Mapping and Candidate Gene Analysis of an All-Stage Stem Rust Resistance Gene in Durum Wheat Landrace PI 94701
Abstract
1. Introduction
2. Results
2.1. Characterization of Stem Rust Resistance in Durum Wheat Accession PI 94701
2.2. Genetic Mapping of SrPI94701 on Chromosome Arm 5BL
2.3. Candidate Genes for SrPI94701 within Tetraploid and Hexaploid Wheat Genomes
2.4. Identification of Differentially Expressed Genes (DEGs) Within the SrPI94701 Mapping Interval
2.5. Validation of SrPI94701-Linked Markers in Uncharacterized Wheat Accessions
3. Discussion
4. Materials and Methods
4.1. Plant Materials and Mapping Populations
4.2. Evaluation for Stem Rust Resistance
4.3. Bulked Segregant RNA-Seq (BSR-Seq) Analysis
4.4. Development of PCR Markers
4.5. qRT-PCR Analysis
4.6. Statistical Analyses
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Cao, Y.; Yao, P.; Wu, Y.; Bi, Y.; Yang, J. Discovery and verification of an important inoculum source for Puccinia graminis f. sp. tritici in China. Plant Prot. 2001, 28, 294–298. [Google Scholar]
- Saari, E.E.; Prescott, J. World distribution in relation to economic losses. In Diseases, Distribution, Epidemiology, and Control; Elsevier: Amsterdam, The Netherlands, 1985; pp. 259–298. [Google Scholar]
- Amulaka, F.; Maling’a, J.; Pathak, R.; Cakir, M.; Mulwa, R. Yield evaluation of a wheat line with combined resistance to Russian wheat aphid and stem rust race “Ug99” in Kenya. Am. J. Plant Sci. 2013, 4, 1494–1499. [Google Scholar] [CrossRef]
- Singh, R.P.; Hodson, D.P.; Huerta-Espino, J.; Jin, Y.; Bhavani, S.; Njau, P.; Herrera-Foessel, S.; Singh, P.K.; Singh, S.; Govindan, V. The emergence of Ug99 races of the stem rust fungus is a threat to world wheat production. Annu. Rev. Phytopathol. 2011, 49, 465–481. [Google Scholar] [CrossRef]
- Singh, R.P.; Hodson, D.P.; Jin, Y.; Lagudah, E.S.; Ayliffe, M.A.; Bhavani, S.; Rouse, M.N.; Pretorius, Z.A.; Szabo, L.J.; Huerta-Espino, J.; et al. Emergence and spread of new races of wheat stem rust fungus: Continued threat to food security and prospects of genetic control. Phytopathology 2015, 105, 872–884. [Google Scholar] [CrossRef]
- Pretorius, Z.A.; Singh, R.P.; Wagoire, W.W.; Payne, T.S. Detection of virulence to wheat stem rust resistance gene Sr31 in Puccinia graminis f. sp. tritici in Uganda. Plant Dis. 2000, 84, 203. [Google Scholar] [CrossRef]
- Jin, Y.; Szabo, L.J.; Pretorius, Z.A.; Singh, R.P.; Ward, R.; Fetch, T. Detection of virulence to resistance gene Sr24 within race TTKS of Puccinia graminis f. sp tritici. Plant Dis. 2008, 92, 923–926. [Google Scholar] [CrossRef]
- Jin, Y.; Szabo, L.J.; Rouse, M.N.; Fetch, T.; Pretorius, Z.A.; Wanyera, R.; Njau, P. Detection of virulence to resistance gene Sr36 within the TTKS race lineage of Puccinia graminis f. sp tritici. Plant Dis. 2009, 93, 367–370. [Google Scholar] [CrossRef]
- Newcomb, M.; Rouse, O.M.N.; Rouse, M.N.; Szabo, L.J.; Johnson, J.; Gale, S.; Luster, D.G.; Wanyera, R.; Macharia, G.; Bhavani, S.; et al. Kenyan Isolates of Puccinia graminis f. sp tritici from 2008 to 2014: Virulence to SrTmp in the Ug99 race group and implications for breeding programs. Phytopathology 2016, 106, 729–736. [Google Scholar] [CrossRef]
- Patpour, M.; Hovmøller, M.; Shahin, A.; Newcomb, M.; Olivera, P.; Jin, Y.; Luster, D.; Hodson, D.; Nazari, K.; Azab, M. First report of the Ug99 race group of wheat stem rust, Puccinia graminis f. sp. tritici, in Egypt in 2014. Plant Dis. 2016, 100, 863. [Google Scholar]
- Terefe, T.G.; Boshoff, W.H.; Park, R.F.; Pretorius, Z.A.; Visser, B. Wheat stem rust surveillance reveals two new races of Puccinia graminis f. sp. tritici in South Africa during 2016 to 2020. Plant Dis. 2024, 108, 20–29. [Google Scholar]
- Patpour, M.; Justesen, A.F.; Hovmøller, M.S.; Baidya, S.; Thapa, D.; Basnet, R. First report of Ug99 wheat stem rust (Puccinia graminis f. sp. tritici) in South Asia. Plant Dis. 2024. [Google Scholar] [CrossRef]
- Olivera, P.; Jin, Y.; Rouse, M.; Badebo, A.; Fetch, T., Jr.; Singh, R.; Yahyaoui, A. Races of Puccinia graminis f. sp. tritici with combined virulence to Sr13 and Sr9e in a field stem rust screening nursery in Ethiopia. Plant Dis. 2012, 96, 623–628. [Google Scholar]
- Zhang, W.; Chen, S.; Abate, Z.; Nirmala, J.; Rouse, M.N.; Dubcovsky, J. Identification and characterization of Sr13, a tetraploid wheat gene that confers resistance to the Ug99 stem rust race group. Proc. Natl. Acad. Sci. USA 2017, 114, E9483–E9492. [Google Scholar] [CrossRef]
- Olivera, P.; Newcomb, M.; Szabo, L.J.; Rouse, M.; Johnson, J.; Gale, S.; Luster, D.G.; Hodson, D.; Cox, J.A.; Burgin, L. Phenotypic and genotypic characterization of race TKTTF of Puccinia graminis f. sp. tritici that caused a wheat stem rust epidemic in southern Ethiopia in 2013–14. Phytopathology 2015, 105, 917–928. [Google Scholar] [CrossRef]
- Lewis, C.M.; Persoons, A.; Bebber, D.P.; Kigathi, R.N.; Maintz, J.; Findlay, K.; Bueno-Sancho, V.; Corredor-Moreno, P.; Harrington, S.A.; Kangara, N. Potential for re-emergence of wheat stem rust in the United Kingdom. Commun. Biol. 2018, 1, 13. [Google Scholar] [CrossRef]
- Patpour, M.; Hovmoller, M.; Hansen, J.; Justesen, A.; Thach, T.; Rodriguez-Algaba, J.; Hodson, D.; Randazo, B. Epidemics of yellow rust and stem rust in Southern Italy 2016–2017. In Proceedings of the BGRI 2018 Technical Workshop, Marrakech, Morocco, 14–17 April 2018; Available online: https://www.globalrust.org/content/epidemics–yellow-and-stem-rust-southern-italy-2016-2017 (accessed on 15 May 2024).
- Fetch, T.; Zegeye, T.; Park, R.; Hodson, D.; Wanyera, R. Detection of wheat stem rust races TTHSK and PTKTK in the Ug99 race group in Kenya in 2014. Plant Dis. 2016, 100, 1495. [Google Scholar] [CrossRef]
- Li, H.; Luo, J.; Zhang, W.; Hua, L.; Li, K.; Wang, J.; Xu, B.; Yang, C.; Wang, G.; Rouse, M.N. High-resolution mapping of SrTm4, a recessive resistance gene to wheat stem rust. Theor. Appl. Genet. 2023, 136, 120. [Google Scholar] [CrossRef]
- Olivera, P.; Szabo, L.J.; Kokhmetova, A.; Morgounov, A.; Luster, D.; Jin, Y. Puccinia graminis f. sp. tritici population causing recent wheat stem rust epidemics in Kazakhstan is highly diverse and includes novel virulence pathotypes. Phytopathology 2022, 112, 2403–2415. [Google Scholar] [CrossRef]
- Sharma, J.S.; Che, M.; Fetch, T.; McCallum, B.D.; Xu, S.S.; Hiebert, C.W. Identification of Sr67, a new gene for stem rust resistance in KU168-2 located close to the Sr13 locus in wheat. Theor. Appl. Genet. 2024, 137, 30. [Google Scholar] [CrossRef]
- Chen, S.; Guo, Y.; Briggs, J.; Dubach, F.; Chao, S.; Zhang, W.; Rouse, M.N.; Dubcovsky, J. Mapping and characterization of wheat stem rust resistance genes SrTm5 and Sr60 from Triticum monococcum. Theor. Appl. Genet. 2018, 131, 625–635. [Google Scholar] [CrossRef] [PubMed]
- Nirmala, J.; Saini, J.; Newcomb, M.; Olivera, P.; Gale, S.; Klindworth, D.; Elias, E.; Talbert, L.; Chao, S.; Faris, J. Discovery of a novel stem rust resistance allele in durum wheat that exhibits differential reactions to Ug99 isolates. G3 Genes Genomes Genet. 2017, 7, 3481–3490. [Google Scholar] [CrossRef] [PubMed]
- Gill, B.K.; Klindworth, D.L.; Rouse, M.N.; Zhang, J.; Zhang, Q.; Sharma, J.S.; Chu, C.; Long, Y.; Chao, S.; Olivera, P.D. Function and evolution of allelic variations of Sr13 conferring resistance to stem rust in tetraploid wheat (Triticum turgidum L.). Plant J. 2021, 106, 1674–1691. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.; Nirmala, J.; Chen, S.; Jost, M.; Steuernagel, B.; Karafiatova, M.; Hewitt, T.; Li, H.; Edae, E.; Sharma, K. Single amino acid change alters specificity of the multi-allelic wheat stem rust resistance locus SR9. Nat. Commun. 2023, 14, 7354. [Google Scholar] [CrossRef] [PubMed]
- Yu, L.-X.; Barbier, H.; Rouse, M.N.; Singh, S.; Singh, R.P.; Bhavani, S.; Huerta-Espino, J.; Sorrells, M.E. A consensus map for Ug99 stem rust resistance loci in wheat. Theor. Appl. Genet. 2014, 127, 1561–1581. [Google Scholar] [CrossRef] [PubMed]
- Bariana, H.S.; Hayden, M.J.; Ahmed, N.; Bell, J.; Sharp, P.; McIntosh, R. Mapping of durable adult plant and seedling resistances to stripe rust and stem rust diseases in wheat. Aust. J. Agric. Res. 2001, 52, 1247–1255. [Google Scholar] [CrossRef]
- Rondon, M.; Gough, F.; Williams, N.D. Inheritance of stem rust resistance in Triticum aestivum ssp. vulgare ‘Reliance’and PI 94701 of Triticum durum 1. Crop Sci. 1966, 6, 177–179. [Google Scholar] [CrossRef]
- Chen, S.; Hegarty, J.; Shen, T.; Hua, L.; Li, H.; Luo, J.; Li, H.; Bai, S.; Zhang, C.; Dubcovsky, J. Stripe rust resistance gene Yr34 (synonym Yr48) is located within a distal translocation of Triticum monococcum chromosome 5AmL into common wheat. Theor. Appl. Genet. 2021, 134, 2197–2211. [Google Scholar] [CrossRef] [PubMed]
- Takagi, H.; Abe, A.; Yoshida, K.; Kosugi, S.; Natsume, S.; Mitsuoka, C.; Uemura, A.; Utsushi, H.; Tamiru, M.; Takuno, S. QTL-seq: Rapid mapping of quantitative trait loci in rice by whole genome resequencing of DNA from two bulked populations. Plant J. 2013, 74, 174–183. [Google Scholar] [CrossRef]
- Voorrips, R. MapChart: Software for the graphical presentation of linkage maps and QTLs. J. Hered. 2002, 93, 77–78. [Google Scholar] [CrossRef]
- Ellis, J.; Dodds, P.; Pryor, T. Structure, function and evolution of plant disease resistance genes. Curr. Opin. Plant Biol. 2000, 3, 278–284. [Google Scholar] [CrossRef]
- Li, H.; Hua, L.; Zhao, S.; Hao, M.; Song, R.; Pang, S.; Liu, Y.; Chen, H.; Zhang, W.; Shen, T.; et al. Cloning of the wheat leaf rust resistance gene Lr47 introgressed from Aegilops speltoides. Nat. Commun. 2023, 14, 6072. [Google Scholar] [CrossRef] [PubMed]
- Marone, D.; Russo, M.A.; Laidò, G.; De Leonardis, A.M.; Mastrangelo, A.M. Plant nucleotide binding site-leucine-rich repeat (NBS-LRR) genes: Active guardians in host defense responses. Int. J. Mol. Sci. 2013, 14, 7302–7326. [Google Scholar] [CrossRef] [PubMed]
- Chen, S.; Rouse, M.N.; Zhang, W.; Zhang, X.; Guo, Y.; Briggs, J.; Dubcovsky, J. Wheat gene Sr60 encodes a protein with two putative kinase domains that confers resistance to stem rust. New Phytol. 2020, 225, 948–959. [Google Scholar] [CrossRef] [PubMed]
- Fu, D.; Uauy, C.; Distelfeld, A.; Blechl, A.; Epstein, L.; Chen, X.; Sela, H.; Fahima, T.; Dubcovsky, J. A kinase-START gene confers temperature-dependent resistance to wheat stripe rust. Science 2009, 323, 1357–1360. [Google Scholar] [CrossRef] [PubMed]
- Martin, G.B.; Brommonschenkel, S.H.; Chunwongse, J.; Frary, A.; Ganal, M.W.; Spivey, R.; Wu, T.; Earle, E.D.; Tanksley, S.D. Map-based cloning of a protein kinase gene conferring disease resistance in tomato. Science 1993, 262, 1432–1436. [Google Scholar] [CrossRef] [PubMed]
- Hurni, S.; Scheuermann, D.; Krattinger, S.G.; Kessel, B.; Wicker, T.; Herren, G.; Fitze, M.N.; Breen, J.; Presterl, T.; Ouzunova, M.; et al. The maize disease resistance gene Htn1 against northern corn leaf blight encodes a wall-associated receptor-like kinase. Proc. Natl. Acad. Sci. USA 2015, 112, 8780–8785. [Google Scholar] [CrossRef] [PubMed]
- Klymiuk, V.; Yaniv, E.; Huang, L.; Raats, D.; Fatiukha, A.; Chen, S.; Feng, L.; Frenkel, Z.; Krugman, T.; Lidzbarsky, G. Cloning of the wheat Yr15 resistance gene sheds light on the plant tandem kinase-pseudokinase family. Nat. Commun. 2018, 9, 3735. [Google Scholar] [CrossRef]
- Heermann, R.; Smith, G.; Briggle, L.; Schwilghamer, E. Inheritance of reaction to stem rust in certain durum and emmer wheats. In Proceedings of the Report of the Third International Wheat Rust Conference, Mexico City, Mexico, 18–24 March 1956; pp. 82–83. [Google Scholar]
- Chen, S.; Zhang, W.; Bolus, S.; Rouse, M.N.; Dubcovsky, J. Identification and characterization of wheat stem rust resistance gene Sr21 effective against the Ug99 race group at high temperature. PLoS Genet. 2018, 14, e1007287. [Google Scholar] [CrossRef]
- Li, H.; Hua, L.; Rouse, M.N.; Li, T.; Pang, S.; Bai, S.; Shen, T.; Luo, J.; Li, H.; Zhang, W. Mapping and characterization of a wheat stem rust resistance gene in durum wheat “Kronos”. Front. Plant Sci. 2021, 12, 751398. [Google Scholar] [CrossRef]
- Liu, Y.; Hou, S.; Chen, S. Kinase fusion proteins: Intracellular R-proteins in plant immunity. Trends Plant Sci 2023, 29, 278–282. [Google Scholar] [CrossRef]
- Brueggeman, R.; Rostoks, N.; Kudrna, D.; Kilian, A.; Han, F.; Chen, J.; Druka, A.; Steffenson, B.; Kleinhofs, A. The barley stem rust-resistance gene Rpg1 is a novel disease-resistance gene with homology to receptor kinases. Proc. Natl. Acad. Sci. USA 2002, 99, 9328–9333. [Google Scholar] [CrossRef] [PubMed]
- Yu, G.; Matny, O.; Champouret, N.; Steuernagel, B.; Moscou, M.J.; Hernández-Pinzón, I.; Green, P.; Hayta, S.; Smedley, M.; Harwood, W.; et al. Aegilops sharonensis genome-assisted identification of stem rust resistance gene Sr62. Nat. Commun. 2022, 13, 1607. [Google Scholar] [CrossRef] [PubMed]
- Yu, G.; Matny, O.; Gourdoupis, S.; Rayapuram, N.; Aljedaani, F.R.; Wang, Y.L.; Nürnberger, T.; Johnson, R.; Crean, E.E.; Saur, I.M.-L. The wheat stem rust resistance gene Sr43 encodes an unusual protein kinase. Nat. Genet. 2023, 55, 921–926. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Abrouk, M.; Gourdoupis, S.; Koo, D.-H.; Karafiátová, M.; Molnár, I.; Holušová, K.; Doležel, J.; Athiyannan, N.; Cavalet-Giorsa, E. An unusual tandem kinase fusion protein confers leaf rust resistance in wheat. Nat. Genet. 2023, 55, 914–920. [Google Scholar] [CrossRef] [PubMed]
- Bansal, U.K.; Muhammad, S.; Forrest, K.L.; Hayden, M.J.; Bariana, H.S. Mapping of a new stem rust resistance gene Sr49 in chromosome 5B of wheat. Theor. Appl. Genet. 2015, 128, 2113–2119. [Google Scholar] [CrossRef] [PubMed]
- Bansal, U.; Bariana, H.; Wong, D.; Randhawa, M.; Wicker, T.; Hayden, M.; Keller, B. Molecular mapping of an adult plant stem rust resistance gene Sr56 in winter wheat cultivar Arina. Theor. Appl. Genet. 2014, 127, 1441–1448. [Google Scholar] [CrossRef] [PubMed]
- Megerssa, S.H.; Ammar, K.; Acevedo, M.; Brown-Guedira, G.; Ward, B.; Degete, A.G.; Randhawa, M.S.; Sorrells, M.E. Multiple-race stem rust resistance loci identified in durum wheat using genome-wide association mapping. Front. Plant Sci. 2020, 11, 1934. [Google Scholar] [CrossRef]
- Saintenac, C.; Zhang, W.; Salcedo, A.; Rouse, M.N.; Trick, H.N.; Akhunov, E.; Dubcovsky, J. Identifcation of wheat gene Sr35 that confers resistance to Ug99 stem rust race group. Science 2013, 341, 783–786. [Google Scholar] [CrossRef] [PubMed]
- Luo, J.; Rouse, M.N.; Hua, L.; Li, H.; Li, B.; Li, T.; Zhang, W.; Gao, C.; Wang, Y.; Dubcovsky, J. Identification and characterization of Sr22b, a new allele of the wheat stem rust resistance gene Sr22 effective against the Ug99 race group. Plant Biotechnol. J. 2022, 20, 554–563. [Google Scholar] [CrossRef] [PubMed]
- Steuernagel, B.; Periyannan, S.K.; Hernández-Pinzón, I.; Witek, K.; Rouse, M.N.; Yu, G.; Hatta, A.; Ayliffe, M.; Bariana, H.; Jones, J.D.G.; et al. Rapid cloning of disease-resistance genes in plants using mutagenesis and sequence capture. Nat. Biotechnol. 2016, 34, 652–655. [Google Scholar] [CrossRef]
- Zhang, J.; Hewitt, T.C.; Boshoff, W.H.; Dundas, I.; Upadhyaya, N.; Li, J.; Patpour, M.; Chandramohan, S.; Pretorius, Z.A.; Hovmøller, M. A recombined Sr26 and Sr61 disease resistance gene stack in wheat encodes unrelated NLR genes. Nat. Commun. 2021, 12, 3378. [Google Scholar] [CrossRef] [PubMed]
- Klindworth, D.; Miller, J.; Xu, S. Registration of Rusty durum wheat. Crop Sci. 2006, 46, 1012–1014. [Google Scholar] [CrossRef]
- Chen, S.; Rouse, M.N.; Zhang, W.; Jin, Y.; Akhunov, E.; Wei, Y.; Dubcovsky, J. Fine mapping and characterization of Sr21, a temperature-sensitive diploid wheat resistance gene effective against the Puccinia graminis f. sp. tritici Ug99 race group. Theor. Appl. Genet. 2015, 128, 645–656. [Google Scholar] [CrossRef] [PubMed]
- Rouse, M.; Jin, Y. Genetics of resistance to race TTKSK of Puccinia graminis f. sp. tritici in Triticum monococcum. Phytopathology 2011, 101, 1418–1423. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.; Li, H.; Shen, T.; Lyu, S.; ur Rehman, S.; Li, H.; Wang, G.; Xu, B.; Wang, Q.; Hu, W.; et al. High-resolution genetic mapping and identification of candidate genes for the wheat stem rust resistance gene Sr8155B1. Crop J. 2023, 11, 1852–1861. [Google Scholar] [CrossRef]
- Stakman, E.C.; Stewart, D.M.; Loegering, W.Q. Identification of Physiologic Races of Puccinia graminis var. tritici; United States Department of Agriculture, Agricultural Research Service: Washington, DC, USA, 1962.
- Bolger, A.M.; Lohse, M.; Usadel, B. Trimmomatic: A flexible trimmer for Illumina sequence data. Bioinformatics 2014, 30, 2114–2120. [Google Scholar] [CrossRef]
- Maccaferri, M.; Harris, N.S.; Twardziok, S.O.; Pasam, R.K.; Gundlach, H.; Spannagl, M.; Ormanbekova, D.; Lux, T.; Prade, V.M.; Milner, S.G.; et al. Durum wheat genome highlights past domestication signatures and future improvement targets. Nat. Genet. 2019, 51, 885–895. [Google Scholar] [CrossRef]
- Dobin, A.; Davis, C.A.; Schlesinger, F.; Drenkow, J.; Zaleski, C.; Jha, S.; Batut, P.; Chaisson, M.; Gingeras, T.R. STAR: Ultrafast universal RNA-seq aligner. Bioinformatics 2013, 29, 15–21. [Google Scholar] [CrossRef]
- McKenna, A.; Hanna, M.; Banks, E.; Sivachenko, A.; Cibulskis, K.; Kernytsky, A.; Garimella, K.; Altshuler, D.; Gabriel, S.; Daly, M.; et al. The Genome Analysis Toolkit: A MapReduce framework for analyzing next-generation DNA sequencing data. Genome Res. 2010, 20, 1297–1303. [Google Scholar] [CrossRef]
- Bai, S.; Wang, G.; Song, R.; Liu, Y.; Hua, L.; Yang, J.; Zhang, L.; ur Rehman, S.; Hao, X.; Hou, L.; et al. Mutations in wheat TaAPA2 gene result in pleiotropic effects on plant architecture. Sci. China Life Sci. 2024. [Google Scholar] [CrossRef]
- Sun, M.; Liu, Q.; Han, Y.; Liu, G.; Wu, J.; Qi, J.; Ni, F.; Bao, Y. PmSN15218: A potential new powdery mildew resistance gene on wheat chromosome 2AL. Front. Plant Sci. 2022, 13, 931778. [Google Scholar] [CrossRef] [PubMed]
- Konieczny, A.; Ausubel, F.M. A procedure for mapping Arabidopsis mutations using co-dominant ecotype-specific PCR-based markers. Plant J. 1993, 4, 403–410. [Google Scholar] [CrossRef] [PubMed]
- Robinson, M.D.; McCarthy, D.J.; Smyth, G.K. edgeR: A Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics 2010, 26, 139–140. [Google Scholar] [CrossRef] [PubMed]
- Singh, R.; Huerta-Espino, J.; Rajaram, S. Achieving near-immunity to leaf and stripe rusts in wheat by combining slow rusting resistance genes. Acta Phytopathol. Entomol. Hung. 2000, 35, 133–139. [Google Scholar]
Markers | Marker Type | Forward Primer (5′-3′) | Reverse Primer (5′-3′) | Enzyme | Expected Size (bp) | Ann. T. (°C) |
---|---|---|---|---|---|---|
pku68299 | CAPS | GGTTTTAGTGCTGCACCTGGAC | GGCTCTCAGTTCTCTTCTGCACC | HphI | 337 | 63 |
pku68425 | CAPS | ACAGACCCCCTTAAGCCTTTTTCTT | AGGGGAGATGTGTGTTGCTTTGTGT | BssHII | 441 | 60 |
pku68823 | CAPS | ACTCCTACGGATCAAATTATCACCTT | GCACGGACATCTTGCTAGTAAGAG | ApoI | 473 | 56 |
pku69013 | CAPS | CATAATCTTGACGATCCAGGGAC | TATATGCAGGCTATTACTGCTGTGG | HaeIII | 609 | 58 |
pku69020 | CAPS | CCAGTTTTTATCGTCCAAATCTAGAG | ATCCATAGGTAGCTGCACATGT | HaeIII | 511 | 54 |
pku69118 | CAPS | GTATGAAACCGCGAACACTTTACA | CGGGTTTCCAAATTTTGTTCTTGAG | XmnI | 394 | 57 |
pku69119 | CAPS | GGAATTTCACATTTGTTCCCAATC | CGGAGATCGTCAACATCTC | HhaI | 394 | 55 |
pku69124 | CAPS | TCTTTGTATTAAGAGTTTGCACAGCT | GCAGATTTCACATACTCAACCATC | SspI | 376 | 57 |
pku69187 | CAPS | GCGCTGATGAAGATAATCTCAT | CGGAGGGAGTACTAGATTATCATG | BbvCI | 526 | 57 |
pku69211 | CAPS | ATTTGTGTTCATCGATCAAAACAC | TAGTAAGATAAACTCTTGCCTCCTTC | HpyCH4IV | 376 | 52 |
pku69227 | CAPS | GGCACCTTTAAAATAATACACGGA | AATGAGTTTGTTGTACCAAGTGCAG | PvuII | 354 | 55 |
pku69228 | CAPS | CCTTCCCTACGGATATGTTTTTAGA | AGAAGTTGGAAGGGTAGATCATCACC | Hpy188III | 386 | 55 |
pku69231 | CAPS | TGACACTTTCCACTCACTCCTAGG | ATTTGGCACGTTGACCTTAACT | BtgI | 340 | 56 |
pku69264 | CAPS | AAATTCTATCAACACTTGAAGAGAA | CCAACCAACTATCATTTAGAAGT | BstUI | 503 | 52 |
pku69384 | CAPS | ACTCCTTCACGCTTCTCGACA | AAATTTCCTGGGTGAGCCATT | BanI | 496 | 56 |
pku69400 | CAPS | GGTGGTGGAGAACATGCATGC | ATGGCGATGACCGTGCAAGG | MspI | 336 | 60 |
pku69560 | CAPS | CGTGGTCCGTTTCTCAGAAGA | CGGGAACAGAAGACACACTATATTT | BfuAI | 350 | 56 |
pku69883 | CAPS | GTTCATGTTGTTGAGAAGCTAGAC | CACCTTACAAACAAGTGGTCAAC | BsmAI | 600 | 55 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, H.; Li, K.; Li, H.; Yang, C.; Perera, G.; Wang, G.; Lyu, S.; Hua, L.; Rehman, S.u.; Zhang, Y.; et al. Mapping and Candidate Gene Analysis of an All-Stage Stem Rust Resistance Gene in Durum Wheat Landrace PI 94701. Plants 2024, 13, 2197. https://doi.org/10.3390/plants13162197
Li H, Li K, Li H, Yang C, Perera G, Wang G, Lyu S, Hua L, Rehman Su, Zhang Y, et al. Mapping and Candidate Gene Analysis of an All-Stage Stem Rust Resistance Gene in Durum Wheat Landrace PI 94701. Plants. 2024; 13(16):2197. https://doi.org/10.3390/plants13162197
Chicago/Turabian StyleLi, Hongyu, Kairong Li, Hongna Li, Chen Yang, Geetha Perera, Guiping Wang, Shikai Lyu, Lei Hua, Shams ur Rehman, Yazhou Zhang, and et al. 2024. "Mapping and Candidate Gene Analysis of an All-Stage Stem Rust Resistance Gene in Durum Wheat Landrace PI 94701" Plants 13, no. 16: 2197. https://doi.org/10.3390/plants13162197
APA StyleLi, H., Li, K., Li, H., Yang, C., Perera, G., Wang, G., Lyu, S., Hua, L., Rehman, S. u., Zhang, Y., Ayliffe, M., Yu, H., & Chen, S. (2024). Mapping and Candidate Gene Analysis of an All-Stage Stem Rust Resistance Gene in Durum Wheat Landrace PI 94701. Plants, 13(16), 2197. https://doi.org/10.3390/plants13162197