Development of Chloroplast Microsatellite Markers and Evaluation of Genetic Diversity and Population Structure of Cutleaf Groundcherry (Physalis angulata L.) in China
Abstract
:1. Introduction
2. Results
2.1. Characterization of the Developed cpSSR Markers
2.2. CpSSR Analysis
2.3. Genetic Diversity Analysis
2.4. Genetic Differentiation and Gene Flow
2.5. Genetic Relationships
2.6. Population Structure
3. Discussion
4. Materials and Methods
4.1. Plant Materials and DNA Extraction
4.2. CpSSR Marker Development
4.3. CpSSR Analysis
4.4. Data Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Feng, S.; Jiang, M.; Shi, Y.; Jiao, K.; Shen, C.; Lu, J.; Ying, Q.; Wang, H. Application of the ribosomal DNA ITS2 region of Physalis (Solanaceae): DNA barcoding and phylogenetic study. Front. Plant Sci. 2016, 7, 1047. [Google Scholar] [CrossRef] [PubMed]
- Zhan, X.; Liao, X.; Luo, X.; Zhu, Y.; Feng, S.; Yu, C.; Lu, J.; Shen, C.; Wang, H. Comparative metabolomic and proteomic analyses reveal the regulation mechanism underlying MeJA-induced bioactive compound accumulation in cutleaf groundcherry (Physalis angulata L.) hairy roots. J. Agric. Food Chem. 2018, 66, 6336–6347. [Google Scholar] [CrossRef] [PubMed]
- Ding, H.; Hu, Z.; Yu, L.; Ma, Z.; Ma, X.; Chen, Z.; Wang, D.; Zhao, X. Induction of quinone reductase (QR) by withanolides isolated from Physalis angulata L. var. villosa Bonati (Solanaceae). Steroids 2014, 86, 32–38. [Google Scholar] [CrossRef] [PubMed]
- Zhan, X.; Zhang, Z.; Zhang, Y.; Gao, Y.; Jin, Y.; Shen, C.; Wang, H.; Feng, S. Complete plastome of Physalis angulata var. villosa, Gene organization, comparative genomics and phylogenetic relationships among Solanaceae. Genes 2022, 13, 2291. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Z.; Jin, Y.; Gao, Y.; Zhang, Y.; Ying, Q.; Shen, C.; Lu, J.; Zhan, X.; Wang, H.; Feng, S. The complete chloroplast genomes of two Physalis species, Physalis macrophysa and P. ixocarpa: Comparative genomics, evolutionary dynamics and phylogenetic relationships. Agronomy 2023, 13, 135. [Google Scholar] [CrossRef]
- Daltro, S.R.T.; Santos, I.P.; Barros, P.L.; Moreira, D.R.M.; Tomassini, T.C.B.; Ribeiro, I.M.; Ribeiro Dos Santos, R.; Meira, C.S.; Soares, M.B.P. In vitro and in vivo immunomodulatory activity of Physalis angulata concentrated ethanolic extract. Planta. Med. 2021, 87, 160–168. [Google Scholar] [CrossRef]
- Sun, C.P.; Kutateladze, A.G.; Zhao, F.; Chen, L.X.; Qiu, F. A novel withanolide with an unprecedented carbon skeleton from Physalis angulata. Org. Biomol. Chem. 2017, 15, 1110–1114. [Google Scholar] [CrossRef]
- Rivera, D.; Ocampo, Y.; Franco, L.A. Physalis angulata calyces modulate macrophage polarization and alleviate chemically induced intestinal inflammation in mice. Biomedicines 2020, 8, 24. [Google Scholar] [CrossRef]
- Wang, L.; Lu, S.; Wang, L.; Xin, M.; Xu, Y.; Wang, G.; Chen, D.; Chen, L.; Liu, S.; Zhao, F. Anti-inflammatory effects of three withanolides isolated from Physalis angulata L. in LPS-activated RAW 264.7 cells through blocking NF-kappaB signaling pathway. J. Ethnopharmacol. 2021, 276, 114186. [Google Scholar] [CrossRef]
- Ramakrishna Pillai, J.; Wali, A.F.; Menezes, G.A.; Rehman, M.U.; Wani, T.A.; Arafah, A.; Zargar, S.; Mir, T.M. Chemical composition analysis, cytotoxic, antimicrobial and antioxidant activities of Physalis angulata L.: A comparative study of leaves and fruit. Molecules 2022, 27, 1480. [Google Scholar] [CrossRef]
- Preet, R.; Gupta, R.C. Quantification of withaferin-A and withanolide-A in diploid (n = 12) and tetraploid cytotypes (n = 24) of “Rassbhary”, Physalis angulata L. Nat. Prod. Res. 2018, 33, 3157–3160. [Google Scholar] [CrossRef] [PubMed]
- Arruda, J.C.C.; Rocha, N.C.; Santos, E.G.; Ferreira, L.G.B.; Bello, M.L.; Penido, C.; Costa, T.; Santos, J.A.A.; Ribeiro, I.M.; Tomassini, T.C.B.; et al. Physalin pool from Physalis angulata L. leaves and physalin D inhibit P2X7 receptor function in vitro and acute lung injury in vivo. Biomed. Pharm. 2021, 142, 112006. [Google Scholar] [CrossRef] [PubMed]
- Feng, S.; Hou, K.; Zhang, H.; Chen, C.; Huang, J.; Wu, Q.; Zhang, Z.; Gao, Y.; Wu, X.; Wang, H.; et al. Investigation of the role of TmMYB16/123 and their targets (TmMTP1/11) in the tolerance of Taxus media to cadmium. Tree Physiol. 2023, tpad019. [Google Scholar] [CrossRef] [PubMed]
- Wang, S.Q. Genetic diversity and population structure of the endangered species Paeonia decomposita endemic to China and implications for its conservation. BMC Plant Biol. 2020, 20, 510. [Google Scholar] [CrossRef]
- Ye, M.R.; Liu, W.; Xue, Q.Y.; Yan, W.J.; Hou, B.W.; Luo, J.; Ding, X.Y. Phylogeography of endangered Dendrobium moniliforme in East Asia based on mitochondrial DNA sequence variations. Biodivers. Conserv. 2017, 26, 1659–1674. [Google Scholar] [CrossRef]
- Tautz, D. Hypervariability of simple sequences as a general source for polymorphic DNA markers. Nucleic. Acids. Res. 1989, 17, 6463–6471. [Google Scholar] [CrossRef]
- Ramu, P.; Billot, C.; Rami, J.F.; Senthilvel, S.; Upadhyaya, H.D.; Ananda Reddy, L.; Hash, C.T. Assessment of genetic diversity in the sorghum reference set using EST-SSR markers. Appl. Genet. 2013, 126, 2051–2064. [Google Scholar] [CrossRef]
- Kumar, R.; Kumar, C.; Paliwal, R.; Roy Choudhury, D.; Singh, I.; Kumar, A.; Kumari, A.; Singh, R. Development of novel genomic simple sequence repeat (g-SSR) markers and their validation for genetic diversity analyses in Kalmegh [Andrographis paniculata (Burm. F.) Nees]. Plants 2020, 9, 1734. [Google Scholar] [CrossRef]
- Tyagi, S.; Kumar, A.; Gautam, T.; Pandey, R.; Rustgi, S.; Mir, R.R. Development and use of miRNA-derived SSR markers for the study of genetic diversity, population structure, and characterization of genotypes for breeding heat tolerant wheat varieties. PLoS ONE 2021, 16, e0231063. [Google Scholar] [CrossRef]
- Sharma, H.; Hyvonen, J.; Poczai, P. Development of chloroplast microsatellite markers for giant ragweed (Ambrosia trifida). Appl. Plant Sci. 2020, 8, e11313. [Google Scholar] [CrossRef]
- Zapiola, M.L.; Cronn, R.C.; Mallory-Smith, C.A. Development of novel chloroplast microsatellite markers to identify species in the Agrostis complex (Poaceae) and related genera. Mol. Ecol. Resour. 2010, 10, 738–740. [Google Scholar] [CrossRef] [PubMed]
- Xiong, Y.; Xiong, Y.; Shu, X.; Yu, Q.; Lei, X.; Li, D.; Yan, J.; Bai, S.; Ma, X. Molecular phylogeography and intraspecific divergences in siberian wildrye (Elymus sibiricus L.) wild populations in China, Inferred From chloroplast DNA sequence and cpSSR Markers. Front. Plant Sci. 2022, 13, 862759. [Google Scholar] [CrossRef] [PubMed]
- Awasthi, P.; Ahmad, I.; Gandhi, S.G.; Bedi, Y.S. Development of chloroplast microsatellite markers for phylogenetic analysis in Brassicaceae. Acta Biol. Hung. 2012, 63, 463–473. [Google Scholar] [CrossRef] [PubMed]
- Phumichai, C.; Phumichai, T.; Wongkaew, A. Novel chloroplast microsatellite (cpSSR) markers for genetic diversity assessment of cultivated and wild Hevea Rubber. Plant Mol. Biol. Rep. 2015, 33, 1486–1498. [Google Scholar] [CrossRef]
- Simbaqueba, J.; Sanchez, P.; Sanchez, E.; Nunez Zarantes, V.M.; Chacon, M.I.; Barrero, L.S.; Marino-Ramirez, L. Development and characterization of microsatellite markers for the Cape gooseberry Physalis peruviana. PLoS ONE 2011, 6, e26719. [Google Scholar] [CrossRef]
- Vargas-Ponce, O.; Perez-Alvarez, L.F.; Zamora-Tavares, P.; Rodriguez, A. Assessing genetic diversity in Mexican Husk tomato species. Plant Mol. Biol. Rep. 2011, 29, 733–738. [Google Scholar] [CrossRef]
- Labate, J.; Robertson, L. Nucleotide diversity estimates of tomatillo (Physalis philadelphica) accessions including nine new inbred lines. Mol. Breed. 2015, 35, 1–10. [Google Scholar] [CrossRef]
- Garzon-Martinez, G.A.; Osorio-Guarin, J.A.; Delgadillo-Duran, P.; Mayorga, F.; Enciso-Rodriguez, F.E.; Landsman, D.; Marino-Ramirez, L.; Barrero, L.S. Genetic diversity and population structure in Physalis peruviana and related taxa based on InDels and SNPs derived from COSII and IRG markers. Plant Gene 2015, 4, 29–37. [Google Scholar] [CrossRef]
- Huang, L.S.; Sun, Y.Q.; Jin, Y.; Gao, Q.; Hu, X.G.; Gao, F.L.; Yang, X.L.; Zhu, J.J.; El-Kassaby, Y.A.; Mao, J.F. Development of high transferability cpSSR markers for individual identification and genetic investigation in Cupressaceae species. Ecol. Evol. 2018, 8, 4967–4977. [Google Scholar] [CrossRef]
- Terrab, A.; Paun, O.; Talavera, S.; Tremetsberger, K.; Arista, M.; Stuessy, T.F. Genetic diversity and population structure in natural populations of Moroccan Atlas cedar (Cedrus atlantica; Pinaceae) determined with cpSSR markers. Am. J. Bot. 2006, 93, 1274–1280. [Google Scholar] [CrossRef]
- He, S.; Yang, Y.; Li, Z.; Wang, X.; Guo, Y.; Wu, H. Comparative analysis of four Zantedeschia chloroplast genomes: Expansion and contraction of the IR region, phylogenetic analyses and SSR genetic diversity assessment. PeerJ 2020, 8, e9132. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.; Liu, Y.H.; Wang, Y.H.; Shen, S.K. Genetic diversity and population structure of Rhododendron rex subsp. rex inferred from microsatellite markers and chloroplast DNA sequences. Plants 2020, 9, 338. [Google Scholar] [CrossRef] [PubMed]
- Ye, J.W.; Li, D.Z. Development of 20 chloroplast microsatellite primers in wuyao (Lindera aggregata, Lauraceae). Appl. Plant Sci. 2019, 7, e01213. [Google Scholar] [CrossRef]
- Xu, M.; Xu, L.A.; Cao, F.L.; Zhang, H.J.; Yu, F.X. Development of novel chloroplast microsatellite markers for Ginkgo biloba. Genet. Mol. Res. 2015, 14, 7715–7720. [Google Scholar] [CrossRef] [PubMed]
- Xue, J.; Wang, S.; Zhou, S.L. Polymorphic chloroplast microsatellite loci in Nelumbo (Nelumbonaceae). Am. J. Bot. 2012, 99, e240–e244. [Google Scholar] [CrossRef] [PubMed]
- Feng, S.; He, R.; Lu, J.; Jiang, M.; Shen, X.; Jiang, Y.; Wang, Z.; Wang, H. Development of SSR markers and assessment of genetic diversity in medicinal Chrysanthemum morifolium cultivars. Front. Genet. 2016, 7, 113. [Google Scholar] [CrossRef] [PubMed]
- Bhandawat, A.; Sharma, V.; Singh, P.; Seth, R.; Nag, A.; Kaur, J.; Sharma, R.K. Discovery and utilization of EST-SSR marker resource for genetic diversity and population structure analyses of a subtropical bamboo, Dendrocalamus hamiltonii. Biochem Genet. 2019, 57, 652–672. [Google Scholar] [CrossRef]
- Fu, N.; Wang, P.Y.; Liu, X.D.; Shen, H.L. Use of EST-SSR markers for evaluating genetic diversity and fingerprinting celery (Apium graveolens L.) cultivars. Molecules 2014, 19, 1939–1955. [Google Scholar] [CrossRef]
- Wang, X.; Chen, W.; Luo, J.; Yao, Z.; Yu, Q.; Wang, Y.; Zhang, S.; Liu, Z.; Zhang, M.; Shen, Y. Development of EST-SSR markers and their application in an analysis of the genetic diversity of the endangered species Magnolia sinostellata. Mol. Genet. Genom. MGG 2019, 294, 135–147. [Google Scholar] [CrossRef]
- Hamrick, J.L.; Godt, M.J.W.; Sherman-Broyles, S.L. Factors influencing levels of genetic diversity in woody plant species. New For. 1992, 6, 95–124. [Google Scholar] [CrossRef]
- Zamora-Tavares, P.; Vargas-Ponce, O.; Sanchez-Martinez, J.; Cabrera-Toledo, D. Diversity and genetic structure of the husk tomato (Physalis philadelphica Lam.) in Western Mexico. Genet. Resour. Crop. Evol. 2015, 62, 141–153. [Google Scholar] [CrossRef]
- Wei, J.; Hu, X.; Yang, J.; Yang, W. Identification of single-copy orthologous genes between Physalis and Solanum lycopersicum and analysis of genetic diversity in Physalis using molecular markers. PLoS ONE 2012, 7, e50164. [Google Scholar] [CrossRef] [PubMed]
- Yao, X.; Ye, Q.; Kang, M.; Huang, H. Microsatellite analysis reveals interpopulation differentiation and gene flow in the endangered tree Changiostyrax dolichocarpa (Styracaceae) with fragmented distribution in central China. New Phytol. 2007, 176, 472–480. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Q.; Zhang, X.; Yang, Y.; Xu, L.; Feng, J.; Wang, J.; Tang, Y.; Pei, X.; Zhao, X. Genetic diversity of Juglans mandshurica populations in northeast China based on SSR markers. Front. Plant Sci. 2022, 13, 931578. [Google Scholar] [CrossRef] [PubMed]
- Yang, W.; Bai, Z.; Wang, F.; Zou, M.; Wang, X.; Xie, J.; Zhang, F. Analysis of the genetic diversity and population structure of Monochasma savatieri Franch. ex Maxim using novel EST-SSR markers. BMC Genom. 2022, 23, 597. [Google Scholar] [CrossRef]
- Xia, T.; Chen, S.; Chen, S.; Ge, X. Genetic variation within and among populations of Rhodiola alsia (Crassulaceae) native to the Tibetan Plateau as detected by ISSR markers. Biochem. Genet. 2005, 43, 87–101. [Google Scholar] [CrossRef]
- Barkley, N.A.; Roose, M.L.; Krueger, R.R.; Federici, C.T. Assessing genetic diversity and population structure in a citrus germplasm collection utilizing simple sequence repeat markers (SSRs). Appl. Genet. 2006, 112, 1519–1531. [Google Scholar] [CrossRef]
- Feng, S.; Zhu, Y.; Yu, C.; Jiao, K.; Jiang, M.; Lu, J.; Shen, C.; Ying, Q.; Wang, H. Development of species-specific SCAR markers, based on a SCoT analysis, to authenticate Physalis (Solanaceae) species. Front. Genet. 2018, 9, 192. [Google Scholar] [CrossRef]
- Feng, S.; Zheng, K.; Jiao, K.; Cai, Y.; Chen, C.; Mao, Y.; Wang, L.; Zhan, X.; Ying, Q.; Wang, H. Complete chloroplast genomes of four Physalis species (Solanaceae): Lights into genome structure, comparative analysis, and phylogenetic relationships. BMC Plant Biol. 2020, 20, 242. [Google Scholar] [CrossRef]
- Beier, S.; Thiel, T.; Munch, T.; Scholz, U.; Mascher, M. MISA-web: A web server for microsatellite prediction. Bioinformatics 2017, 33, 2583–2585. [Google Scholar] [CrossRef]
- Lalitha, S. Primer premier 5. Biotech Softw. Internet Rep. Comput. Softw. J. Sci. 2000, 1, 270–272. [Google Scholar] [CrossRef]
- Botstein, D.; White, R.L.; Skolnick, M.; Davis, R.W. Construction of a genetic linkage map in man using restriction fragment length polymorphisms. Am. J. Hum. Genet. 1980, 32, 314–331. [Google Scholar] [PubMed]
- Rohlf, F.J. NTSYS-PC: Numerical taxonomy and multivariate analysis system, version 2.00. In Biochemical Genetics; Exeter Software: Setauket, NY, USA, 2000. [Google Scholar]
- Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular evolutionary genetics analysis across computing platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef] [PubMed]
- Peakall, R.; Smouse, P.E. GenAlEx 6.5: Genetic analysis in Excel. Population genetic software for teaching and research—An update. Bioinformatics 2012, 28, 2537–2539. [Google Scholar] [CrossRef]
- Falush, D.; Stephens, M.; Pritchard, J.K. Inference of population structure using multilocus genotype data: Dominant markers and null alleles. Mol. Ecol. Notes 2007, 7, 574–578. [Google Scholar] [CrossRef]
- Evanno, G.; Regnaut, S.; Goudet, J. Detecting the number of clusters of individuals using the software STRUCTURE: A simulation study. Mol. Ecol. 2005, 14, 2611–2620. [Google Scholar] [CrossRef]
- Earl, D.A.; Vonholdt, B.M. STRUCTURE HARVESTER: A website and program for visualizing STRUCTURE output and implementing the Evanno method. Conserv. Genet. Resour 2012, 4, 359–361. [Google Scholar] [CrossRef]
Parameter | Value |
---|---|
Total size of examined sequences (bp) | 156,905 |
Total number of identified SSRs | 57 |
Number of SSR containing sequences | 1 |
Number of sequences containing more than 1 SSR | 1 |
Number of SSRs present in compound formation | 3 |
Repeat types | |
Mononucleotide | 39 (68.42%) |
Dinucleotide | 6 (10.53%) |
Trinucleotide | 5 (8.77%) |
Tetranucleotide | 7 (12.28%) |
SSR Motif | Number of Repeat Units in cp Genome | ||||||||
---|---|---|---|---|---|---|---|---|---|
Repeats | 3 | 4 | 5 | 6 | 7 | 8 | 9 | ≥10 | Total |
Mononucleotide | 39 | 39 | |||||||
(A)n | – | – | – | – | – | – | – | 14 | 14 |
(C)n | – | – | – | – | – | – | – | 1 | 1 |
(T)n | – | – | – | – | – | – | – | 24 | 24 |
Dinucleotide | 5 | 1 | 6 | ||||||
(AT)n | – | – | 3 | – | – | – | 3 | ||
(TA)n | – | – | 2 | 1 | – | – | – | 3 | |
Trinucleotide | 5 | 5 | |||||||
(AAG)n | – | 1 | – | – | – | – | – | – | 1 |
(ACT)n | – | 1 | – | – | – | – | – | – | 1 |
(TAA)n | – | 1 | – | – | – | – | – | – | 1 |
(TTA)n | – | 1 | – | – | – | – | – | – | 1 |
(TTC)n | – | 1 | – | – | – | – | – | – | 1 |
Tetranucleotide | 7 | 7 | |||||||
(AAAC)n | 1 | – | – | – | – | – | – | – | 1 |
(CTAT)n | 1 | – | – | – | – | – | – | – | 1 |
(CTTA)n | 1 | – | – | – | – | – | – | – | 1 |
(TTTA)n | 2 | – | – | – | – | – | – | – | 2 |
(TTTG)n | 2 | – | – | – | – | – | – | – | 2 |
Total | 7 | 5 | 5 | 0 | 1 | 0 | 0 | 39 | 57 |
Distribution frequency (%) | 12.28 | 8.77 | 8.77 | 0 | 1.54 | 0 | 0 | 68.42 |
Primer Name | Primer Sequences (5′–3′) | Repeat Motif | Tm (°C) | Sequence Size (bp) | No. of Alleles | Polymorphic Alleles | Polymorphic Rate (%) | PIC |
---|---|---|---|---|---|---|---|---|
KzcpSSR02 | F: CGTAGAAAGACGAAAGTGGATT | (AAG)4 | 58 | 196 | 11 | 10 | 90.91 | 0.931 |
R: AAACTCTTCGCTATTGGGTAAA | ||||||||
KzcpSSR04 | F: ATAGATAAATACACCAAACAACAAA | (T)12 | 58 | 231 | 12 | 11 | 91.67 | 0.945 |
R: GATAGAAGTTAATCAGTAATGGGAA | ||||||||
KzcpSSR17 | F: TCAACAATGATCCACTAGACACT | (A)20 | 58 | 255 | 9 | 9 | 100.00 | 0.939 |
R: TTTTCCCCTCAAATATGAATACT | ||||||||
KzcpSSR18 | F: AGGTTCTTTAAATTCCGTGG | (TTC)4 | 58 | 172 | 4 | 3 | 75.00 | 0.835 |
R: TCCTTTTTCAAATCCTGCTG | ||||||||
KzcpSSR19 | F: TGATCGTGACCTTGAACCTGTT | (T)13 | 60 | 299 | 2 | 1 | 50.00 | 0.550 |
R: TCCCTCTCTCTCCTTTTTTGCT | ||||||||
KzcpSSR21 | F: TTTTTCCTATTTTGACTTCTATG | (T)13 | 56 | 172 | 2 | 1 | 50.00 | 0.657 |
R: ATCTGTCATTACGTGCGACTATC | ||||||||
KzcpSSR23 | F: ACAAGGAATGAAAAGAAAAAAGA | (CTTA)3 | 56 | 231 | 4 | 1 | 25.00 | 0.781 |
R: AATAATAGATAGTAAATGGGTCG | ||||||||
KzcpSSR24 | F: GGGATGAATTGGATAAATATACAG | (TA)5 | 58 | 158 | 4 | 3 | 75.00 | 0.831 |
R: TAGATGATTGATAATGTTCCTTTG | ||||||||
KzcpSSR25 | F: GAATAAAAAAAAGAATAGGGAA | (ACT)4 | 56 | 247 | 2 | 1 | 50.00 | 0.613 |
R: TAGAATTGTGATAAATCGAAA | ||||||||
KzcpSSR26 | F: TTCTCCTGTTTCTCTTGTTTTTTT | (T)11 | 57 | 189 | 8 | 8 | 100.00 | 0.922 |
R: CTCTTCTATTTGATTACTTGTTCT | ||||||||
KzcpSSR29 | F: CTTTGCGTTTTTCTTTCTTTT | (A)11 | 57 | 178 | 7 | 5 | 71.43 | 0.897 |
R: ACCCAATTTTTATTTTTTACC | ||||||||
KzcpSSR30 | F: GAGTTTTTGACTTTCATTATTTTG | (T)10 | 58 | 188 | 4 | 4 | 100.00 | 0.862 |
R: TTTTCTTCCCCGCATTTATC | ||||||||
KzcpSSR31 | F: AAAAGAAAAAGAAATCCATTTT | (A)10…(TTTG)3 | 57 | 176 | 4 | 1 | 25.00 | 0.780 |
R: GTTGGGTTCATCCCTGTAGTAA | ||||||||
KzcpSSR34 | F: CTCTACAAGAAAATTGACCCCC | (A)13 | 58 | 187 | 6 | 5 | 83.33 | 0.865 |
R: TGCTGAATCACAGACAAAAAAA | ||||||||
KzcpSSR35 | F: GATAAAGTCGGTTGATTAGGGT | (T)16 | 60 | 178 | 8 | 7 | 87.50 | 0.921 |
R: ATTGAAAAATCGAAGAAAAGCC | ||||||||
KzcpSSR36 | F: CCCATTACCATTTCTTTTTGT | (T)10 | 60 | 179 | 4 | 4 | 100.00 | 0.858 |
R: TGAAGTATCCAGGCTCCGTTT | ||||||||
KzcpSSR37 | F: TTTGTTTTGTAATGGATAGTTGC | (T)12 | 56 | 251 | 2 | 2 | 100.00 | 0.714 |
R: TTTTTGTTATTGGGATAGGTGAA | ||||||||
KzcpSSR38 | F: TCTTTGTTTTGTAATGGATAGTTG | (AT)5 | 60 | 256 | 2 | 2 | 100.00 | 0.719 |
R: GTTTTTTTGTTATTGGGATAGGTG | ||||||||
KzcpSSR39 | F: TTGGCTGTTATTCAAAAGGTC | (T)11 | 58 | 188 | 5 | 3 | 60.00 | 0.836 |
R: ACAATCAACATACGGTTCCTT | ||||||||
KzcpSSR41 | F: TTCTTATTTAATGGTTAGGTCCG | (T)10 | 60 | 175 | 4 | 4 | 100.00 | 0.854 |
R: AAAGCATCAATACGCATTCATAC | ||||||||
KzcpSSR42 | F: ATTGTGGGTATAATGGTAGATGC | (T)16 | 58 | 271 | 7 | 6 | 85.71 | 0.896 |
R: TGGAAGAAGAAGTAGAAAAAGGA | ||||||||
KzcpSSR44 | F: AAAATGGAAAGTTCGACACAA | (A)12 | 58 | 143 | 3 | 2 | 66.67 | 0.772 |
R: GAAGAGAAGCAAATGAAAGGC | ||||||||
KzcpSSR45 | F: GTGACGATACTGTAGGGGAGG | (A)12 | 58 | 239 | 7 | 5 | 71.43 | 0.904 |
R: ATTTCGGGTTAAGAAGATGTG | ||||||||
KzcpSSR46 | F: AGGTCGTGTCATCTTTCTTCCAT | (A)10 | 60 | 153 | 5 | 4 | 80.00 | 0.850 |
R: CACAAAACCCCTTTCTACTCAAT | ||||||||
KzcpSSR47 | F: GGAAAGAAACAAAAAAAAGAAA | (A)11 | 58 | 125 | 4 | 4 | 100.00 | 0.857 |
R: TGAGAAAGGAGAATAGGAATGA | ||||||||
KzcpSSR48 | F: CAATTTTCAGATTCAGTTTGACTA | (T)13 | 59 | 199 | 5 | 5 | 100.00 | 0.885 |
R: AAGAAACCAAAGAATGGCTTATCA | ||||||||
KzcpSSR49 | F: GCCATTCTTTGGTTTCTTTT | (T)10 | 56 | 160 | 4 | 4 | 100.00 | 0.861 |
R: TCCTTTTTTGAGCCCATTTT | ||||||||
KzcpSSR50 | F: ATCAATGAAGGTAATAGAATA | (T)10 | 55 | 179 | 6 | 6 | 100.00 | 0.903 |
R: CAAACAAAAAGAGAAGAGAAA | ||||||||
KzcpSSR51 | F: CGAGGTGTGAAGTGGGAGAGA | (T)12 | 60 | 145 | 9 | 9 | 100.00 | 0.935 |
R: CGACGCCAGGATGATAAAAAG | ||||||||
KzcpSSR53 | F: GTAATTTCATAGAGTCATTCGGTC | (AT)5 | 60 | 236 | 2 | 2 | 100.00 | 0.716 |
R: CCAAACTGTACAAGCTTCTTCCAA | ||||||||
Average | 5.2 | 4.4 | 81.29 | 0.830 | ||||
Total | 156 | 132 |
Population | Na | Ne | h | I | PL | PPL (%) |
---|---|---|---|---|---|---|
HZ | 1.1154 ± 0.3205 | 1.0879 ± 0.2623 | 0.0476 ± 0.1389 | 0.0685 ± 0.1972 | 18 | 11.54 |
XS | 1.5449 ± 0.4996 | 1.2984 ± 0.3705 | 0.1743 ± 0.1974 | 0.2640 ± 0.2798 | 85 | 54.49 |
LA | 1.2051 ± 0.4051 | 1.0873 ± 0.2268 | 0.0536 ± 0.1295 | 0.0839 ± 0.1909 | 32 | 20.51 |
DQ | 1.0641 ± 0.2457 | 1.0371 ± 0.1663 | 0.0215 ± 0.0902 | 0.0325 ± 0.1316 | 10 | 6.41 |
YW | 1.3077 ± 0.4630 | 1.1848 ± 0.3122 | 0.1093 ± 0.1792 | 0.1628 ± 0.2609 | 48 | 30.77 |
PJ | 1.4551 ± 0.4996 | 1.2226 ± 0.3325 | 0.1324 ± 0.1850 | 0.2020 ± 0.2660 | 71 | 45.51 |
NH | 1.1795 ± 0.3850 | 1.1368 ± 0.3120 | 0.0749 ± 0.1672 | 0.1079 ± 0.2381 | 28 | 17.95 |
LH | 1.1538 ± 0.3620 | 1.0969 ± 0.2576 | 0.0555 ± 0.1418 | 0.0821 ± 0.2048 | 24 | 15.38 |
TZ | 1.2244 ± 0.4185 | 1.1689 ± 0.3255 | 0.0951 ± 0.1796 | 0.1376 ± 0.2584 | 35 | 22.44 |
WZ | 1.5000 ± 0.5016 | 1.2375 ± 0.3327 | 0.1428 ± 0.1852 | 0.2195 ± 0.2656 | 78 | 50.00 |
NJZ | 1.3205 ± 0.4682 | 1.1466 ± 0.2730 | 0.0902 ± 0.1600 | 0.1390 ± 0.2351 | 50 | 32.05 |
NJX | 1.1346 ± 0.3424 | 1.0842 ± 0.2321 | 0.0498 ± 0.1321 | 0.0741 ± 0.1938 | 21 | 13.46 |
JJ | 1.3910 ± 0.4896 | 1.2323 ± 0.3655 | 0.1323 ± 0.1923 | 0.1982 ± 0.2739 | 61 | 39.10 |
HG | 1.4231 ± 0.4956 | 1.2306 ± 0.3458 | 0.1344 ± 0.1909 | 0.2019 ± 0.2738 | 66 | 42.31 |
XJ | 1.4936 ± 0.5016 | 1.2692 ± 0.3672 | 0.1559 ± 0.1975 | 0.2345 ± 0.2809 | 77 | 49.36 |
YN | 1.5449 ± 0.4996 | 1.2858 ± 0.3634 | 0.1673 ± 0.1974 | 0.2529 ± 0.2808 | 85 | 54.49 |
Average | 1.3161 ± 0.4311 | 1.1754 ± 0.3028 | 0.1023 ± 0.1665 | 0.1538 ± 0.2395 | 49 | 31.61 |
Population | HZ | XS | LA | DQ | YW | PJ | NH | LH | TZ | WZ | NJZ | NJX | JJ | HG | XJ | YN |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
HZ | 0.5009 | 0.9221 | 0.8996 | 0.9238 | 0.5339 | 0.4446 | 0.9237 | 0.8993 | 0.5293 | 0.4860 | 0.8845 | 0.8438 | 0.8892 | 0.9015 | 0.8935 | |
XS | 0.6914 | 0.5267 | 0.4994 | 0.5356 | 0.9211 | 0.9171 | 0.5046 | 0.5266 | 0.9075 | 0.9093 | 0.5160 | 0.6482 | 0.5920 | 0.5975 | 0.5809 | |
LA | 0.0811 | 0.6411 | 0.9419 | 0.9479 | 0.5570 | 0.4662 | 0.9507 | 0.9426 | 0.5143 | 0.4897 | 0.9054 | 0.8538 | 0.8998 | 0.9053 | 0.9119 | |
DQ | 0.1059 | 0.6943 | 0.0599 | 0.9612 | 0.5199 | 0.4403 | 0.9146 | 0.9197 | 0.4858 | 0.4409 | 0.8930 | 0.8254 | 0.8881 | 0.8740 | 0.8716 | |
YW | 0.0793 | 0.6243 | 0.0535 | 0.0396 | 0.5493 | 0.4727 | 0.9392 | 0.9346 | 0.5237 | 0.4852 | 0.9150 | 0.8505 | 0.9183 | 0.9115 | 0.9124 | |
PJ | 0.6275 | 0.0822 | 0.5853 | 0.6541 | 0.5991 | 0.9337 | 0.5370 | 0.5433 | 0.9080 | 0.9106 | 0.5101 | 0.6774 | 0.5933 | 0.6154 | 0.5939 | |
NH | 0.8106 | 0.0865 | 0.7631 | 0.8202 | 0.7492 | 0.0686 | 0.4603 | 0.4658 | 0.8900 | 0.9171 | 0.4374 | 0.5835 | 0.5175 | 0.5362 | 0.5092 | |
LH | 0.0794 | 0.6840 | 0.0505 | 0.0893 | 0.0627 | 0.6217 | 0.7758 | 0.9677 | 0.5038 | 0.4833 | 0.9263 | 0.8549 | 0.9179 | 0.9302 | 0.9204 | |
TZ | 0.1062 | 0.6414 | 0.0591 | 0.0837 | 0.0677 | 0.6100 | 0.7640 | 0.0329 | 0.5443 | 0.4970 | 0.9167 | 0.8608 | 0.9228 | 0.9217 | 0.9194 | |
WZ | 0.6361 | 0.0971 | 0.6649 | 0.7220 | 0.6469 | 0.0966 | 0.1165 | 0.6856 | 0.6083 | 0.9346 | 0.5065 | 0.6657 | 0.6034 | 0.6098 | 0.5979 | |
NJZ | 0.7216 | 0.0951 | 0.7139 | 0.8190 | 0.7232 | 0.0937 | 0.0865 | 0.7271 | 0.6991 | 0.0676 | 0.4896 | 0.6462 | 0.5794 | 0.5964 | 0.5650 | |
NJX | 0.1227 | 0.6617 | 0.0994 | 0.1131 | 0.0888 | 0.6731 | 0.8268 | 0.0765 | 0.0870 | 0.6802 | 0.7141 | 0.8492 | 0.9374 | 0.9413 | 0.9336 | |
JJ | 0.1698 | 0.4335 | 0.1581 | 0.1919 | 0.1619 | 0.3896 | 0.5388 | 0.1567 | 0.1499 | 0.4070 | 0.4366 | 0.1634 | 0.9012 | 0.9021 | 0.8985 | |
HG | 0.1174 | 0.5243 | 0.1056 | 0.1187 | 0.0852 | 0.5221 | 0.6587 | 0.0857 | 0.0804 | 0.5051 | 0.5457 | 0.0647 | 0.1041 | 0.9534 | 0.9551 | |
XJ | 0.1037 | 0.5150 | 0.0995 | 0.1347 | 0.0927 | 0.4855 | 0.6233 | 0.0723 | 0.0815 | 0.4947 | 0.5168 | 0.0604 | 0.1031 | 0.0477 | 0.9513 | |
YN | 0.1126 | 0.5432 | 0.0922 | 0.1375 | 0.0917 | 0.5210 | 0.6750 | 0.0829 | 0.0841 | 0.5143 | 0.5710 | 0.0687 | 0.1071 | 0.0460 | 0.0499 |
Total Gene Diversity (Ht) | Population Genetic Diversity (Hs) | Coefficient of Genetic Differentiation (Gst) | Gene Flow (Nm) |
---|---|---|---|
0.3224 ± 0.0284 | 0.1023 ± 0.0064 | 0.6827 | 0.2324 |
Source | df | SS | MS | Est. Var. | Percentage (%) | PhiPT |
---|---|---|---|---|---|---|
Among pops | 15 | 10,086.383 | 672.426 | 51.470 | 71 | 0.710 (p = 0.001) |
Within pops | 187 | 3923.824 | 20.983 | 20.983 | 29 | |
Total | 202 | 14,010.207 | 72.453 | 100 |
Number | Population Code | Sample Size | Locations |
---|---|---|---|
1 | HZ | 10 | Jianggan, Hangzhou, Zhejiang, China |
2 | XS | 14 | Xiaoshan, Hangzhou, Zhejiang, China |
3 | LA | 13 | Tianmushan, Lin’an, Zhejiang, China |
4 | DQ | 6 | Deqing, Huzhou, Zhejiang, China |
5 | YW | 12 | Yiwu, Jinhua, Zhejiang, China |
6 | PJ | 14 | Pujiang, Jinhua, Zhejiang, China |
7 | NH | 10 | Nihai, Ningbo, Zhejiang, China |
8 | LH | 12 | Linhai, Taizhou, Zhejinag, China |
9 | TZ | 15 | Jiaojiang, Taizhou, Zhejiang, China |
10 | WZ | 12 | Wenling, Wenzhou, Zhejiang, China |
11 | NJZ | 15 | Xixia, Nanjing, Jiangsu, China |
12 | NJX | 12 | Xuanwu, Nanjing, Jiangsu, China |
13 | JJ | 13 | Xunyang, Jiujiang, Jiangxi, China |
14 | HG | 15 | Luotian, Huanggang, Hubei, China |
15 | XJ | 14 | Xiajin, Dezhou, Shangdong, China |
16 | YN | 16 | Baohua, Honghe, Yunnan, China |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Feng, S.; Jiao, K.; Zhang, Z.; Yang, S.; Gao, Y.; Jin, Y.; Shen, C.; Lu, J.; Zhan, X.; Wang, H. Development of Chloroplast Microsatellite Markers and Evaluation of Genetic Diversity and Population Structure of Cutleaf Groundcherry (Physalis angulata L.) in China. Plants 2023, 12, 1755. https://doi.org/10.3390/plants12091755
Feng S, Jiao K, Zhang Z, Yang S, Gao Y, Jin Y, Shen C, Lu J, Zhan X, Wang H. Development of Chloroplast Microsatellite Markers and Evaluation of Genetic Diversity and Population Structure of Cutleaf Groundcherry (Physalis angulata L.) in China. Plants. 2023; 12(9):1755. https://doi.org/10.3390/plants12091755
Chicago/Turabian StyleFeng, Shangguo, Kaili Jiao, Zhenhao Zhang, Sai Yang, Yadi Gao, Yanyun Jin, Chenjia Shen, Jiangjie Lu, Xiaori Zhan, and Huizhong Wang. 2023. "Development of Chloroplast Microsatellite Markers and Evaluation of Genetic Diversity and Population Structure of Cutleaf Groundcherry (Physalis angulata L.) in China" Plants 12, no. 9: 1755. https://doi.org/10.3390/plants12091755
APA StyleFeng, S., Jiao, K., Zhang, Z., Yang, S., Gao, Y., Jin, Y., Shen, C., Lu, J., Zhan, X., & Wang, H. (2023). Development of Chloroplast Microsatellite Markers and Evaluation of Genetic Diversity and Population Structure of Cutleaf Groundcherry (Physalis angulata L.) in China. Plants, 12(9), 1755. https://doi.org/10.3390/plants12091755