Relationship between Sugarcane eIF4E Gene and Resistance against Sugarcane Streak Mosaic Virus
Abstract
1. Introduction
2. Results
2.1. Differences in Resistance of Sugarcane Varieties against Sugarcane Mosaic Disease
2.2. Detection and Sequence Analysis of SCSMV-CP and SCSMV-VPg in Different Resistant Sugarcane Varieties
2.3. Cloning and Sequence Analysis of eIF4E from Different Varieties
2.3.1. Detection of eIF4E from Different Varieties
2.3.2. Bioinformatic Analysis of Coding Region Sequence of eIF4E in Different Varieties
2.4. Polymorphism Analysis of the Coding Region Sequence of eIF4E
2.4.1. Cloning of the Coding Region Sequence of eIF4E in Different Resistant Varieties
2.4.2. Nucleotide Sequence Polymorphism of the Coding Region of eIF4E
2.4.3. Amino Acid Sequence Analysis of eIF4E Coding Region
2.5. Spatial Structure of eIF4E Protein
3. Discussion
4. Materials and Methods
4.1. Tested Material
4.2. Design and Synthesis of Primers
4.3. Extraction of Total RNA from Plants
4.4. Gene Cloning
4.5. SCSMV Accumulation Detection
4.6. Sequence Analysis
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Hema, M.; Sreenivasulu, P.; Savithri, H.S. Taxonomic position of Sugarcane streak mosaic virus in the family Potyviridae. Arch. Virol. 2002, 147, 1997–2007. [Google Scholar] [CrossRef] [Scilit]
- King, A.M.Q.; Adams, M.J.; Carstens, E.B.; Lefkowitz, E. Family Potyviridae. In Virus Taxonomy: Classification and Nomenclature of Viruses; Ninth Report of the International Committee on Taxonomy of Viruses; Elsevier Academic Press: San Diego, CA, USA, 2012; pp. 1069–1090. [Google Scholar]
- Rabenstein, F.; Seifers, D.L.; Schubert, J.; French, R.C.; Stenger, D.C. Phylogenetic relationships, strain diversity and biogeography of tritimoviruses. J. Gen. Virol. 2002, 83, 895–906. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tatineni, S.; Ziem, A.D.; Wegulo, S.N.; French, R. Triticum mosaic virus: A distinct member of the family Potyviridae with an unusually long leader sequence. Phytopathology 2009, 99, 943–950. [Google Scholar] [CrossRef] [Scilit]
- Hong, Y.; Levay, K.; Murphy, J.F.; Klein, P.G.; Shaw, J.G.; Hunt, A.G. A potyvirus polymerase interacts with the viral coat protein and VPg in the yeast cells. Virology 1995, 214, 159–166. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Puustinen, P.; Makinen, K. Uridylylation of the potyvirus VPg by viral replicase NIb correlates with the nucleotide binding capacity of VPg. J. Biol. Chem. 2004, 279, 38103–38110. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lopez-Moya, J.J.; Wang, R.Y.; Pirone, T.P. Context of the coat protein DAG motif affects Potyvirus transmissibility by aphids. J. Gen. Virol. 1999, 80, 3281–3288. [Google Scholar] [CrossRef] [Scilit]
- Gazo, B.M.; Murphy, P.; Gatchel, J.R.; Browning, K.S. A novel interaction of cap-binding protein complexes eukaryotic initiation factor (eIF) 4F and eIF(iso)4F with a region in the 3′-untranslated region of satellite tobacco necrosis virus. J. Korean Soc. Appl. Biol. 2004, 279, 13584–13592. [Google Scholar] [CrossRef] [Scilit]
- Léonard, S.; Plante, D.; Wittmann, S.; Daigneault, N.; Fortin, M.G.; Laliberte, J.F. Complex formation between potyvirus VPg and translation eukaryotic initiation factor 4E correlates with virus infectivity. J. Virol. 2000, 74, 7730–7737. [Google Scholar] [CrossRef] [Scilit]
- Wittmann, S.; Chatel, H.; Fortin, M.G.; Laliberté, J.F. Interaction of the viral protein genome linked of turnip mosaic potyvirus with the translational eukaryotic initiation factor (iso)4E of Arabidopsis thaliana using the yeast two-hybrid system. Virology 1997, 234, 84–92. [Google Scholar] [CrossRef] [Scilit]
- Robaglia, C.; Caranta, C. Translation initiation factors: A weak link in plant RNA virus infection. Trends Plant Sci. 2006, 11, 40–45. [Google Scholar] [CrossRef] [Scilit]
- Wang, A.M.; Krishnaswamy, S. Eukaryotic translation initiation factor 4e-mediated recessive resistance to plant viruses and its utility in crop improvement. Mol. Plant Pathol. 2012, 13, 795–803. [Google Scholar] [CrossRef] [Scilit]
- Lin, S.F.; Wang, R.G.; Ren, X.L.; Li, Z.Q.; Yuan, Y.; Long, M.J.; Zhang, J.S.; Wang, Z.L. Genotypic identification of Potato virus Y resistance in tobacco germplasm resources. Acta Tabacaria Sin. 2021, 27, 37–44. (In Chinese) [Google Scholar] [CrossRef]
- Yakupjan, H.; Asigul, I.; Wang, Y.J.; Liu, Y.L. Advances in genetic engineering of plant virus resistance. Chin. J. Biotechnol. 2015, 31, 976–994. [Google Scholar] [CrossRef]
- Green, M.R.; Sambrook, J. Molecular Cloning: A Laboratory Manual, 4th ed.; He, F.C., Ed.; Translator; Science Press: Beijing, China, 2017; pp. 509–545. [Google Scholar]
- Monzingo, A.F.; Dhaliwal, S.; Dutt-Chaudhuri, A.; Lyon, A.; Sadow, J.H.; Hoffman, D.W.; Robertus, J.D.; Browning, K.S. The structure of eukaryotic translation initiation factor-4E from wheat reveals a novel disulfide bond. Plant Physiol. 2007, 14, 1504–1518. [Google Scholar] [CrossRef] [Scilit]
- Papadopoulos, E.; Jenni, S.; Kabha, E.; Takrouri, K.J.; Yi, T.; Salvi, N.; Luna, R.E.; Gavathiotis, E.; Mahalingam, P.; Arthanari, H.; et al. Structure of the eukaryotic translation initiation factor eIF4E in complex with 4EGI-1 reveals an allosteric mechanism for dissociating eIF4G. Proc. Natl. Acad. Sci. USA 2014, 111, 3187–3195. [Google Scholar] [CrossRef] [Scilit]
- Li, W.F.; He, Z.; Li, S.F.; Huang, Y.K.; Zhang, Z.X.; Jiang, D.M.; Wang, X.Y.; Luo, Z.M. Molecular characterization of a new strain of Sugarcane streak mosaic virus (SCSMV). Arch. Virol. 2011, 156, 2101–2104. [Google Scholar] [CrossRef] [Scilit]
- Li, X.J.; Li, C.J.; Wu, Z.D.; Tian, C.Y.; Hu, X.; Qiu, L.H.; Wu, J.M. Expression characteristic and gene diversity analysis of ScHTD2 in sugarcane. Acta Agron. Sin. 2022, 48, 1601–1613. (In Chinese) [Google Scholar]
- Wang, X.Y.; Li, W.F.; Huang, Y.K.; Zhang, R.Y.; Shan, H.L.; Yin, J.; Luo, Z.M. Molecular detection and phylogenetic analysis of viruses causing mosaic symptoms in new sugarcane varieties in China. Eur. J. Plant Pathol. 2017, 148, 931–940. [Google Scholar] [CrossRef] [Scilit]
- Adams, M.J.; Antoniw, J.F.; Fauquet, C.M. Molecular criteria for genus and species discrimination within the family Potyviridae. Arch. Virol. 2005, 150, 459–479. [Google Scholar] [CrossRef] [Scilit]
- Zhu, M.; Chen, Y.T.; Ding, S.X.; Webb, S.L.; Zhou, T.; Nelson, R.S.; Fan, Z.F. Maize elonginc interacts with the viral genome-linked protein, VPg, of Sugarcane mosaic virus and facilitates virus infection. New Phytol. 2014, 203, 1291–1304. [Google Scholar] [CrossRef] [Scilit]
- Zhang, R.Y.; Li, W.F.; Huang, Y.K.; Pu, C.H.; Wang, X.Y.; Shan, H.L.; Cang, X.Y.; Luo, Z.M.; Yin, J. Genetic diversity and population structure of Sugarcane streak mosaic virus in Yunnan province, China. Trop. Plant Pathol. 2018, 43, 514–519. [Google Scholar] [CrossRef] [Scilit]
- Zhu, M. Studies of the Molecular Interactions between Maize Elongin C and Vpg of Sugarcane mosaic virus. Ph.D. Thesis, China Agricultural University, Beijing, China, 2014. (In Chinese) [Google Scholar]
- Moury, B.; Charron, C.; Janzac, B.; Simon, V.; Gallois, L.J. Evolution of plant eukaryotic initiation factor 4E (eIF4E) and potyvirus genome-linked protein (VPg): A game of mirrors impacting resistance spectrum and durability. Infect. Genet. Evol. 2014, 27, 472–480. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kim, J.; Kang, W.H.; Hwang, J.; Yang, H.B.; Dosun, K.; Oh, C.S.; Kang, B.C. Transgenic Brassica rapa plants over-expressing eIF(iso)4E variants show broad-spectrum Turnip mosaic virus (TuMV) resistance. Mol. Plant Pathol. 2014, 15, 615–626. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, H.; Shirako, Y. Association of VPg and eIF4E in the host tropism at the cellular level of Barley yellow mosaic virus and Wheat yellow mosaic virus in the genus Bymovirus. Virology 2015, 476, 159–167. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Geng, G.W.; Gu, K.; Yu, C.M.; Li, X.D.; Tian, Y.P.; Yuan, X.F. Sequence analysis of translation initiation factor eIF4E from two varieties of wheat with differential resistance to Wheat yellow mosaic virus. Acta Phytopathol. Sin. 2017, 47, 568–572. (In Chinese) [Google Scholar] [CrossRef]
- Huang, Z.X.; Zhou, F.; Wang, Q.N.; Jin, Y.F.; Fu, C.; Hu, H.X.; Zhang, C.M.; Chang, H.L.; Ji, J.L.; Wu, Q.W.; et al. Genetic diversity assessment of Saccharum spontaneum L. native of domestic and overseas with phenotype agronomic traits. J. Plant Genet. Resour. 2012, 13, 825–829. (In Chinese) [Google Scholar] [CrossRef]
- Li, W.F.; Wang, X.Y.; Huang, Y.K.; Shan, H.L.; Luo, Z.M.; Ying, X.M.; Zhang, R.Y.; Shen, K.; Yin, J. Screening sugarcane germplasm resistant to Sorghum mosaic virus. Crop Prot. 2013, 43, 27–30. [Google Scholar] [CrossRef] [Scilit]
- Li, Y.H.; Li, J.; Qin, W.; Wang, X.Y.; Zhang, R.Y.; Zhao, J.; Shan, H.L.; Li, W.F.; Huang, Y.K. Diseases investigation and resistance analysis of new sugarcane varieties in the regional test demonstration of the national sugar system. Sugar Crops China 2022, 44, 58–63. (In Chinese) [Google Scholar] [CrossRef]
- Zhang, J.; Arro, J.; Chen, Y.Q.; Ming, R. Haplotype analysis of sucrose synthase gene family in three Saccharum species. BMC Genom. 2013, 14, 314. [Google Scholar] [CrossRef] [Scilit]
- Wang, X.W. Germplasm Identification and Evaluation of Resistance to TuMV and eIF(iso)4E Gene Cloning and Sequence Analysis in Brassica campestris L. ssp. Master’s Thesis, Chinese Academy of Agricultural Sciences, Beijing, China, 2015. (In Chinese) [Google Scholar]
- Zhu, Y.L.; Song, Q.J.; Hyten, D.L.; Van, C.P.; Matukumalli, L.K.; Grimm, D.R.; Hyatt, S.M.; Fickus, E.W.; Young, N.D.; Cregan, P.B. Single-nucleotide polymorphisms in Soybean. Genetics 2003, 163, 1123–1134. [Google Scholar] [CrossRef] [Scilit]
- Rao, Q. SNP markers and soybean genome mapping. Prog. Mod. Biomed. 2008, 8, 2184–2186. [Google Scholar] [CrossRef]
- Nielsen, R. Molecular signatures of natural selection. Annu. Rev. Genet. 2005, 39, 197–218. [Google Scholar] [CrossRef] [Scilit]
- Ruffel, S.; Dussault, M.H.; Palloix, A.; Moury, B.; Bendahmane, A.; Robaglia, C.; Caranta, C. A natural recessive resistance gene against potato virus Y in pepper corresponds to the eukaryotic initiation factor 4E (eIF4E). Plant J. 2002, 32, 1067–1075. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ruffel, S.; Gallois, J.L.; Moury, B.; Robaglia, C.; Palloix, A.; Caranta, C. Simultaneous mutations in translation initiation factors eIF4E and eIF(iso)4E are required to prevent Pepper veinal mottle virus infection of pepper. J. Gen. Virol. 2006, 87, 2089–2098. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yeam, I.; Cavatorta, J.R.; Ripoll, D.R.; Kang, B.C. Functional dissection of naturally occurring amino acid substitutions in eIF4E that confers recessive potyvirus resistance in Plants. Plant Cell 2007, 19, 2913–2928. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Stein, N.; Perovic, D.; Kumlehn, J.; Pellio, B.; Stracke, S.; Streng, S.; Ordon, F.; Graner, A. The eukaryotic translation initiation factor, 4E, confers multiallelic recessive Bymovirus resistance in Hordeum vulgare (L.). Plant J. 2005, 42, 912–922. [Google Scholar] [CrossRef] [Scilit]
- Miyoshi, H.; Suehiro, N.; Tomoo, K.; Muto, S.; Takahashi, T.; Tsukamoto, T.; Ohmori, T.; Natsuaki, T. Binding analysis for the interaction between plant virus genome-linked protein (VPg) and plant translational initiation factors. Biochimie 2006, 88, 329–340. [Google Scholar] [CrossRef] [Scilit]
- Li, W.F.; Shan, H.L.; Zhang, R.Y.; Wang, X.Y.; Yang, K.; Luo, Z.M.; Yin, J.; Cang, X.Y.; Li, J.; Huang, Y.K. Identification of resistance to Sugarcane streak mosaic virus (SCSMV) and Sorghum mosaic virus (SrMV) in new elite sugarcane varieties/clones in China. Crop Prot. 2018, 110, 77–82. [Google Scholar] [CrossRef] [Scilit]
- Wilhelm, J.; Pingoud, A. Real-time polymerase chain reaction. ChemBioChem 2003, 4, 1120–1128. [Google Scholar] [CrossRef] [Scilit]
- Tamura, K.; Stecher, G.; Peterson, D.; Filipski, A.; Kumar, S. MEGA6: Molecular evolutionary genetics analysis version 6.0. Mol. Biol. Evol. 2013, 30, 2725–2729. [Google Scholar] [CrossRef] [Scilit]










| Number | Sample | Phenotype | Number | Sample | Phenotype |
|---|---|---|---|---|---|
| 1 | CP 94-1100 | R | 7 | Guitang 08-1180 | S |
| 2 | Funong 30 | R | 8 | ROC 10 | S |
| 3 | Yuetang 55 | R | 9 | Q 124 | S |
| 4 | CP 89-2377 | R | 10 | Funong 02-6427 | S |
| 5 | Funong 09-2201 | S | 11 | ROC 22 | S |
| 6 | Yunrui 10-701 | S |
| Varieties | CP | VPg | eIF4E | |||
|---|---|---|---|---|---|---|
| Nucleotide | Amino Acid | Nucleotide | Amino Acid | Nucleotide | Amino Acid | |
| ROC22 | 938 | 240 | 594 | 198 | 663 | 220 |
| CP94-1100 | 938 | 240 | 594 | 198 | 663 | 220 |
| Sequence identities/% | 99.5 | 99.2 | 98.2 | 99.0 | 99.1 | 98.2 |
| Length | No. of Haplotypes | Haplotype Diversity (Hd ± SD) | Nucleotide Diversity (Pi ± SD) | No. of Polymorphic Sites (S) | Specific Polymorphic Sites | |
|---|---|---|---|---|---|---|
| All samples | 663 | 11 | 1.000 ± 0.039 | 0.00932 ± 0.0011 | 28 | SNP3; SNP101; SNP172; SNP242; SNP383; SNP416; SNP419; SNP496 |
| Highly resistant to SCSMV | 663 | 4 | 1.000 ± 0.177 | 0.00930 ± 0.0020 | 14 | SNP181; SNP193; SNP261; SNP406; SNP451; SNP614 |
| Highly susceptible to SCSMV | 663 | 7 | 1.000 ± 0.076 | 0.00970 ± 0.00153 | 22 | SNP46; SNP60; SNP180; SNP304; SNP328; SNP415; SNP433; SNP437; SNP448; SNP493; SNP501; SNP554; SNP644; SNP662 |
| Number | Mutation | Polymorphic Type | Amino Acid Variations | Mutation Type | Material |
|---|---|---|---|---|---|
| 1 | SNP46 | G/A | GLY15Asp | Non-synonymous mutation | Hap7 |
| 2 | SNP60 | G/T | Ala20Ser | Non-synonymous mutation | Hap7; Hap10; Hap11 |
| 3 | SNP71 | G/C | Glu23Asp | Non-synonymous mutation | Hap1; Hap2; Hap3; Hap4; Hap5; Hap6; Hap7; Hap8; Hap9; Hap10; Hap11 |
| 4 | SNP101 | T/C | Asp33Asp | Synonymous mutation | Hap3; Hap8 |
| 5 | SNP172 | A/C | Gln58Pro | Non-synonymous mutation | Hap1; Hap2; Hap3; Hap4; Hap5; Hap6; Hap7; Hap8; Hap9; Hap10; Hap11 |
| 6 | SNP180 | A/G | Lys60Glu | Non-synonymous mutation | Hap11 |
| 7 | SNP181 | A/G | Ser61Ser | Synonymous mutation | Hap2 |
| 8 | SNP193 | C/G | Ala64Val | Non-synonymous mutation | Hap3 |
| 9 | SNP242 | G/A | Glu80Glu | Synonymous mutation | Hap2; Hap4; Hap7; Hap9 |
| 10 | SNP261 | A/G | Asn87Asp | Non-synonymous mutation | Hap2 |
| 11 | SNP304 | T/C | Phe101Ser | Non-synonymous mutation | Hap9 |
| 12 | SNP328 | A/G | Glu109Gly | Non-synonymous mutation | Hap11 |
| 13 | SNP383 | T/C | Cys127Cys | Synonymous mutation | Hap1; Hap7 |
| 14 | SNP406 | T/C | Leu135Pro | Non-synonymous mutation | Hap2 |
| 15 | SNP415 | A/G | His138Arg | Non-synonymous mutation | Hap5 |
| 16 | SNP416 | C/T | His138Arg | Hap4; Hap9 | |
| 17 | SNP419 | T/C | Th139Thr | Synonymous mutation | Hap3; Hap5 |
| 18 | SNP433 | T/C | Ile144Thr | Non-synonymous mutation | Hap5 |
| 19 | SNP437 | C/T | Gly145Gly | Synonymous mutation | Hap5 |
| 20 | SNP448 | A/G | Asp149Gly | Non-synonymous mutation | Hap8 |
| 21 | SNP451 | A/G | Tye150Cys | Non-synonymous mutation | Hap2 |
| 22 | SNP493 | A/G | Lys164Arg | Non-synonymous mutation | Hap7 |
| 23 | SNP496 | A/T A/G | Gln165Leu Gln165Arg | Non-synonymous mutation | Hap1; Hap7; Hap8 |
| 24 | SNP501 | A/G | Arg167Gly | Non-synonymous mutation | Hap6 |
| 25 | SNP554 | T/C | Ile184Ile | Synonymous mutation | Hap8 |
| 26 | SNP614 | C/T | Asp204Asp | Synonymous mutation | Hap3 |
| 27 | SNP644 | G/A | Arg214Arg | Synonymous mutation | Hap9 |
| 28 | SNP662 | G/A | Val220Val | Synonymous mutation | Hap11 |
| Varieties | Haplotype | Protein | Amino Acid Variation Sites | ||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 15 | 20 | 23 | 58 | 60 | 64 | 87 | 101 | 109 | 135 | 138 | 144 | 149 | 150 | 164 | 165 | 167 | |||
| KX757017 | G | A | E | Q | K | A | N | F | E | L | H | L | D | Y | K | Q | R | ||
| CP 94-1100 | Hap1 | Protein-1 | — | — | D | P | — | — | — | — | — | — | — | — | — | — | — | L | — |
| Funong 30 | Hap2 | Protein-2 | — | — | D | P | — | — | D | — | — | P | — | — | — | C | — | — | — |
| Yuetang 55 | Hap3 | Protein-3 | — | — | D | P | — | V | — | — | — | — | — | — | — | — | — | — | — |
| CP 89-2377 | Hap4 | Protein-4 | — | — | D | P | — | — | — | — | — | — | — | — | — | — | — | — | |
| Funong 09-2201 | Hap5 | Protein-5 | — | — | D | P | — | — | — | — | — | — | R | T | — | — | — | — | — |
| Yunrui 10-701 | Hap6 | Protein-6 | — | S | D | P | — | — | — | — | — | — | — | — | — | — | — | — | G |
| Guitang 08-1180 | Hap7 | Protein-7 | D | — | D | P | — | — | — | — | — | — | — | — | — | — | R | L | — |
| ROC 10 | Hap8 | Protein-8 | — | — | D | P | — | — | — | — | — | — | — | — | G | — | — | R | — |
| Q 124 | Hap9 | Protein-9 | — | — | D | P | — | — | — | S | — | — | — | — | — | — | — | — | — |
| Funong 02-6427 | Hap10 | Protein-10 | — | S | D | P | — | — | — | — | — | — | — | — | — | — | — | — | — |
| ROC 22 | Hap11 | Protein-11 | — | S | D | P | E | — | — | — | G | — | — | — | — | — | — | — | — |
| Primers | Sequence (5′ to 3′) | Product Size | Target Gene |
|---|---|---|---|
| SCSMV-CP-F | ACAAGGAACGCAGCCACCT | 938 bp | CP |
| SCSMV-CP-R | ACTAAGCGGTCAGGCAAC | ||
| SCSMV-VPg-4F | GGGAAGAAGCGTCGAACTCA | 712 bp | vpg + Partial NIa-Pro |
| SCSMV-VPg-4R | CAACACACCAACTCTGCGTG | ||
| eIF4E-5F | ATGGCCGACGAGATCGACAC | 660 bp | eIF4E |
| eIF4E-5R | GCAACTCCTCGGCAAATACAG | ||
| SCSMV-qCP-F | AACAACAACGAGTCAAGCTG | 143 bp | SCSMV |
| SCSMV-qCP-R | AGAGATGAGAGCTTGTGGTG | ||
| eIF4E-qF | GGCGAACAATTCGACTATGG | 93 bp | eIF4E |
| eIF4E-qR | TCTGAGCAGCTTCATTAGCA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Shan, H.; Chen, D.; Zhang, R.; Wang, X.; Li, J.; Wang, C.; Li, Y.; Huang, Y. Relationship between Sugarcane eIF4E Gene and Resistance against Sugarcane Streak Mosaic Virus. Plants 2023, 12, 2805. https://doi.org/10.3390/plants12152805
Shan H, Chen D, Zhang R, Wang X, Li J, Wang C, Li Y, Huang Y. Relationship between Sugarcane eIF4E Gene and Resistance against Sugarcane Streak Mosaic Virus. Plants. 2023; 12(15):2805. https://doi.org/10.3390/plants12152805
Chicago/Turabian StyleShan, Hongli, Du Chen, Rongyue Zhang, Xiaoyan Wang, Jie Li, Changmi Wang, Yinhu Li, and Yingkun Huang. 2023. "Relationship between Sugarcane eIF4E Gene and Resistance against Sugarcane Streak Mosaic Virus" Plants 12, no. 15: 2805. https://doi.org/10.3390/plants12152805
APA StyleShan, H., Chen, D., Zhang, R., Wang, X., Li, J., Wang, C., Li, Y., & Huang, Y. (2023). Relationship between Sugarcane eIF4E Gene and Resistance against Sugarcane Streak Mosaic Virus. Plants, 12(15), 2805. https://doi.org/10.3390/plants12152805
