Next Article in Journal
The Polyphenolic Profile and Antioxidant Activity of Five Vegetal Extracts with Hepatoprotective Potential
Next Article in Special Issue
Deciphering the Genetic Inheritance of Tocopherols in Indian Mustard (Brassica juncea L. Czern and Coss)
Previous Article in Journal
Biopriming of Maize Seeds with a Novel Bacterial Strain SH-6 to Enhance Drought Tolerance in South Korea
Previous Article in Special Issue
Genome-Wide Association Study of Phenylalanine Derived Glucosinolates in Brassica rapa
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

BnKAT2 Positively Regulates the Main Inflorescence Length and Silique Number in Brassica napus by Regulating the Auxin and Cytokinin Signaling Pathways

1
College of Agronomy and Biotechnology, Southwest University, Chongqing 400715, China
2
Academy of Agricultural Sciences, Southwest University, Chongqing 400715, China
3
Chongqing Engineering Research Center for Rapeseed, Chongqing 400715, China
4
Guizhou Rapeseed Institute, Guizhou Academy of Agricultural Sciences, Guiyang 550018, China
*
Authors to whom correspondence should be addressed.
These authors contributed equally to this work.
Plants 2022, 11(13), 1679; https://doi.org/10.3390/plants11131679
Submission received: 18 May 2022 / Revised: 17 June 2022 / Accepted: 21 June 2022 / Published: 24 June 2022
(This article belongs to the Special Issue Development and Genetic Improvement in Brassica Crops)

Abstract

:
Brassica napus is the dominant oil crop cultivated in China for its high quality and high yield. The length of the main inflorescence and the number of siliques produced are important traits contributing to rapeseed yield. Therefore, studying genes related to main inflorescence and silique number is beneficial to increase rapeseed yield. Herein, we focused on the effects of BnKAT2 on the main inflorescence length and silique number in B. napus. We explored the mechanism of BnKAT2 increasing the effective length of main inflorescence and the number of siliques through bioinformatics analysis, transgenic technology, and transcriptome sequencing analysis. The full BnKAT2(BnaA01g09060D) sequence is 3674 bp, while its open reading frame is 2055 bp, and the encoded protein comprises 684 amino acids. BnKAT2 is predicted to possess two structural domains, namely KHA and CNMP-binding domains. The overexpression of BnKAT2 effectively increased the length of the main inflorescence and the number of siliques in B. napus, as well as in transgenic Arabidopsis thaliana. The type-A Arabidopsis response regulator (A-ARR), negative regulators of the cytokinin, are downregulated in the BnKAT2-overexpressing lines. The Aux/IAA, key genes in auxin signaling pathways, are downregulated in the BnKAT2-overexpressing lines. These results indicate that BnKAT2 might regulate the effective length of the main inflorescence and the number of siliques through the auxin and cytokinin signaling pathways. Our study provides a new potential function gene responsible for improvement of main inflorescence length and silique number, as well as a candidate gene for developing markers used in MAS (marker-assisted selection) breeding to improve rapeseed yield.

1. Introduction

Rapeseed (Brassica napus) is an important allopolyploid crop formed by interspecific hybridization between Brassica rapa and Brassica oleracea. It is the second most important oilseed, responsible for approximately 13% of vegetable oil in the world [1,2]. Improving rapeseed yield is an important way to mitigate the disparity between the limited supply and increasing demand, and has been the focus of breeding programs. Three major factors, including the number of siliques, number of seeds per silique, and thousand-seed weight, determine the yield of rapeseed plants, with the number of siliques having the highest correlation with yield [3]. Additionally, an optimized plant architecture (PA) is fundamental for high-yield breeding but the corresponding genetic control is largely unknown in rapeseed. The main inflorescence length is an important trait related to ideal plant architecture [4]. The plant with longer main inflorescence often has higher plant height, more siliques in main inflorescence, and higher yield. Considering current rapeseed production requirements for mechanical sowing with high planting density, the germplasm with longer main inflorescence is very important [5]. When the cultivation density is as high as 75 plants per m2, the yield of the main inflorescence accounts for 73.05% of the total yield per plant [6]. Therefore, increasing the effective length of the main inflorescence and the number of siliques may be effectively beneficial to increase the yield [7,8].
The discovery and utilization of rapeseed genes regulating the main inflorescence effective length and silique number is of great importance for breeding plants suitable for mechanized harvesting. Ren et al. [9] detected 17 SNP loci associated with inflorescence length and silique number using genome-wide association study (GWAS) and predicted the candidate genes. Among them, BnaA01g16940D encodes a proline-rich glycoprotein that regulates inflorescence length and silique number [9,10,11]. Another gene, BnaC01g39480D, encodes phosphoinositide-specific phospholipase C (PI-PLC), which catalyzes the hydrolysis of phosphatidylinositol 4,5-bisphosphate to 1,4,5-triphosphate inositol and diacylglycerol, which are involved in auxin biosynthesis and signal transduction, and ultimately regulates silique number [9,12,13]. Han et al. [14] found that BnaC06g27150D affects rapeseed inflorescence structure and stem branching via the auxin and cytokinin signal transduction [15,16,17]. We conducted a GWAS analysis on the effective length of the main inflorescence and the number of siliques in the main inflorescence employing 520 rapeseed cultivars (grown in Lincang, Yunnan, China, and Beibei, Chongqing, China) and screened a candidate gene, namely BnaA01g09060D, which might be associated with the length of the main inflorescence and the number of siliques it produces (unpublished). This gene was named BnKAT2 because of its homology with At4G18290 (AtKAT2) in Arabidopsis thaliana. KAT2 is a potassium channel in plants [18], and in A. thaliana it is activated by AtCPK6 in a calcium-dependent manner to control the K+ homeostasis in the leaves [19]. In this study, the genetic sequence of BnKAT2 and the structural characteristics of its encoded protein were analyzed. The phenotype analysis of transgenic B. napus plants and A. thaliana plants, both overexpressed with BnKAT2, showed that this gene could significantly increase the effective length of the main inflorescence and the number of siliques produced. RNA sequencing (RNA-seq) and differential gene expression analysis results showed that BnKAT2 functions by regulating the expression of genes that negatively regulate the cytokinin and auxin signal transduction pathways. These findings provide a theoretical basis and germplasm resources for the molecular breeding of rapeseed with a longer main inflorescence and more siliques to improve the yield.

2. Results

2.1. Cloning and Bioinformatics Analysis of BnKAT2 in B. napus

The full BnKAT2 gene is 3674 bp in length with a 2055-bp open reading frame and encodes a protein with 684 amino acid residues. The phylogenetic analysis showed that BnKAT2 is homologous to Bra013296 in B. rapa and to At4g18290 (AtKAT2) in A. thaliana (Figure 1a). The BnKAT2 protein was predicted to possess two domains, namely the potassium ion channel KHA domain and the cyclic nucleotide cAMP (CNMP)-binding domain (Figure 1c). The CNMP-binding domain consists of three α helixes and an eight-chain antiparallel β barrel-like structure. The BnKAT2 protein has four transmembrane helixes distributing at the positions of A64–A86, A101–A123, A201–A220, and A278–A300 (Figure 1b), and the proportions of α helix, β folding, and irregular crimp structures in its secondary structure (Figure 1d) are 50.29%, 9.65%, and 40.06%, respectively.

2.2. Improvement Effects of BnKAT2 on the Effective Inflorescence Length and Silique Number

BnKAT2 was overexpressed in B. napus and A. thaliana to assess its effect on inflorescence length and silique number. The primers F35S3ND+OEBnKAT2 and Bar-F+Bar-R were used to test the expression of BnKAT2 in the transgenic plants. As shown in Figure 2a, the expression level of BnKAT2 was 3.57–5.25 times higher in the transgenic lines overexpressing BnKAT2 than that in the wild-type B. napus (ZS11). Similarly, the expression level of BnKAT2 was 4.25–5.0 times higher in the transgenic lines than that in wild-type A. thaliana (Figure 2b).
The average effective inflorescence lengths of the BnKAT2-overexpressing transgenic B. napus lines and the wild type were 67.4 and 55.3 cm, respectively, with 21.8% longer inflorescences in the transgenic lines (Figure 3a). The average inflorescence silique numbers in the transgenic B. napus lines and the wild type were 95.8 and 71.3, respectively, increasing 34.3% in the transgenic lines (Figure 3a). These results indicate that BnKAT2 positively regulates the effective inflorescence length and silique number of B. napus.
The effective inflorescence length of the transgenic A. thaliana was 22.4 cm on average, which was 31.2% longer than that of the wild type (17.1 cm) (Figure 3b). The numbers of siliques produced by the main inflorescences of the transgenic and wild-type A. thaliana were 24.3 and 17.9 on average, respectively, increasing 37.3% in the transgenic plants (Figure 3b). This result is consistent with that in B. napus, which indicates the pathway may be conserved in A. thaliana and B. napus.

2.3. Analysis of Differentially Expressed Genes

An RNA-seq analysis was performed on the BnKAT2-overexpressing and wild-type B. napus plants, with 54.56 Gb of clean bases obtained after the quality control process. The proportion of reads with a false discovery rate (FDR) < 0.001 was 93.52–94.46%, and the GC content was over 46.99%, indicating that high-quality transcriptome sequencing data were obtained. A total of 4362 differentially expressed genes (DEGs) were identified between the BnKAT2-overexpressing and wild-type B. napus, including 1952 upregulated genes and 2410 downregulated genes (Figure 4a). A Venn diagram (Figure 4b) showed that 1587 genes were only expressed in the transgenic B. napus lines, while 2016 genes were only expressed in the wild type. These results indicate that BnKAT2 regulates the effective inflorescence length and silique number by influencing the expression of related genes.

2.4. GO and KEGG Enrichment Analysis on the DEGs

To explore the regulating mechanism of BnKAT2 in details, we completed the enrichment of differential genes employing GO and KEGG analysis. Gene ontology (GO) enrichment analysis was performed using |log2 fold| > 1 and p < 0.05 as the threshold for significant enrichment. According to their enrichment significance (p < 0.05), the top five GO enrichments in each category were selected for mapping (Figure 5a). In terms of the cell component functions, the major DEG categories have functions associated with the plasma membrane and the nuclear membrane. Among the molecular functions, the DEGs were mainly associated with calcium ion binding and protein binding. The DEGs associated with biological processes were mainly enriched into the intracellular signal transduction pathway and phosphorylated signal transduction pathway categories, which accounted for 1.79% and 1.64% of the DEGs, respectively, suggesting that BnKAT2 may regulate the effective inflorescence length and silique number via these pathways.
KEGG metabolic pathway analysis showed that the upregulated and downregulated DEGs were classified in 75 and 89 metabolic pathways, respectively. According to their enrichment significance (p < 0.05), the top 10 KEGG pathways were selected for mapping (Figure 5b). The DEGs were mainly enriched in plant hormone signal transduction. Among them, 24 DEGs were enriched in plant hormone signaling pathways (Table S1), with 18 of the genes downregulated in the BnKAT2-overexpressing plants found to be associated with the auxin and cytokinin signaling pathways (Figure 5c). The downregulated genes in the auxin signaling pathway belong to the Aux/IAA gene family, a negative regulator of the auxin signaling pathway. The downregulated genes in the cytokinin signaling pathway are mainly AHP6 and type-A response regulator (A-ARR) genes, which are negative feedback regulatory genes in the cytokinin signaling pathway. These results suggest that BnKAT2 may affect the effective inflorescence length and silique number through the regulation of auxin and cytokinin signal transduction.

2.5. DEGs Verification Using qRT-PCR

To verify that BnKAT2 is involved in the cytokinin and auxin signaling pathways, the expression level of key genes involved in these pathways that were significantly downregulated in the RNA-Seq data of BnKAT2-overexpressing plants were quantified using qRT-PCR. The cytokinin signaling-related genes, including BnaA06g06240D (ARR4), BnaC08g27970D (ARR9), BnaA06g22370D (ARR6), BnaA03g19410D (ARR3), and BnaC05g14720D (ARR7), were confirmed to be significantly downregulated in the BnKAT2-overexpressing plants compared to the wild type (Figure 6), as were the auxin signaling-related genes BnaCnng41350D (IAA1) and BnaA09g16590D (IAA2). Compared with the expression level in the wild type, the expression levels of the ARR genes in the BnKAT2-overexpressing plants ranged from 1.41 to 20.51, on average, while in the wild type, the expression levels ranged from 6.10 to 40.49. The expression of ARR4 showed the highest decrease in expression (83.6%) in the BnKAT2-expressing plants. The expression levels of IAA1 and IAA2 were 0.23 and 0.46, on average, in the BnKAT2-overexpressing plants and 2.42 and 2.7 in the wild type, representing a decrease of 21.8% and 58.7%, respectively. The expression patterns of the DEGs determined using qRT-PCR were therefore consistent with the RNA-seq results, confirming the reliability of RNA-Seq data.

3. Discussion

Seed yield, one of the most important goal for rapeseed breeding, is directly determined by silique number, seeds amount, and seed weight [20]. The effective length of the main inflorescence and the number of siliques it produces are closely correlated with rapeseed yield [21]. In a previous GWAS analysis (unpublished), BnKAT2 was identified as a putative regulating gene responsible for the indices mentioned above, but this had not been verified and the corresponding mechanism had not been unraveled.
In the present study, the BnKAT2-overexpressing B. napus and transgenic BnKAT2-expressing A. thaliana lines produced longer inflorescences and more siliques than their respective wild types. The BnKAT2 protein was predicted to contain a cNMP (cAMP and cGMP) binding domain, indicating that BnKAT2 may participate in intracellular signal transduction pathway. RNA-seq was performed on the BnKAT2-overexpressing and wild-type B. napus plants, and GO enrichment analysis showed that the DEGs between these genotypes were enriched in cellular signal transduction pathways. KEGG enrichment analysis showed that the DEGs were mainly enriched in the auxin and cytokinin signaling pathways.
The main DEGs in auxin pathway belonged to the Aux/IAA family, which plays key roles in the auxin response [22,23,24]. Auxin is essential for the elongation of plant stems [25,26], and for the initiation of floral meristems (FMs) as well as termination meristem growth [27]. However, the regulating mechanism on the floral organ initiation remains less mechanistically well understood than its functions in the development of other organs. Auxin can also function as a morphogen by generating response gradients, particularly in combination with the cytokinin, which are instrumental in several aspects of floral organogenesis [28]. Auxin regulates flower development in A. thaliana involving members of the AINTEGUMENTA-LIKE/PLETHORA(AIL/PLT) gene family [29]. IAA can activate guanosine cyclase, leading to the increase of endogenous cGMP in A. thaliana roots and the degradation of Aux/IAA proteins by cGMP-dependent protein kinases. This promotes the expression of the IAA-responsive genes and ultimately affects auxin signal transduction [30,31,32]. In the present study, the Aux/IAA genes (IAA1, IAA2) were downregulated in the BnKAT2-overexpressing B. napus plants, probably due to the activation of cGMP following its binding to the CNMP-binding domain in BnKAT2 proteins, which also caused the degradation of Aux/IAA protein. Thus, the inhibitory effect of the Aux/IAA proteins on the expression of the genes downstream of the auxin signaling pathway was lifted, leading to their upregulated expression, and the length of main inflorescence and the number of siliques were increased. The specific mechanism underlying this effect is yet to be fully elucidated.
It showed that, in the BnKAT2-overexpressing B. napus line, eight of the downregulated genes were involved in the cytokinin signaling pathway, seven of which belonged to the A-ARR gene family and one was AHP6 (Table 1). The ARR gene family comprises regulatory proteins that function in response to cytokinin. A-type ARRs are a family of primary cytokinin response genes, which interfere with cytokinin activity and encode phosphorus-accepting proteins of the two-component response regulator class [33,34]. WUSCHEL (WUS), a positive regulator of stem cells, directly represses the transcription of several two-component sensor-regulator ARR genes (ARR5, ARR6, ARR7, and ARR15), which act in the negative feedback loop in cytokinin signaling, suggesting that the ARR genes might negatively influence meristem size and that their repression by WUS might be necessary for meristem function [35]. Loss-of-A-type ARR function in ARR7 and ARR3,4,5,6,7,8,9 mutants strongly stimulated callus development, indicating that cell proliferation is repressed by A-type ARRs [36]. Loss of ARR activity in maize causes enlarged meristems [37]. AHP6 simultaneously inhibits the transfer of phosphate from AHP1 to ARR1 and the transfer from histidine to aspartic acid in the AHKs, suggesting that AHP6 may be a negative regulator of cytokinin signal transduction [38]. Our results suggest that BnKAT2 is involved in cytokinin signal transduction by negatively regulating the expression of A-ARR genes and AHP6. Foliar spraying of cytokinins can improve rapeseed yields by significantly increasing the number of siliques per plant, stimulating the fruit-bearing characteristics of the main inflorescence, and reducing the seed shattering rate [39]. Increased epidermal cytokinin biosynthesis or breakdown could be achieved through the expression of the cytokinin biosynthesis gene LOG4 or the cytokinin-degrading gene CKX1, respectively, under the control of the epidermis-specific AtML1 promoter in A. thaliana [40]. During vegetative growth, increased epidermal cytokinin production led to larger shoot apical meristems and promoted earlier flowering [41]. Auxin negatively regulates cytokinin biosynthesis through the iPMP-independent cytokinin biosynthesis pathway, and cytokinin and auxin act synergistically during organ initiation to jointly regulate the growth of the shoot apical meristem [42]. We speculate that BnKAT2 is involved in auxin signaling by regulating the expression of the Aux/IAA gene via binding to cGMP and in the cytokinin signaling pathway by regulating the expression of the ARR and AHP genes. Through these network pathways, BnKAT2 regulates the growth of the main inflorescence and the number of siliques in B. napus. A possible model for this BnKAT2 regulatory pathway is presented in Figure 7. However, the mechanism underlying the integration of BnKAT2 with cytokinin and auxin signaling pathways has not been fully elucidated yet.
We also noticed that BnKAT2 and AtKAT2 protein domains contain a potassium channel domain (KHA). Potassium is involved in turgor-driven processes such as cell elongation, phototropism, gravitropism, and stomatal movement [43]. The activity of K+ channels has been shown to be dependent on auxin via the activation of an auxin-binding protein and the induction of cytosolic pH changes [44,45]. Auxin-stimulated proton efflux and potassium uptake into expanding coleoptile cells affect the upregulation of the H+-ATPase [46,47] and activation of K+ uptake [48]. Re-addition of K+ or removal of K+ channel blockers in the presence of auxin leads to a rapid enhancement of coleoptile growth rates [49]. Auxin-induced growth in maize coleoptile segments involves K+ uptake through voltage-dependent, inwardly rectifying K+ channels (ZMK1, Zea mays K+ channel 1), the activity of which contributes to water uptake and consequently influences cell expansion [50]. The target of auxin action is the plasma membrane H+-ATPase, which excretes H+ into the cell wall compartment and, in an antiport, takes up K+ through an inwardly rectifying K+ channel. The auxin-enhanced H+ pumping lowers pH value in the cell wall, resulting in the activation of pH-sensitive enzymes and proteins within the wall, and cell wall loosening and extension growth [46,47,50]. It is speculated that auxin activates the K+ channel (KHA) of BnKAT2 protein through excreting H+ and stimulating K+ influx, which eventually leads to cell elongation and growth and increases the effective length of the main inflorescence.
Rapeseed siliques are not only a storage organ, but also an important photosynthetic organ, and thus play dual roles of “source” and “sink”, which further influences yields [51]. BnKAT2 affects the length of the main inflorescence and the number of siliques produced by B. napus, both of which are important factors affecting the yield. It can be employed as a target to develop markers for screening out the germplasm source for yield breeding in B. napus.
It is noteworthy that effective silique number on main inflorescence is obviously affected by the planting environment [21,52]. The yield of crop is always affected by abiotic stress, such as drought and so on [21,53]. The response of BnKAT2 to stress possibly be very important for because of the influence on the vegetative and reproductive growth of plants. BnKAT2 improves the main inflorescence length and the number of siliques under the suitable cultivation environment in the present research, which is meaningful to unravel the response mechanism to improve the yield. This study will aid theoretical research on improving rapeseed yields and also provides a new target gene for the improvement of important crops through genetic engineering. However, the effect of BnKAT2 expression on possible reproductive problems such as lack of seeds setting or others, which play an important role in yield improvement, has not been investigated in the present study.

4. Materials and Methods

4.1. Plant Materials and Growing Conditions

B. napus (ZS11) and A. thaliana (Col-0) were used in this study. The B. napus plants were grown in the experimental field of Chongqing Rapeseed Engineering Technology Research Center (29°49′08′′ N, 106°25′11′′ E; altitude of 216 m) and were cultivated and managed using conventional procedures. The A. thaliana plants were cultured in growth chamber, as described by Wang [54].

4.2. Cloning of BnKAT2 in B. napus

Appropriate B. napus leaves were harvested to extract a high-quality RNA using an RNA prep Pure Plant Kit (Tiangen, Beijing, China). The cDNA was reverse-transcribed according to the PrimeScript RT Reagent Kit with a gDNA Eraser (Perfect Real Time) kit (Takara Bio, Kusatsu, Japan). BnKAT2-specific primers (Table 1) were designed according to the genetic sequence on the NCBI website (http://www.ncbi.nlm.nih.gov/ (accessed on 2 May 2021)). Using the total B. napus cDNA as template, BnKAT2 was amplified and ligated into a pGEM-T easy vector and then was transformed into Escherichia coli DH5α cells. The positive clones were screened out and sequenced by Shenzhen Huada Gene Company (Shenzhen, China) to obtain the full-length BnKAT2 cDNA sequence.

4.3. Bioinformatics Analysis

PredictProtein and TMHMM Server v.2.0 (https://services.healthtech.dtu.dk/service.php?TMHMM-2.0 (accessed on 2 November 2020)) were used to predict the secondary structures and transmembrane domains of the BnMAPK2 protein. MEGA11.0 software (https://www.megasoftware.net/ (accessed on 2 November 2020)) was employed to align the amino acid sequences and construct the phylogenetic tree of BnKAT2. The BnKAT2 protein domains were predicted using the online software on the Prosite website (http://prosite.expasy.org/prosite.html (accessed on 2 November 2020)).

4.4. Plasmid Construction and Plant Transformation

To generate the BnKAT2 transgenic expression vector, the BnKAT2 fragment was amplified from the recombinant vector PGEM-T-BnKAT2. For the A. thaliana transformation, the BnKAT2 fragment was cloned into Pearleygate101 to make a Pearleygate101-35S-BnKAT2 construct, which was transferred into Agrobacterium tumefaciens strain GV3101 and transformed into A. thaliana Col-0 plants using the floral dip method [55]. Transgenic lines were selected on 0.5× Murashige and Skoog medium containing hygromycin (100 mg/L). For the B. napus transformation, the BnKAT2 construct was introduced into the cotyledons of B. napus using an Agrobacterium-mediated method [56]. The PCR primers used in these experiments are listed in Table 1.

4.5. Phenotypic Examination of the Transgenic Plants

The effective length of the main inflorescence (from the first silique to the last silique in the main inflorescence) and the number of siliques produced on the main inflorescence were measured at the maturity stage of the transgenic and wild-type B. napus and A. thaliana plants. The data represent three experiments for each genotype, each including genotype replicates of 20 plants.

4.6. RNA-Seq

The stem tips of the BnKAT2-overexpressing and wild-type B. napus plants at the bolting stage were harvested and immediately frozen in liquid nitrogen. The RNA-seq was performed by Beijing Nuohe Source Technology (Beijing, China). The original reads were first converted into sequencing reads using the software CLC Genomics Workbench 9 (Qiagen, Hilden, Germany), and the reads containing ambiguous bases were removed to enhance the quality of the data. The clean data were mapped to the B. napus reference genome (http://www.genoscope.cns.fr/brassicanapus/ (accessed on 5 June 2021)). Reference genome indexing and read alignments were performed using Bowtie 2.0.6 and TopHat 2.0.9 (https://magic.novogene.com/ (accessed on 5 June 2021)), respectively. The number of reads per kilobase per million mapped reads (RPKM) [57] was used to calculate the relative levels of expression. Genes with a |log2FC| > 1 and a p-value < 0.05 were considered to be differentially expressed between the two genotypes. The GOseq package (https://magic.novogene.com/ (accessed on 5 June 2021)) was used to perform a GO enrichment analysis of the DEGs. The GO terms with a corrected p-value < 0.05 were considered significantly enriched [58]. The KEGG statistical enrichment of the DEGs was evaluated using KOBAS software (http://kobas.cbi.pku.edu.cn (accessed on 5 June 2021)). The DEGs were grouped into the KEGG pathways based on their matches to the database [59].

4.7. QRT-PCR Analysis

The qRT-PCR analysis was performed on seven of the identified DEGs to test the reliability of the transcriptome sequencing data and verify the effects of BnKAT2 on the expression of genes negatively regulating the cytokinin and auxin signaling pathways. The reverse transcription was performed using a PrimeScript RT Reagent Kit (Takara Bio). The qRT-PCR was performed on a Light Cycler 480 II (Roche, Basel, Switzerland) using SYBG Premix Ex Taq II (Takara Bio), with the following cycling conditions: 95 °C for 30 s; followed by 40 cycles of 95 °C for 5 s, 60 °C for 30 s, and 60 °C for 45 s. Actin7 was used as the reference gene. The primer sequences specific to the 12 DEGs are shown in Table S1. The relative gene expression levels were calculated according to 2−ΔΔCT [60].

5. Conclusions

BnKAT2 was highly homogenous to the AtKAT2 (AT4G18290) gene in A. thaliana. The BnKAT2 protein has KHA and CNMP-binding domains and is speculated to participate in the auxin signaling pathway by regulating Aux/IAA gene expression via targeting cGMP. It also participates in the cytokinin signaling pathway by regulating the ARR gene. It integrates the auxin and cytokinin signaling pathways to regulate the effective length of the main inflorescence of B. napus, as well as the number of siliques produced.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/plants11131679/s1, Table S1: DEGs involved in plant hormone signaling pathways.

Author Contributions

Y.L. conceived and designed the study; H.W. and C.Q. conducted experiment guidance; D.Y. performed the bioinformatics analysis; D.Z., Z.W. and Y.Z. investigated inflorescence length and silique counts of the transgenic plants and wild-type plants; D.Y., Y.Z. and Z.W. helped to perform the data analysis to generate the figures; D.Y. wrote the manuscript; H.W., C.Q. and Y.L. reviewed the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Natural Science Foundation of China (31872876) and Natural Science Foundation Project of CQ (CSTC2020jcyj-msxmX0957).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Not applicable.

Acknowledgments

We are very grateful to Chongqing Rapeseed Engineering Technology Research Center for providing the B. napus ZS11 DH line seeds. We also thank Yi Fu, Zhonghui Jing, Fang Yuan, and Lijiao Meng from Southwest University, Chongqing, China, for their contributions in performing the data analysis.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Prakash, S.; Wu, X.; Bhat, S.R. History, evolution and domestication of Brassica crops. Plant Breed. Rev. 2012, 35, 19–84. [Google Scholar] [CrossRef]
  2. Li, H.; Feng, H.; Guo, C.; Yang, S.; Huang, W.; Xiong, X.; Liu, J.; Chen, G.; Liu, Q.; Xiong, L.; et al. High-throughput phenotyping accelerates the dissection of the dynamic genetic architecture of plant growth and yield improvement in rapeseed. Plant Biotechnol. J. 2020, 18, 2345–2353. [Google Scholar] [CrossRef] [PubMed]
  3. Pu, Y.; Shu, C.; Lin, C.; Xu, J.; Liu, K. Identification of a major QTL for silique length and seed weight in oilseed rape (Brassica napus L.). Theor. Appl. Genet. 2012, 125, 285–296. [Google Scholar] [CrossRef]
  4. Cai, G.; Yang, Q.; Chen, H.; Yang, Q.; Zhang, C.; Fan, C.; Zhou, Y. Genetic dissection of plant architecture and yield-related traits in Brassica napus. Sci. Rep. 2016, 16, 21625. [Google Scholar] [CrossRef] [Green Version]
  5. Dai, X.L.; Zhao, J.X.; Xiang, Y.; Ren, T.B.; Cheng, G.P. Hybrid Brassica napus: Correlation analysis of main inflorescence length and plant traits. Chin. Agric. Sci. Bull. 2018, 34, 42–48. [Google Scholar]
  6. Tuncturk, M.; Ciftci, V. Relationship between yield and some yield components in rapeseed (Brassica napus ssp. oleifera L.) cultivars by using correlation and path analysis. Pak. J. Bot. 2007, 39, 81–84. [Google Scholar] [CrossRef]
  7. Ma, N.; Yuan, J.; Li, M.; Li, J.; Zhang, L.; Liu, L.; Naeem, M.S.; Zhang, C. Ideotype population exploration: Growth, photosynthesis, and yield components at different planting densities in winter oilseed rape (Brassica napus L.). PLoS ONE 2014, 9, e114232. [Google Scholar] [CrossRef]
  8. Khan, S.; Anwar, S.; Kuai, J.; Ullah, S.; Fahad, S.; Zhou, G. Optimization of nitrogen rate and planting density for improving uield, nitrogen use efficiency, and lodging resistance in oilseed rape. Front. Plant Sci. 2017, 8, 532. [Google Scholar] [CrossRef] [Green Version]
  9. Ren, Y.Y.; Cui, C.; Wang, Q.; Tang, Z.L.; Xu, X.F.; Ling, N.; Ying, J.M.; Li, J.N.; Zhou, Q.Y. Genome-Wide Association Analysis of silique density on racemes and its component traits in Brassica napus. Sci. Agric. Sin. 2018, 51, 1014–1033. [Google Scholar]
  10. Phillips, A.L.; Huttly, A.K. Cloning of two gibberellin-regulated cDNAs from A. thaliana by subtractive hybridization: Expression of the tonoplast water channel, gamma-TIP, is increased by GA3. Plant Mol. Biol. 1994, 24, 603–615. [Google Scholar] [CrossRef]
  11. Shi, J.X.; Malitsky, S.; De Oliveira, S.; Branigan, C.; Franke, R.B.; Schreiber, L.; Aharoni, A. SHINE transcription factors act redundantly to pattern the archetypal surface of Arabidopsis thaliana Flower Organs. PLoS Genet. 2011, 7, e1001388. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  12. Li, L.; He, Y.; Wang, Y.; Zhao, S.; Chen, X.; Ye, T.; Wu, Y.; Wu, Y.A. thaliana PLC2 is involved in auxin-modulated reproductive development. Plant J. 2015, 84, 504–515. [Google Scholar] [CrossRef] [Green Version]
  13. Di Fino, L.M.; D’Ambrosio, J.M.; Tejos, R.; van Wijk, R.; Lamattina, L.; Munnik, T.; Pagnussat, G.C.; Laxalt, A.M. Arabidopsis thaliana phosphatidylinositol-phospholipase C2 (PLC2) is required for female gametogenesis and embryo development. Planta 2016, 245, 717–728. [Google Scholar] [CrossRef] [Green Version]
  14. Han, D.P.; Zhou, C.; Zheng, Y.Z.; Fu, D.J.; Zhou, Q.H. Genome-wide association analysis of main inflorescence traits in Brassica napus. J. Nucl. Agric. Sci. 2018, 32, 463–476. [Google Scholar]
  15. Zhu, J.; Zhang, G.Q.; Chang, Y.H.; Chang, Y.H.; Li, X.C.; Yang, J.; Huang, X.Y.; Yu, Q.B.; Chen, H.; Wu, T.L.; et al. AtMYB103 is a crucial regulator of several pathways affecting Arabidopsis thaliana anther development. Sci. China Life Sci. 2010, 53, 1112–1122. [Google Scholar] [CrossRef]
  16. Guo, X.; Lu, W.; Ma, Y.; Qin, Q.; Hou, S. The BIG gene is required for auxin-mediated organ growth in Arabidopsis thaliana. Planta 2013, 237, 1135–1147. [Google Scholar] [CrossRef]
  17. Yang, P.; Smalle, J.; Lee, S.; Yan, N.; Emborg, T.J.; Vierstra, R.D. Ubiquitin C-terminal hydrolases 1 and 2 affect shoot architecture in Arabidopsis thaliana. Plant J. 2007, 51, 441–457. [Google Scholar] [CrossRef]
  18. Lebaudy, A.; Vavasseur, A.; Hosy, E.; Dreyer, I.; Leonhardt, N.; Thibaud, J.B.; Véry, A.A.; Simonneau, T.; Sentenac, H. Plant adaptation to fluctuating environment and biomass production are strongly dependent on guard cell potassium channels. Proc. Natl. Acad. Sci. USA 2008, 105, 5271–5276. [Google Scholar] [CrossRef] [Green Version]
  19. Lebaudy, A.; Pascaud, F.; Véry, A.A.; Alcon, C.; Dreyer, I.; Thibaud, J.B.; Lacombe, B. Preferential KAT1-KAT2 heteromerization determines inward K+ current properties in Arabidopsis thaliana guard cells. J. Biol. Chem. 2010, 285, 6265–6274. [Google Scholar] [CrossRef] [Green Version]
  20. Özer, H.; Oral, E.; Dogru, U. Relationships between yield and yield components on currently improved spring rapeseed cultivars. Turk. J. Agric. For. 1999, 23, 603–607. [Google Scholar]
  21. Chen, W.; Zhang, Y.; Liu, X.; Chen, B.; Tu, J.; Tingdong, F. Detection of QTL for six yield-related traits in oilseed rape (Brassica napus) using DH and immortalized F(2) populations. Theor. Appl. Genet. 2007, 115, 849–858. [Google Scholar] [CrossRef] [PubMed]
  22. Gray, W.M.; Kepinski, S.; Rouse, D.; Leyser, O.; Estelle, M. Auxin regulates SCF (TIRI)-dependent degradation of AUX, IAA proteins. Nature 2001, 414, 271–276. [Google Scholar] [CrossRef] [PubMed]
  23. Abel, S.; Nguyen, M.D.; Theologis, A. The PS-IAA4/5-like family of early auxin-inducible mRNAs in Arabidopsis thaliana. J. Mol. Biol. 1995, 251, 533–549. [Google Scholar] [CrossRef]
  24. Reed, J.W. Roles and activities of Aux/IAA proteins in Arabidopsis thaliana. Trends Plant Sci. 2001, 6, 420–425. [Google Scholar] [CrossRef]
  25. Ross, J.J.; O’Neill, D.P.; Wolbang, C.M.; Symons, G.M.; Reid, J.B. Auxin- gibberell in interactions and their role in plant growth. J. Plant Growth Regul. 2001, 20, 336–353. [Google Scholar] [CrossRef]
  26. Yin, C.; Gan, L.; Ng, D.; Zhou, X.; Xia, K. Decreased panicle derived indole- 3- acetic acid reduces gibberellin A1 level in the uppermost internode, causing panicle enclosure in male sterile rice Zhenshan 97A. J. Exp. Bot. 2007, 58, 2441–2449. [Google Scholar] [CrossRef] [Green Version]
  27. Chandler, J.; Werr, W. DORNRÖSCHEN, DORNRÖSCHEN-LIKE, and PUCHI redundantly control floral meristem identity and organ initiation in Arabidopsis. J. Exp. Bot. 2017, 68, 3457–3472. [Google Scholar] [CrossRef]
  28. Su, Z.; Zhao, L.; Zhao, Y.; Li, S.; Won, S.; Cai, H.; Wang, L.; Li, Z.; Chen, P.; Qin, Y. The THO complex non-cell-autonomously represses female germline specification through the TAS3-ARF3 module. Curr. Biol. 2017, 27, 1597–1609. [Google Scholar] [CrossRef] [Green Version]
  29. Krizek, B.A. Auxin regulation of A. thaliana flower development involves members of the AINTEGUMENTA-LIKE/PLETHORA (AIL/PLT) family. J. Exp. Bot. 2011, 62, 3311–3319. [Google Scholar] [CrossRef] [Green Version]
  30. Isner, J.C.; Nühse, T.; Maathuis, F.J. The cyclic nucleotide cGMP is involved in plant hormone signaling and alters phosphorylation of Arabidopsis thaliana root proteins. J. Exp. Bot. 2012, 63, 3199–3205. [Google Scholar] [CrossRef] [Green Version]
  31. Nan, W.; Wang, X.; Yang, L.; Hu, Y.; Wei, Y.; Liang, X.; Mao, L.; Bi, Y. Cyclic GMP is involved in auxin signaling during Arabidopsis thaliana root growth and development. J. Exp. Bot. 2014, 65, 1571–1583. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  32. Gehring, C.; Turek, I.S. Cyclic nucleotide monophosphates and their cyclases in plant signaling. Front. Plant Sci. 2017, 8, 1704. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  33. To, J.P.; Haberer, G.; Ferreira, F.J.; Deruere, J.; Mason, M.G.; Schaller, G.E.; Alonso, J.M.; Ecker, J.R.; Kieber, J.J. Type-A Arabidopsis thaliana response regulators are partially redundant negative regulators of cytokinin signaling. Plant Cell 2004, 16, 658–671. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  34. Kiba, T.; Aoki, K.; Sakakibara, H.; Mizuno, T. Arabidopsis thaliana response regulator, ARR22, ectopic expression of which results in phenotypes similar to the wol cytokinin-receptor mutant. Plant Cell Physiol. 2004, 45, 1063–1077. [Google Scholar] [CrossRef]
  35. Leibfried, A.; To, J.P.; Busch, W.; Stehling, S.; Kehle, A.; Demar, M.; Kieber, J.J.; Lohmann, J.U. WUSCHEL controls meristem function by direct regulation of cytokinin-inducible response regulators. Nature 2005, 438, 1172–1175. [Google Scholar] [CrossRef]
  36. Andersen, S.U.; Kieber, J.J.; Lohmann, J.U. Role of A-type ARABIDOPSIS RESPONSE REGULATORS in meristem maintenance and regeneration. Eur. J. Cell Biol. 2010, 89, 279–284. [Google Scholar] [CrossRef]
  37. Giulini, A.; Wang, J.; Jackson, D. Control of phyllotaxy by the cytokinin-inducible response regulator homologue ABPHYL1. Nature 2004, 430, 1031–1034. [Google Scholar] [CrossRef]
  38. Mahonen, A.P.; Bishopp, A.; Higuchi, M.; Nieminen, K.M.; Kinoshita, K.; Tormakangas, K.; Keda, Y.; Oka, A.; Kakimoto, T.; Helariutta, Y. Cytokinin signaling and its inhibitor AHP6 regulate cell fate during vascular development. Science 2006, 311, 94–98. [Google Scholar] [CrossRef]
  39. Schwarz, I.; Scheirlinck, M.T.; Otto, E.; Bartrina, I.; Schmidt, R.C.; Schmülling, T. Cytokinin regulates the activity of the inflorescence meristem and components of seed yield in oilseed rape. J. Exp. Bot. 2020, 71, 7146–7159. [Google Scholar] [CrossRef]
  40. Werner, S.; Bartrina, I.; Novák, O.; Strnad, M.; Werner, T.; Schmülling, T. The cytokinin status of the epidermis regulates aspects of vegetative and reproductive development in Arabidopsis thaliana. Front. Plant Sci. 2021, 23, 613488. [Google Scholar] [CrossRef]
  41. Powell, G.K.; Hommes, N.G.; Kuo, J.; Castle, L.A.; Morris, R.O. Inducible expression of cytokinin biosynthesis in Agrobacterium tumefaciens by plant phenolics. Mol. Plant Microbe Interact. 1988, 1, 235–242. [Google Scholar] [CrossRef] [PubMed]
  42. Besnard, F.; Rozier, F.; Vernoux, T. The AHP6 cytokinin signaling inhibitor mediates an auxin-cytokinin crosstalk that regulates the timing of organ initiation at the shoot apical meristem. Plant Signal. Behav. 2014, 9, 1559–2324. [Google Scholar] [CrossRef] [Green Version]
  43. McLean, R.M.; Wang, N.X. Potassium. Adv. Food Nutr. Res. 2021, 96, 89–121. [Google Scholar] [CrossRef] [PubMed]
  44. Thiel, G.; Blatt, M.R.; Fricker, M.D. Modulation of K+ channels in Vicia stomatal guard cells by peptide homologs to the auxin binding protein C-terminus. Proc. Natl. Acad. Sci. USA 1994, 90, 11493–11497. [Google Scholar] [CrossRef] [Green Version]
  45. Blatt, M.R.; Grabov, A. Signal redundancy, gates and integration in the control of ion channels for stomatal movement. J. Exp. Bot. 1997, 48, 529–537. [Google Scholar] [CrossRef] [PubMed]
  46. Senn, A.P.; Goldsmith, M.H. Regulation of electro-genic proton pumping by auxin and fusicoccin as related to the growth of Avena coleoptiles. Plant Physiol. 2019, 88, 131–138. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  47. Frias, I.; Caldeira, M.T.; Perez-Castineira, J.R.; Navarro-Avino, J.P.; Culianez-Macia, F.A.; Kuppinger, O.; Stransky, H.; Pagès, M.; Hager, A.; Serrano, R. A major isoform of the maize plasma membrane H+-ATPase: Characterization and induction by auxin in coleoptiles. Plant Cell 1996, 8, 1533–1544. [Google Scholar] [CrossRef] [Green Version]
  48. Christian, M.; Steffens, B.D. How does auxin enhance cell elongation? roles of auxin-binding proteins and potassium channels in growth control. Plant Biol. 2010, 8, 346–352. [Google Scholar] [CrossRef]
  49. Becker, D.; Hedrich, R. Channelling auxin action: Modulation of ion transport by indole-3-acetic acid. Plant Mol. Biol. 2002, 49, 349–356. [Google Scholar] [CrossRef]
  50. Hager, A. Role of the plasma membrane H+-ATPase in auxin-induced elongation growth: Historical and new aspects. J. Plant Res. 2003, 116, 483–505. [Google Scholar] [CrossRef]
  51. Chen, L.; Chen, L.; Zhang, X.; Liu, T.; Niu, S.; Wen, J.; Yi, B.; Ma, C.; Tu, J.; Fu, T.; et al. Identification of miRNAs that regulate silique development in Brassica napus. Plant Sci. 2018, 269, 106–117. [Google Scholar] [CrossRef] [PubMed]
  52. Zhu, Z.H.; Cheng, Y.; Ma, S.J.; He, C.; Zhen, W.Y.; Zhou, K.J.; Ma, Y.S. Genetics of effective silique number on main inflorescence of new germplasm 12R1402(Brassica napus L.). Chin. J. Oil Crop Sci. 2016, 38, 287–291. [Google Scholar]
  53. Wilmowicz, E.; Ku’ko, A.; Burchardt, S.; Przywieczerski, T. Molecular and hormonal aspects of drought-triggered flower shedding in yellow lupine. Int. J. Mol. Sci. 2019, 20, 3731. [Google Scholar] [CrossRef] [Green Version]
  54. Wang, Z.; Wan, Y.; Meng, X.; Zhang, X.; Yao, M.; Miu, W.; Zhu, D.; Yuan, D.; Lu, K.; Li, J.; et al. Genome-wide identification and analysis of MKK and MAPK gene families in Brassica species and response to stress in Brassica napus. Int. J. Mol. Sci. 2021, 22, 544. [Google Scholar] [CrossRef] [PubMed]
  55. Lough, S.J.; Bent, A.F. Floral dip: A simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J. 1998, 16, 735–743. [Google Scholar] [CrossRef] [Green Version]
  56. Wang, Y.; Wu, W.H. Potassium transport and signaling in higher plants. Annu. Rev. Plant Biol. 2013, 64, 451–476. [Google Scholar] [CrossRef] [Green Version]
  57. Mortazavi, A.; Williams, B.A.; McCue, K.; Schaeffer, L.; Wold, B. Mapping and quantifying mammalian transcriptomes by RNA-Seq. Nat. Methods 2008, 5, 621–628. [Google Scholar] [CrossRef]
  58. Young, M.D.; Wakefield, M.J.; Smyth, G.K.; Oshlack, A. Gene ontology analysis for RNA-seq: Accounting for selection bias. Genome Biol. 2010, 11, R14. [Google Scholar] [CrossRef] [Green Version]
  59. Kanehisa, M.; Araki, M.; Goto, S.; Hattori, M.; Hirakawa, M.; Itoh, M.; Katayama, T.; Kawashima, S.; Okuda, S.; Tokimatsu, T.; et al. KEGG for linking genomes to life and the environment. Nucleic Acids Res. 2008, 36, 480–484. [Google Scholar] [CrossRef]
  60. Arocho, A.; Chen, B.; Ladanyi, M.; Pan, Q. Validation of the 2-DeltaDeltaCt calculation as an alternate method of data analysis for quantitative PCR of BCR-ABL P210 transcripts. Diagn. Mol. Pathol. 2006, 15, 56–61. [Google Scholar] [CrossRef]
Figure 1. Bioinformatics analysis of the BnKAT2 gene. (a) Phylogenetic tree. (b) Transmembrane structure of the BnKAT2 protein. The blue line, thick red line, and pink line represent the area inside the membrane (A1–A63; A124–A200; A301–A684), the transmembrane region (A64–A86; A101–A123; A201–A220; A278–A300), and the area outside the membrane (A87–A100; A221–A277), respectively. (c) Protein domains of BnKAT2 (BnaA01g09060D). (d) Secondary structure of the BnKAT2 protein. The red rectangle indicates the α-helix, the blue rectangle indicates the β-sheet, and the rest of the sequence is random coils; the red rhombus indicates a protein binding site.
Figure 1. Bioinformatics analysis of the BnKAT2 gene. (a) Phylogenetic tree. (b) Transmembrane structure of the BnKAT2 protein. The blue line, thick red line, and pink line represent the area inside the membrane (A1–A63; A124–A200; A301–A684), the transmembrane region (A64–A86; A101–A123; A201–A220; A278–A300), and the area outside the membrane (A87–A100; A221–A277), respectively. (c) Protein domains of BnKAT2 (BnaA01g09060D). (d) Secondary structure of the BnKAT2 protein. The red rectangle indicates the α-helix, the blue rectangle indicates the β-sheet, and the rest of the sequence is random coils; the red rhombus indicates a protein binding site.
Plants 11 01679 g001
Figure 2. The expression of BnKAT2 in transgenic B. napus (a) and A. thaliana (b), relative to their respective wild-type expression levels. Values are means ± SD of three independent biological replicates. *** indicate significant differences at the 0.001 levels.
Figure 2. The expression of BnKAT2 in transgenic B. napus (a) and A. thaliana (b), relative to their respective wild-type expression levels. Values are means ± SD of three independent biological replicates. *** indicate significant differences at the 0.001 levels.
Plants 11 01679 g002
Figure 3. Comparison of the effective main inflorescence length and number of siliques produced by the transgenic and wild-type B. napus (a) and A. thaliana (b) plants. Data are means ± SD (n = 3 biological replicates of 20 plants per genotype). *, **, and *** indicate significant differences at the 0.05, 0.01, and 0.001 levels, respectively.
Figure 3. Comparison of the effective main inflorescence length and number of siliques produced by the transgenic and wild-type B. napus (a) and A. thaliana (b) plants. Data are means ± SD (n = 3 biological replicates of 20 plants per genotype). *, **, and *** indicate significant differences at the 0.05, 0.01, and 0.001 levels, respectively.
Plants 11 01679 g003
Figure 4. Volcano (a) and Venn diagram (b) of the significant DEGs between the BnKAT2-overexpressing (OE) and wild-type (WT) B. napus.
Figure 4. Volcano (a) and Venn diagram (b) of the significant DEGs between the BnKAT2-overexpressing (OE) and wild-type (WT) B. napus.
Plants 11 01679 g004
Figure 5. Functional analysis of the differentially expressed genes (DEGs) between the BnKAT2-overexpressing and wild-type B. napus plants. (a) GO enrichment of DEGs. (b) KEGG enrichment of DEGs. (c) Phytohormone signaling pathways associated with the genes downregulated (green) and upregulated (red) in the BnKAT2-overexpressing plants.
Figure 5. Functional analysis of the differentially expressed genes (DEGs) between the BnKAT2-overexpressing and wild-type B. napus plants. (a) GO enrichment of DEGs. (b) KEGG enrichment of DEGs. (c) Phytohormone signaling pathways associated with the genes downregulated (green) and upregulated (red) in the BnKAT2-overexpressing plants.
Plants 11 01679 g005
Figure 6. qRT-PCR verification of some of the DEGs identified in the RNA-seq analysis. The relative expression values for the RNA-seq data are the average fragments per kilobase of exon per million mapped fragments (FPKM) values of three biological replicates. The qRT-PCR value represents the mean relative expression values. Values suggest means ± SD of three independent biological replicates.
Figure 6. qRT-PCR verification of some of the DEGs identified in the RNA-seq analysis. The relative expression values for the RNA-seq data are the average fragments per kilobase of exon per million mapped fragments (FPKM) values of three biological replicates. The qRT-PCR value represents the mean relative expression values. Values suggest means ± SD of three independent biological replicates.
Plants 11 01679 g006
Figure 7. Regulation model of BnKAT2 on the effective length of the main inflorescence and number of siliques in B. napus. (1) BnKAT2 participates in the auxin signaling pathway by regulating the expression of Aux/IAA by cGMP. (2) BnKAT2 participates in the auxin signaling pathway by regulating the expression of AHP and ARR genes.
Figure 7. Regulation model of BnKAT2 on the effective length of the main inflorescence and number of siliques in B. napus. (1) BnKAT2 participates in the auxin signaling pathway by regulating the expression of Aux/IAA by cGMP. (2) BnKAT2 participates in the auxin signaling pathway by regulating the expression of AHP and ARR genes.
Plants 11 01679 g007
Table 1. Primers used in this study.
Table 1. Primers used in this study.
Primer NameForward Primer (5′–3′)Reverse Primer (5′–3′)
BnKAT2ATGTCAATCTCTTGCACTAGAAACTTCTTTTCAAGAGTCTATGCTTTCAAGCTCAC
BnKAT2qCAACATTGTCAATGGCTTCTTTGCTGGAATGGAGCTGTGGAGCAGA
ACT7TGGGTTTGCTGGTGACGATACGGATCCTAGCAGCTCAGATGTTGA
OE-BnKAT2CACCATGTCAATCTCTTGCACTAGAAACTTCTTTGAGAGTCTATGCTTTCAAGCTCACTG
35S3NDF-RPA3NDGGAAGTTCATTTCATTTGGAGAGAGAGTCTATGCTTTCAAGCTCACTG
BarCGACATCCGCCGTGCCACCGACAAATCTCGGTGACGGGCAGG
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Yuan, D.; Zhang, Y.; Wang, Z.; Qu, C.; Zhu, D.; Wan, H.; Liang, Y. BnKAT2 Positively Regulates the Main Inflorescence Length and Silique Number in Brassica napus by Regulating the Auxin and Cytokinin Signaling Pathways. Plants 2022, 11, 1679. https://doi.org/10.3390/plants11131679

AMA Style

Yuan D, Zhang Y, Wang Z, Qu C, Zhu D, Wan H, Liang Y. BnKAT2 Positively Regulates the Main Inflorescence Length and Silique Number in Brassica napus by Regulating the Auxin and Cytokinin Signaling Pathways. Plants. 2022; 11(13):1679. https://doi.org/10.3390/plants11131679

Chicago/Turabian Style

Yuan, Dashuang, Yin Zhang, Zhen Wang, Cunmin Qu, Dongming Zhu, Huafang Wan, and Ying Liang. 2022. "BnKAT2 Positively Regulates the Main Inflorescence Length and Silique Number in Brassica napus by Regulating the Auxin and Cytokinin Signaling Pathways" Plants 11, no. 13: 1679. https://doi.org/10.3390/plants11131679

APA Style

Yuan, D., Zhang, Y., Wang, Z., Qu, C., Zhu, D., Wan, H., & Liang, Y. (2022). BnKAT2 Positively Regulates the Main Inflorescence Length and Silique Number in Brassica napus by Regulating the Auxin and Cytokinin Signaling Pathways. Plants, 11(13), 1679. https://doi.org/10.3390/plants11131679

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop