.88%) and 806 (5.31%), respectively (Figure 2C).

2.2. Assessment of Novel SSRs, Primer Design, and Genetic Diversity Statistics

Initially, 96 pairs of non-repetitive SSR primers designed based on transcriptome data were selected for preliminary screening (Table S3), which were utilized to amplify DNA extracted from four individuals of M. integrifolia. Following screening, 23 pairs of primers producing clear and distinct bands were identified and employed for polymerase chain reaction (PCR) amplification on 185 individuals collected from 16 populations of M. integrifolia (Figure S1). Part of the amplification results are depicted in Figure 3. The amplification results show that the sizes of polymorphic bands in the amplified products varied from 100 to 220 bp, with a total of 84 polymorphic bands observed (Figure S1). On average, each primer pair generated 3.65 polymorphic bands.
At the species level, the genetic diversity indices were as follows: PPB = 91.67%, observed number of alleles (Na) = 1.9167, effective number of alleles (Ne) = 1.5037, He = 0.2989, and I = 0.4514. The differences in genetic diversity at the population level are shown in Table 2. The average value of Na was 1.1208, ranging from 1.0595 (Bomi Tianchi in Tibet, BM) to 1.4881 (Litang Jianziwan Mountain in Sichuan Province, JZWS); the average value of Ne was 1.0657, ranging from 1.0397 (BM) to 1.2683 (JZWS); the average value of He was 0.0399, ranging from 0.0226 (BM) to 0.1603 (JZWS); and the average value of I was 0.0610, ranging from 0.0334 (BM) to 0.2436 (JZWS). The consistent ranking results of different genetic diversity indicators including Na, Ne, He, I, and PPB indicated that three populations from BM, Yaoshan Mountain in Yunnan Province (QJYS), and Maidika in Tibet (MDK) showed the lowest genetic diversity, while populations from JZWS, Zogang Dongda Mountain in Tibet (DDS), Qamdo in Tibet (CD), and Baima Snow mountain in Yunnan Province (BMXS) had the highest rankings for each genetic diversity indicator (Table 2). A previous study has shown that altitude significantly impacts the plant traits and floral characteristics of M. integrifolia [18]. The correlation analysis results show that He is significantly correlated with altitude (r = 0.302, p = 0.033 < 0.05) (Figure S2A), while I (r = 0.295, p = 0.160 > 0.05) and PPB (r = 0.275, p = 0.529 > 0.05) did not show significant correlations with altitude changes (Figure S2B,C), suggesting that altitude had some influence on the genetic diversity of M. integrifolia.

2.3. Genetic Differentiation and Phylogenetic Relationship

Nei’s method revealed high genetic differentiation among M. integrifolia populations (GST = 0.6902). The distribution of genetic variability among and within populations, as estimated by AMOVA, yielded consistent results. Specifically, AMOVA revealed that 63.39% of the total genetic variation was attributed to diversity among populations, with only 36.61% occurring within populations (Table 3). The gene flow (Nm) among populations was estimated to be 0.2244 (<1). The genetic similarity coefficient (GS) values among the populations ranged from 0.6035 to 0.9138 (Figure 4). Specifically, M. integrifolia from population BM and the M. integrifolia population from Cangshan Mountain in Yunnan Province (CS) had the greatest genetic distance and the lowest genetic similarity. Conversely, M. integrifolia from population QJYS and M. integrifolia from population MDK exhibited the smallest genetic distance and the highest genetic similarity. Mantel tests based on SSR markers revealed that genetic differentiation among populations (Nei’s genetic distance) did not show a significant correlation with geographic distance (Figure S2D). These results indicated that the genetic variation in M. integrifolia populations may be influenced by multiple factors.
To further elucidate the relationships among 16 populations of M. integrifolia, we employed unweighted pair-group method average (UPGMA) cluster analysis based on Nei’s genetic distance to generate a population dendrogram (Figure 5). The results indicated that the M. integrifolia population BM first separated into a distinct branch, forming subcluster IV, which showed a relatively distant genetic relationship with other populations. The population from Bayan Har Mountain in Qinghai Province (BYQ), Yulong Snow Mountain in Yunnan Province (YLXS), Namtso in Tibet (NMC), MDK, and QJYS clustered together and formed subcluster I, indicating closer genetic relationships among these populations. The population from Hongyuan in Sichuan Province (HY) and Xiaojin Balang Mountain in Sichuan Province (BLS) clustered together closely to form subcluster II with the population from Dari in Qinghai Province (DR). The remaining subcluster III contained most populations including DDS, CD, BMXS, Shergyla Mountain in Tibet (SJLS), JZWS, Yushu in Qinghai Province (YS), and CS. Among these, subclusters II and III each contain several geographically proximate populations. However, the overall clustering results do not entirely align with the geographical distribution. For instance, the population CS clusters closely with the distant population YS, while the geographically closer population YLXS is grouped into a different subcluster.
The principal component analysis (PCA) clustering results for all individuals from the 16 populations were generally consistent with the UPGMA cluster analysis (Figure 6). Individuals from the population BM clustered separately from those of other populations. Individuals from populations that clustered within the same branch did not group strictly according to their respective populations but were intermixed with individuals from other populations in the same subcluster (Figure 5 and Figure 6).

3. Discussion

3.1. Genetic Diversity of M. integrifolia

Intraspecific genetic variation is crucial for adaptation to environmental changes and the long-term survival of species [19]. In this study, we used previously obtained transcriptome data to screen a set of SSR markers suitable for the genus Meconopsis. The identified SSR markers were applied for the genetic diversity and structure of 16 populations of M. integrifolia, which could allow us to evaluate genetic variation between different populations and investigate potential factors influencing this variation. The SSR marker analysis revealed relatively high genetic diversity at the species level for M. integrifolia (PPB = 91.67%, He = 0.2989, and I = 0.4514) (Table 2). These results are obviously higher than those obtained by Guo et al. (2016) using AFLP markers for M. integrifolia (He = 0.2356, I = 0.3659) [10] and slightly higher than those reported by Yang et al. (2010) using RAPD markers for M. quintuplinervia (He = 0.2408, I = 0.3347) [8]. In contrast to the high genetic diversity at the species level, M. integrifolia showed relatively low genetic diversity at the population level (PPB = 12.08%, He = 0.0399, and I = 0.0610) (Table 2). This finding is consistent with the results of Guo et al. (2016) using AFLP markers, which also showed very low genetic diversity at the population level (He = 0.0317, I = 0.0480) [10]. Specifically, two sampling sites (Balang Mountain and Jianziwan Mountain) in this work overlap with the study conducted by Guo et al. (2016). Their AFLP analysis showed higher diversity at Jianziwan Mountain (YJJZW, PPB = 9.2%, He = 0.0320, I = 0.0475) compared to Balang Mountain (XJ, PPB = 5.9%, He = 0.0169, I = 0.0259) [10]. Similarly, our SSR marker analysis also revealed higher genetic diversity at Jianziwan Mountain (JZWS, PPB = 48.81%, He = 0.1603, I = 0.2436) than at Balang Mountain (BLS, PPB = 28.57%, He = 0.1051, I = 0.1565) (Table 2). Moreover, the higher level of polymorphism detected in M. integrifolia populations by SSR markers compared with AFLPs highlights the discriminating capacity of the former. The reason why SSR markers exhibit higher polymorphism compared to AFLP markers may be due to the high variability of SSR regions in the genome. These regions, due to their repetitive nature, are susceptible to mutations, which can lead to higher polymorphism. In addition, SSR markers are usually located in non-coding regions and may be subject to less selective pressure, which may also promote the development of their polymorphism. This finding aligns with previous studies that have demonstrated similar results when comparing SSRs with other marker systems in species such as Fig (Ficus carica L.) [20], tropical maize (Zea mays L.) [21], and olive tree (Olea europaea L.) [22].

3.2. Genetic Differentiation and Structure of M. integrifolia Populations

The genetic structure of plant populations reflects the interplay of various processes, including distributional changes [23], habitat fragmentation and/or population isolation [24], genetic drift [25], reproductive systems [26], gene flow [27], and life history traits [28] All these factors are related to the total amount of genetic variation and its distribution within and among populations. This study found that the genetic differentiation among M. integrifolia populations was relatively high (GST = 0.6902), and AMOVA analysis showed a similar pattern of genetic structure with 63.39% of the total variation among populations. Previous studies using AFLP markers also indicated high genetic differentiation among M. integrifolia populations (GST = 0.8636), with AMOVA analysis showing 88.9% of the total variation among populations [10]. Similarly, results based on cpDNA analysis showed high genetic differentiation among M. integrifolia populations (GST = 0.843), with AMOVA analysis indicating 80.18% of the total variation among populations [9]. Consistently, these results suggest significant genetic differentiation among M. integrifolia populations. Although the UPGMA clustering results (Figure 5) and PCA clustering analysis (Figure 6) show that some geographically proximate populations cluster together according to their terrain, the genetically similar groups are intermixed in their geographical distribution, suggesting that geographical distribution has some influence on the genetic structure of M. integrifolia. However, there was no significant correlation between genetic distance and geographical distance among populations (Figure 4 and Figure S2D). This may imply that geographical isolation is not the primary factor driving genetic differentiation, or its effects might be obscured by other factors. The gene flow Nm value among populations based on SSR markers in our work was 0.2244 (less than 1), indicating relatively low gene flow among M. integrifolia populations, similar with that estimated by AFLP markers (Nm = 0.0395) [10]. These results imply that limited gene flow may be the primary reason for the low genetic variation within populations and high differentiation among populations of M. integrifolia.
The level of gene flow in a species is influenced by its biological characteristics and the behavior of its pollinators, and the breeding system significantly impacts population differentiation [29,30]. Typically, self-pollinating species retain more genetic diversity among populations rather than within populations, compared to outcrossing species [31]. It has been reported that M. integrifolia has a mixed mating system, with approximately 65.0% of seeds set through autonomous self-pollination [32], potentially promoting high genetic differentiation among populations. Additionally, the primary pollinators of M. integrifolia are flies and thrips with limited flight capabilities [32], restricting their movement and thus reducing pollen exchange among populations, contributing to the high genetic differentiation. According to our field observations, the M. integrifolia plant often produces many small, lightweight, smooth seeds that lack obvious dispersal adaptations. This kind of seeds are likely dispersed over short distances near the parent plant through gravity. Therefore, gene flow via seeds or pollen within and among M. integrifolia populations is limited.
Besides biological characteristics, limited gene flow is also restricted by fragmented and heterogeneous habitats [33]. M. integrifolia grows at elevations of 2700–5100 m in shrubs or under forests, distributed in the Eastern Himalayas and Hengduan Mountain regions. The parallel mountain ranges and deep river valleys extending from north to south in this area may act as physical barriers, hindering effective gene flow between M. integrifolia populations and thereby enhancing population differentiation. The wild populations of M. integrifolia are small and unable to form large populations, which occurs in various ecological environments, including different altitudes, climate conditions, and habitat types. Environmental heterogeneity may lead to differences in natural selection, which could, in turn, affect the genetic structure among populations [34]. Therefore, the limited seed and pollen dispersal capability of M. integrifolia and its habitat fragmentation likely explain the current limited gene flow (Nm = 0.2244), resulting in increased genetic erosion within populations and genetic differentiation among populations.
Understanding the genetic diversity and structure of natural populations of endangered species is essential for effective conservation measures [31,35]. Our study indicates that M. integrifolia exhibits a high degree of genetic differentiation (GST = 0.6902), with most genetic variation occurring among populations. Maintaining only a limited number of populations is insufficient to preserve the overall genetic diversity. Therefore, conservation efforts should focus on increasing population numbers to enrich the gene pool [36]. To protect the genetic diversity of M. integrifolia, it is essential to preserve as many wild populations as possible. Moreover, M. integrifolia populations can be classified into four representative groups (Figure 5), and representative populations from different groups should be prioritized for monitoring and management under limited conditions. Moreover, our findings suggest that genetic drift plays a significant role in the genetic differentiation of M. integrifolia populations. Conservation strategies should include delineating development areas to allow populations time for self-renewal and expansion. In situ conservation should be the primary approach, complemented by ex situ conservation when necessary. In situ efforts should establish protected areas to prevent trampling and damage by humans and livestock. For populations with very few individuals, severely degraded habitats, or those unable to reproduce independently in the wild, ex situ conservation and scientific management are recommended as alternative strategies. Additionally, artificial propagation should be considered when necessary to supplement M. integrifolia populations. Scientific methods to enhance seed germination rates, improve water and nutrient management, and promote plant growth should be employed. Research on rapid propagation techniques through tissue culture could also help increase the number of M. integrifolia clonal populations [37].

4. Materials and Methods

4.1. Samples Collection and DNA Extraction

The plant material utilized here in studying the genetic diversity and population structure of M. integrifolia was collected from sixteen landraces (16 sites) with 185 individuals (Figure 7, Table S1). These sampling sites were strategically chosen to cover a wide geographic range, primarily sourced from four provinces: Yunnan, Sichuan, Tibet, and Qinghai. Among them, there were 4 populations in Yunnan, 3 in Sichuan, 6 in Tibet, and 3 in Qinghai, with 10–15 individuals collected per sampling point. The average elevation of the 16 sampling sites was 4329 m, with the highest altitude at Namtso in Tibet (NMC) reaching 5200 m and the lowest at Cangshan Mountain in Yunnan (CS) at 3700 m. The barriers between sampling sites were primarily mountain ranges or rivers. Tender fresh leaf tissue from each individual was collected for genomic DNA extraction, which was performed using the Qiagen DNA extraction kit (Qiagen, Hilden, Germany) method.

4.2. SSRs Identification and Primer Design

SSRs were identified based off our transcriptome data obtained in previous work (NCBI: PRJNA1151241) [16] using MISA 1.0 software [38]. Primer design for SSRs was conducted using Primer5 software, with parameters set as follows: primer length of 18–22 bp, GC content of 40–60%, annealing temperature of 50–70 °C, Tm of 55–65 °C, and product size of 100–300 bp. Measures were taken to avoid secondary structures such as hairpins, dimers, mismatches, and primer–dimers. A total of 96 pairs of non-repetitive SSR primers were selected as preliminary screening primers, synthesized by Shuoqing Biotechnology Co., Ltd. in Kunming, China, and tested on the DNA samples from four individuals of M. integrifolia. Primers producing clear, non-streaky, highly polymorphic, and reproducible bands were selected, resulting in 23 primer pairs with good polymorphism that were kept for genetic diversity analysis of 185 individuals from 16 landraces of M. integrifolia (Table 4). PCR reactions were conducted in a 25 μL volume containing 60 ng template DNA, 2 mM Mg2+, 0.2 mM dNTPs, 0.5 μM primer, and 1.6 U Taq DNA polymerase. PCR cycling conditions included an initial denaturation step of 5 min at 94 °C, followed by 35 cycles of 30 s at 94 °C, 30 s at the specific annealing temperature (ranging from 51 to 63 °C depending on the primers used), and 20 s at 72 °C, with a final extension step of 1 min at 72 °C. Polymorphic bands of PCR products were detected using 12% SDS-PAGE separation gel, and the amplified products were observed and photographed, and gel images were saved under a UVP gel imaging system.

4.3. Data Processing and Analysis

The GENE MAPPER 4.1 software was utilized for precise data point analysis [39]. The core base repeat number, corresponding to primer pairs, was instrumental in determining the exact size of the loci. The polymorphism detected for the primer pairs was ascertained based on the locus information analyzed, leading to the selection of highly specific and polymorphic loci for further research endeavors. Given that SSRs are co-dominant genetic markers, a binary matrix (0, 1) was constructed to represent the presence (1) and absence (0) of bands [40]. This matrix, derived from SSR data, was then used to evaluate genetic variability, employing a suite of metrics including the percentage of polymorphic bands (PPB), the observed number of alleles per locus (Na), the effective number of alleles per locus (Ne), Nei’s genetic diversity index (He), the Shannon’s information index (I), the coefficient of gene differentiation (Gst), gene flow (Nm), Nei’s standard genetic distance (D), standard genetic identity (J), and genetic similarity (GS), with the aid of POPGENE 1.32 software [41].
For the analysis of molecular variance (AMOVA), the Arlequin v3.5.2.2L [42] software was employed, conducting 1000 simulations to ascertain the significance of differences in data components between inter-population and intra-population variations and to calculate the respective percentages of variation. The UPGMA method was applied in both MEGA 11 and MVSP 3.22 software to analyze the amplification results of the 16 populations of M. integrifolia, and each software was used to construct a dendrogram [43]. Additionally, a principal component analysis (PCA) was performed to delineate the genetic relationships among these populations. Furthermore, the TFPGA 1.3 software was leveraged to execute Mantel tests, aiming to assess the correlation between genetic distances calculated from SSR markers and geographical distances [44].

5. Conclusions

M. integrifolia, a member of the Papaveraceae family, is an endangered valuable Tibetan medicinal plant with significant medicinal and ornamental value. Understanding genetic diversity and structure is crucial for its sustainable utilization and implementing effective conservation measures. In this study, we developed a set of SSR markers based on transcriptome data to analyze the genetic diversity and structure of 185 individuals from 16 populations of M. integrifolia. The results indicate that M. integrifolia exhibits relatively high genetic diversity at the species level (PPB = 91.67%, Nei’s genetic diversity index He = 0.2989, Shannon’s information index I = 0.4514) but limited genetic variation within populations (PPB = 12.08%, He = 0.0399, I = 0.0610). The genetic differentiation among populations is relatively high (GST = 0.6902), and AMOVA analysis also indicates that 63.39% of the total variation occurs among populations. This suggests that maintaining a limited number of populations is insufficient to preserve the overall diversity of M. integrifolia. All the collected populations can be categorized into four representative subclusters, but they do not cluster strictly according to geographical distribution, implying that geographical isolation might not be the primary factor driving genetic differentiation. Limited gene flow (Nm = 0.2244) is likely the main reason for high differentiation among these populations. Limited seed and pollen dispersal abilities, along with habitat fragmentation, may explain the restricted gene flow among populations, highlighting the necessity of conserving as many populations in the wild as possible.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/plants13182561/s1. Figure S1: PCR amplification of all primers in M. integrifolia; Figure S2: Correlation analysis of altitude and He, PPB and I, and Nei’s genetic distance with geographic distance; Table S1: Location distributions of the 16 populations of M. integrifolia; Table S2: Summary of the different repeat units of identified SSRs in M. integrifolia; Table S3: 96 pairs of non-repetitive SSR primers selected for preliminary screening.

Author Contributions

Y.Q. (Yan Qu) and P.Z. conceived the project and designed experiments. J.W., W.Z. and X.M. collected all the samples for SSR analysis and conducted the experiments. J.W. and Q.Y. conducted the data analysis and draft the manuscript. The manuscript was reviewed and edited by P.Z., Y.Q. (Yuan Qin) and Y.Q. (Yan Qu). All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the National Natural Science Foundation of China (32160404, 31460218); the Ten Thousand Talents Plans for Young Top-notch Talents of Yunnan Province (YNWR-QNBJ-2019-211); Construction Funds for Cross-disciplinary Synthetic Biology at the Institute of Future Technology, Fujian Agriculture and Forestry University (133-712023010); Fujian Key Laboratory of Island Monitoring and Ecological Development (Island Research Center, MNR) (NO: 2022ZD06), Science and Technology Innovation Project of Fujian Agriculture and Forestry University (CXZX2019144G, CXZX2020086A).

Data Availability Statement

The data presented in this study are available in the article, Supplementary Materials and online repositories.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Editorial Committee of the Flora of China of Chinese Academy of Science (Ed.) Flora of China; Science Press: Beijing, China, 1999. [Google Scholar]
  2. Wu, Z.Y.; Chuang, H. A study on the taxonomic system of the genus Meconopsis. Acta Bot. Yunnanica Kunming 1980, 2, 371–381. [Google Scholar]
  3. Wang, B.; Song, X.H.; Cheng, C.M.; Yang, J.S. Studies on species of Meconopsis as Tibetan medicines. Chin. Wild Pl. Resour. 2003, 22, 43–46. [Google Scholar]
  4. Grey-Wilson, C. The true identity of Meconopsis napaulensis DC. Curtis’s Bot. Mag. 2006, 23, 176–209. [Google Scholar] [CrossRef]
  5. Editorial Board of Chinese Materia Medica, Shanghai University of Traditional Chinese Medicine (Ed.) Chinese Materia Medica 8; Shanghai Science and Technology Press: Shanghai, China, 1999. [Google Scholar]
  6. Yu, Y.-L.; Wang, H.-C.; Yu, Z.-X.; Schinnerl, J.; Tang, R.; Geng, Y.-P.; Chen, G. Genetic diversity and structure of the endemic and endangered species Aristolochia delavayi growing along the Jinsha River. Plant Divers. 2021, 43, 225–233. [Google Scholar] [CrossRef] [PubMed]
  7. Sulaiman, I.M.; Hasnain, S.E. Random amplified polymorphic DNA (RAPD) markers reveal genetic homogeneity in the endangered Himalayan species Meconopsis paniculata and M. simplicifolia. Theor. Appl. Genet. 1996, 93, 91–96. [Google Scholar] [CrossRef]
  8. Yang, S.; Lu, X.; Ye, R.; Li, Y.; Zhou, Y.; Yue, P.; Zhao, J.; Zhang, C.; Peng, M. Genetic diversity and population structure in Meconopsis quintuplinervia (Papaveraceae). Afr. J. Biotechnol. 2010, 9, 3048–3053. [Google Scholar]
  9. Yang, F.-S.; Qin, A.-L.; Li, Y.-F.; Wang, X.-Q. Great genetic differentiation among populations of Meconopsis integrifolia and its implication for plant speciation in the Qinghai-Tibetan Plateau. PLoS ONE 2012, 7, e37196. [Google Scholar] [CrossRef]
  10. Guo, J.-L.; Zhang, X.-Y.; Zhang, J.-W.; Li, Z.-M.; Sun, W.-G.; Zhang, Y.-H. Genetic diversity of Meconopsis integrifolia (Maxim.) Franch. In the East Himalaya–Hengduan Mountains inferred from fluorescent amplified fragment length polymorphism analysis. Biochem. Syst. Ecol. 2016, 69, 67–75. [Google Scholar] [CrossRef]
  11. Kashi, Y.; King, D. Simple sequence repeats as advantageous mutators in evolution. Trends Genet. 2006, 22, 253–259. [Google Scholar] [CrossRef]
  12. Powell, W.; Machray, G.C.; Provan, J. Polymorphism revealed by simple sequence repeats. Trends Plant Sci. 1996, 1, 215–222. [Google Scholar] [CrossRef]
  13. Zhao, Y.; Zhang, S.-B.; Yang, J.; Zhang, L. Characterization of 13 microsatellite loci developed from Meconopsis horridula. Genet. Mol. Biol. 2010, 33, 539–541. [Google Scholar] [CrossRef] [PubMed]
  14. Zhou, Q.; Luo, D.; Ma, L.; Xie, W.; Wang, Y.; Wang, Y.; Liu, Z. Development and cross-species transferability of EST-SSR markers in Siberian wildrye (Elymus sibiricus L.) using Illumina sequencing. Sci. Rep. 2016, 6, 20549. [Google Scholar] [CrossRef] [PubMed]
  15. Hannaway, D.; Fransen, S.; Cropper, J.B.; Teel, M.; Chaney, M.; Griggs, T.; Halse, R.R.; Hart, J.M.; Cheeke, P.R.; Hansen, D.E.; et al. Perennial Ryegrass (Lolium perenne L.); Oregon State University: Corvallis, OR, USA, 1999. [Google Scholar]
  16. Qu, Y.; Ou, Z.; Yang, F.-s.; Wang, S.; Peng, J. The study of transcriptome sequencing for flower coloration in different anthesis stages of alpine ornamental herb (Meconopsis ‘Lingholm’). Gene 2019, 689, 220–226. [Google Scholar] [CrossRef] [PubMed]
  17. Park, Y.-J.; Lee, J.K.; Kim, N.-S. Simple sequence repeat polymorphisms (SSRPs) for evaluation of molecular diversity and germplasm classification of minor crops. Molecules 2009, 14, 4546–4569. [Google Scholar] [CrossRef] [PubMed]
  18. Yun, W.; Niwen, Z.; Han, P.; Guangli, L. Phenotypic Selection on Plant Traits and Floral Traits at Different Altitudes for Meconopsis integrifolia. Acta Bot. Boreali-Occident. Sin. 2016, 36, 1443–1449. [Google Scholar]
  19. Pauls, S.U.; Nowak, C.; Bálint, M.; Pfenninger, M. The impact of global climate change on genetic diversity within populations and species. Mol. Ecol. 2013, 22, 925–946. [Google Scholar] [CrossRef]
  20. Baraket, G.; Chatti, K.; Saddoud, O.; Abdelkarim, A.B.; Mars, M.; Trifi, M.; Hannachi, A.S. Comparative assessment of SSR and AFLP markers for evaluation of genetic diversity and conservation of fig, Ficus carica L., genetic resources in Tunisia. Plant Mol. Biol. Rep. 2011, 29, 171–184. [Google Scholar] [CrossRef]
  21. Garcia, A.A.; Benchimol, L.L.; Barbosa, A.M.; Geraldi, I.O.; Souza, C.L., Jr.; Souza, A.P.D. Comparison of RAPD, RFLP, AFLP and SSR markers for diversity studies in tropical maize inbred lines. Genet. Mol. Biol. 2004, 27, 579–588. [Google Scholar] [CrossRef]
  22. Belaj, A.; Satovic, Z.; Cipriani, G.; Baldoni, L.; Testolin, R.; Rallo, L.; Trujillo, I. Comparative study of the discriminating capacity of RAPD, AFLP and SSR markers and of their effectiveness in establishing genetic relationships in olive. Theor. Appl. Genet. 2003, 107, 736–744. [Google Scholar] [CrossRef]
  23. Jay, F.; Manel, S.; Alvarez, N.; Durand, E.Y.; Thuiller, W.; Holderegger, R.; Taberlet, P.; François, O. Forecasting changes in population genetic structure of alpine plants in response to global warming. Mol. Ecol. 2012, 21, 2354–2368. [Google Scholar] [CrossRef]
  24. Vandergast, A.G.; Bohonak, A.J.; Weissman, D.B.; Fisher, R.N. Understanding the genetic effects of recent habitat fragmentation in the context of evolutionary history: Phylogeography and landscape genetics of a southern California endemic Jerusalem cricket (Orthoptera: Stenopelmatidae: Stenopelmatus). Mol. Ecol. 2007, 16, 977–992. [Google Scholar] [CrossRef] [PubMed]
  25. Tremblay, R.L.; Ackerman, J.D. Gene flow and effective population size in Lepanthes (Orchidaceae): A case for genetic drift. Biol. J. Linn. Soc. 2008, 72, 47–62. [Google Scholar] [CrossRef]
  26. Lowry, D.B.; Modliszewski, J.L.; Wright, K.M.; Wu, C.A.; Willis, J.H. The strength and genetic basis of reproductive isolating barriers in flowering plants. Philos. Trans. R. Soc. B Biol. Sci. 2008, 363, 3009–3021. [Google Scholar] [CrossRef] [PubMed]
  27. Tero, N.; Aspi, J.; Siikamäki, P.; Jäkäläniemi, A.; Tuomi, J. Genetic structure and gene flow in a metapopulation of an endangered plant species, Silene tatarica. Mol. Ecol. 2003, 12, 2073–2085. [Google Scholar] [CrossRef] [PubMed]
  28. Nybom, H.; Bartish, I.V. Effects of life history traits and sampling strategies on genetic diversity estimates obtained with RAPD markers in plants. Perspect. Plant Ecol. Evol. Syst. 2000, 3, 93–114. [Google Scholar] [CrossRef]
  29. Ellstrand, N.C. Gene flow by pollen: Implications for plant conservation genetics. Oikos 1992, 63, 77–86. [Google Scholar] [CrossRef]
  30. Kwak, M.M.; Velterop, O.; van Andel, J. Pollen and gene flow in fragmented habitats. Appl. Veg. Sci. 1998, 1, 37–54. [Google Scholar] [CrossRef]
  31. Wang, D.-Y.; Chen, Y.-J.; Zhu, H.-M.; Lv, G.-S.; Zhang, X.-P.; Shao, J.-W. Highly differentiated populations of the narrow endemic and endangered species Primula cicutariifolia in China, revealed by ISSR and SSR. Biochem. Syst. Ecol. 2014, 53, 59–68. [Google Scholar] [CrossRef]
  32. Wu, Y.; Liu, Y.; Peng, H.; Yang, Y.; Liu, G.; Cao, G.; Zhang, Q. Pollination ecology of alpine herb Meconopsis integrifolia at different altitudes. Chin. J. Plant Ecol. 2015, 39, 1–13. [Google Scholar]
  33. Ciccheto, J.R.M.; Carnaval, A.C.; Araujo, S.B.L. The influence of fragmented landscapes on speciation. J. Evol. Biol. 2024, voae043. [Google Scholar] [CrossRef]
  34. Schluter, D.; Rieseberg, L.H. Three problems in the genetics of speciation by selection. Proc. Natl. Acad. Sci. USA 2022, 119, e2122153119. [Google Scholar] [CrossRef] [PubMed]
  35. Meng-Meng, G.; Rui, M.; Xun, G. Conservation genetics of an endemic plant, Anemoclema glaucifolium, in the Jinsha River Valley. Plant Divers. 2013, 35, 555. [Google Scholar]
  36. Höglund, J. Evolutionary Conservation Genetics; Oxford University Press: Oxford, UK, 2009. [Google Scholar]
  37. Chen, K.; Ye, C.; Guo, J.; Chen, D.; Guo, T.; Liu, J.; Liu, C.; Zhou, X. Agrobacterium-mediated transformation efficiency and grain phenotypes in six indica and japonica rice cultivars. Seed Biol. 2023, 2, 4. [Google Scholar] [CrossRef]
  38. Wang, X.; Wang, L. GMATA: An integrated software package for genome-scale SSR mining, marker development and viewing. Front. Plant Sci. 2016, 7, 1350. [Google Scholar] [CrossRef] [PubMed]
  39. Currie-Fraser, E.; Shah, P.; True, S. Data analysis using GeneMapper® v4. 1: Comparing the newest generation of GeneMapper software to legacy Genescan® and Genotyper® Software. J. Biomol. Tech. JBT 2010, 21 (Suppl. S3), S31. [Google Scholar]
  40. Shi, P.; Zhou, Y.; Shang, X.; Xiao, L.; Zeng, W.; Cao, S.; Wu, Z.; Yan, H. Assessment of genetic diversity and identification of core germplasm of Pueraria in Guangxi using SSR markers. Trop. Plants 2024, 3, e012. [Google Scholar] [CrossRef]
  41. Yeh, F.C.; Yang, R.C.; Boyle, T. POPGENE. Microsoft Windows Based Freeware for Population Genetic Analysis, version 1.32; University of Alberta: Edmonton, AB, Canada, 1999.
  42. Excoffier, L.; Lischer, H. An Integrated Software Package for Population Genetics Data Analysis; Swiss Institute of Bioinformatics: Lausanne, Switzerland, 2011. [Google Scholar]
  43. Kumar, S.; Tamura, K.; Nei, M. MEGA: Molecular evolutionary genetics analysis software for microcomputers. Bioinformatics 1994, 10, 189–191. [Google Scholar] [CrossRef]
  44. Miller, M. Tools for Population Genetic Analysis (TFPGA) 1.3: A Windows Program for the Analysis of Elysium and Molecular Population Genetic Data; Northern Arizona University: Flagstaff, AZ, USA, 1997. [Google Scholar]
Figure 1. Habitat (A), whole plant morphology (B), and flower morphology (C) of M. integrifolia in the wild.
Figure 1. Habitat (A), whole plant morphology (B), and flower morphology (C) of M. integrifolia in the wild.
Plants 13 02561 g001
Figure 2. Characterizations of SSRs identified from transcriptome datasets obtained in our previous work of Meconopsis “Lingholm”. (A) Distribution of the length of repeats in SSR loci. (B) Distribution of the number of repeats in SSR loci. (C) Type distribution of SSRs identified in the assembled Meconopsis “Lingholm” unigenes.
Figure 2. Characterizations of SSRs identified from transcriptome datasets obtained in our previous work of Meconopsis “Lingholm”. (A) Distribution of the length of repeats in SSR loci. (B) Distribution of the number of repeats in SSR loci. (C) Type distribution of SSRs identified in the assembled Meconopsis “Lingholm” unigenes.
Plants 13 02561 g002
Figure 3. PCR amplification results using primers P69 and P29 in M. integrifolia. The gel image shows the amplification products of individuals from different populations, with bands separated by markers. The full names corresponding to the population abbreviations in the figure are provided in Table 2.
Figure 3. PCR amplification results using primers P69 and P29 in M. integrifolia. The gel image shows the amplification products of individuals from different populations, with bands separated by markers. The full names corresponding to the population abbreviations in the figure are provided in Table 2.
Plants 13 02561 g003
Figure 4. Genetic distance (below diagonal) and genetic similarity (above diagonal) among 16 populations of M. integrifolia based on SSR analysis. “****” indicates the comparison of populations with themselves, which naturally results in perfect similarity and theoretically a genetic distance of zero.
Figure 4. Genetic distance (below diagonal) and genetic similarity (above diagonal) among 16 populations of M. integrifolia based on SSR analysis. “****” indicates the comparison of populations with themselves, which naturally results in perfect similarity and theoretically a genetic distance of zero.
Plants 13 02561 g004
Figure 5. UPGMA dendrogram based on Nei’s genetic diversity coefficient among 16 populations of M. integrifolia using SSR marker analysis. Bootstrap analysis was performed with 1000 replicates, and the corresponding bootstrap values (%) were indicated.
Figure 5. UPGMA dendrogram based on Nei’s genetic diversity coefficient among 16 populations of M. integrifolia using SSR marker analysis. Bootstrap analysis was performed with 1000 replicates, and the corresponding bootstrap values (%) were indicated.
Plants 13 02561 g005
Figure 6. PCA cluster analysis of 185 individuals from 16 populations of M. integrifolia.
Figure 6. PCA cluster analysis of 185 individuals from 16 populations of M. integrifolia.
Plants 13 02561 g006
Figure 7. Location distributions of the 16 populations of M. integrifolia sampled for this study. Six of the sixteen populations were collected from Tibet, four from Yunnan Province, and three each from Qinghai Province and Sichuan Province. The number of samples collected from each population is also indicated below the corresponding population name. Details of the populations are provided in Table S1.
Figure 7. Location distributions of the 16 populations of M. integrifolia sampled for this study. Six of the sixteen populations were collected from Tibet, four from Yunnan Province, and three each from Qinghai Province and Sichuan Province. The number of samples collected from each population is also indicated below the corresponding population name. Details of the populations are provided in Table S1.
Plants 13 02561 g007
Table 1. Prediction of SSRs out of our previous transcript datasets of Meconopsis “Lingholm” [16].
Table 1. Prediction of SSRs out of our previous transcript datasets of Meconopsis “Lingholm” [16].
ParameterNumber
Total number of unigenes examined91,615
Total number of identified SSRs15,165
Number of SSR containing unigenes12,455
Mono nucleotide226
Di nucleotide3360
Tri nucleotide10,022
Tetra nucleotide315
Penta nucleotide436
Hexa nucleotide806
Table 2. Genetic diversity within populations of M. integrifolia based on SSR analysis.
Table 2. Genetic diversity within populations of M. integrifolia based on SSR analysis.
PopulationSampling LocationPPBNaNeHeI
DDSZogang Dongda Mountain (Tibet)40.48%1.40481.24430.14250.2132
CDQamdo (Tibet)32.14%1.32141.21290.12190.1800
JZWSLitang Jianziwan Mountain (Sichuan Province)48.81%1.48811.26830.16030.2436
SJLSShergyla Mountain (Tibet)30.95%1.30951.17140.10260.1556
YSYushu (Qinghai Province)28.57%1.28571.18220.10430.1549
CSCangshan Mountain (Yunnan Province)28.57%1.28571.14240.08740.1352
BMXSBaima Snow Mountain (Yunnan Province)30.95%1.30951.19110.11190.1672
BYQBayan Har Mountain (Qinghai Province)26.19%1.26191.18680.10430.1523
YLXSYulong Snow Mountain (Yunnan Province)25.00%1.25001.12540.07790.1206
HYHongyuan (Sichuan Province)23.81%1.23811.13850.08170.1233
BLSXiaojin Balang Mountain (Sichuan Province)28.57%1.28571.17910.10510.1565
DRDari (Qinghai Province)22.62%1.22621.13000.07790.1177
NMCNamtso (Tibet)27.38%1.27381.14570.08790.1342
BMBomi Tianchi (Tibet)5.95%1.05951.03970.02260.0334
MDKMaidika (Tibet)17.86%1.17861.09890.05990.0911
QJYSYaoshan Mountain (Yunnan Province)11.90%1.11901.06340.03810.0583
Mean 12.08%
(±0.16)
1.1208
(±0.13)
1.0657
(±0.06)
0.0399
(±0.12)
0.0610
(±0.05)
Total 91.67%1.91671.50370.29890.4514
Table 3. Genetic differences among the 16 populations of M. integrifolia using AMOVA analysis.
Table 3. Genetic differences among the 16 populations of M. integrifolia using AMOVA analysis.
Degrees of
Freedom
Sum of Squares of
Deviations
Variance
Component
Variation
Ratio
p Value
Among populations151551.6848.5326163.39%<0.001
Within populations169832.9324.9285936.61%<0.001
Table 4. SSR primer characteristics used for genetic diversity analysis.
Table 4. SSR primer characteristics used for genetic diversity analysis.
NumberPrimer Sequences (5′-3′)Repeat MotifTmSize
P5TTGCCTTGAAATTGAACATTCTT(ATT)559.997148
AAGCAAACCCAAGATAAAACACA
P11TATGGATATGGAATTGGAATTGG(TGC)659.769157
AGACTTCGACCTAACACGCTTTT
P14TCATTCACTGCTAGTACTCCAACTC(TCA)659.037135
TGATGCTGAGAGTTTCTGTTTGA
P17TTTGGTTCCTTCTCCTCCTCTTA(TC)760.567151
GATTGATGAACTGAAAAGCATCC
P20AGCAACAACAACATCAACATCAG(GGT)560.088132
GCATGTTAGACTGAGATGGAAGG
P23ATGTCTCTGGAGTAATGGGTGTG(TA)660.295142
CCGACAATGAAATGTAAAACCAT
P24GGTGAGAAGGGAGGATTTATGTC(GGT)660.196140
ACTTCAGTAGTCAATCCGAACCC
P27AACACATGTAGCAATCTCGTCCT(TCA)560.075145
GTTTCCTGGTTTTCTCATGGTT
P29GGTTTCTGCTCTTTGCTTCAGTA(AT)760.069155
CACAACCCAACTAGAAAGACCAC
P30GAAAACAACACAAGAATCACCGT(CAC)560.309145
GTTGACGTCTTCTTCTTCGTCTC
P31GTTGTCGATGATGAAAATGATTG(ATG)659.333143
GCTAAAGACACCTTTTGAAGCAA
P37TGTAGGTAATAGCAGAGCCATTG(TCT)558.492151
CTTGGGTAGTGCTTGATATGTCG
P40GTTACCCAACCATCGGTAGTTCA(TGC)562.175140
GCTCGAGTTAATACATCCTCACG
P42ACTTTGCTAGGGAATGTCCAGAT(GTG)560.373148
TTATGGTCTCCATTACGATCACC
P57CTTGAAAAGACGACTACACCCTTA(TA)658.929140
CCTCAAGAGACTAGTCGGGAACT
P58TTCATGAATGAGGATGTGTATGC(CAA)559.843156
AGAGAATGAGGATTGCATTACGA
P65CAAACATCAGTTTCCAACAACAA(AAC)559.927160
GTTTACATTACCCGGAAGATGCT
P69CTTCTTCTTCGGCAATTGAAAAT(AAT)560.898138
TACCAACACATCCTCTTACCGTT
P76CGAAGAATTAAGTGATGGAGAGG(GAG)559.273157
TTAGGGCAACAGTGAATTTTGAT
P84AGAGATCATAGTTACAACCGCCA(GTG)560.035139
CCTTGCAGTAAACCCTAACTGTG
P91GCTTATATGAAGATGCAACGAGG(ACA)660.128138
CATTGTTTGACATTGAAAATGGA
P94TGGTGGTGGAGTAGGAGTTAGAG(ATC)559.685160
TTGAAGAGCAAGAGAAAGTCCAG
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Wu, J.; Yang, Q.; Zhao, W.; Miao, X.; Qin, Y.; Qu, Y.; Zheng, P. Assessment of Population Genetic Diversity of Medicinal Meconopsis integrifolia (Maxim.) Franch. Using Newly Developed SSR Markers. Plants 2024, 13, 2561. https://doi.org/10.3390/plants13182561

AMA Style

Wu J, Yang Q, Zhao W, Miao X, Qin Y, Qu Y, Zheng P. Assessment of Population Genetic Diversity of Medicinal Meconopsis integrifolia (Maxim.) Franch. Using Newly Developed SSR Markers. Plants. 2024; 13(18):2561. https://doi.org/10.3390/plants13182561

Chicago/Turabian Style

Wu, Jiahao, Quanyin Yang, Wanyue Zhao, Xue Miao, Yuan Qin, Yan Qu, and Ping Zheng. 2024. "Assessment of Population Genetic Diversity of Medicinal Meconopsis integrifolia (Maxim.) Franch. Using Newly Developed SSR Markers" Plants 13, no. 18: 2561. https://doi.org/10.3390/plants13182561

APA Style

Wu, J., Yang, Q., Zhao, W., Miao, X., Qin, Y., Qu, Y., & Zheng, P. (2024). Assessment of Population Genetic Diversity of Medicinal Meconopsis integrifolia (Maxim.) Franch. Using Newly Developed SSR Markers. Plants, 13(18), 2561. https://doi.org/10.3390/plants13182561

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop