Immunostimulatory Effects of Guanine-Quadruplex Topologies as Scaffolds for CpG Oligodeoxynucleotides
Abstract
1. Introduction
2. Materials and Methods
2.1. ODNs
2.2. G4 Structure Formation
2.3. Circular Dichroism Spectroscopy
2.4. Polyacrylamide Gel Electrophoresis (PAGE)
2.5. Size Exclusion Chromatography (SEC-HPLC)
2.6. Purity Analysis via NMR
2.7. Serum Stability Assay
2.8. Cell Culture
2.9. Quantification of Immunostimulatory Activity
2.10. Quantification of Cellular Uptake
2.11. Confocal Microscopy
2.12. Immunoprecipitation Assay
2.13. Statistical Analysis
3. Results
3.1. Design and Characterization of G4 CpG ODNs
3.2. Effect of G4 Topology on the Immunostimulatory Activity of CpG ODNs
3.3. Effect of G4 Topology on Thermal Stability and Nuclease Resistance
3.4. Effect of G4 Topology on Cellular Uptake of CpG ODNs
3.5. Investigation of the Uptake Receptor for G4 CpG ODNs
3.6. TLR9 Affinity of G4 CpG ODNs and Immune Response
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Mogensen, T.H. Pathogen recognition and inflammatory signaling in innate immune defenses. Clin. Microbiol. Rev. 2009, 22, 240–273. [Google Scholar] [CrossRef] [PubMed]
- Klinman, D.M.; Yi, A.-K.; Beaucage, S.L.; Conover, J.; Krieg, A.M. CpG motifs present in bacteria DNA rapidly induce lymphocytes to secrete interleukin 6, interleukin 12, and interferon gamma. Proc. Natl. Acad. Sci. USA 1996, 93, 2879–2883. [Google Scholar] [CrossRef] [PubMed]
- Häcker, G.; Redecke, V.; Häcker, H. Activation of the immune system by bacterial CpG-DNA. Immunology 2002, 105, 245–251. [Google Scholar] [CrossRef] [PubMed]
- Klinman, D.M. Immunotherapeutic uses of CpG oligodeoxynucleotides. Nat. Rev. Immunol. 2004, 4, 249–259. [Google Scholar] [CrossRef] [PubMed]
- Krieg, A.M. Toll-like receptor 9 (TLR9) agonists in the treatment of cancer. Oncogene 2008, 27, 161–167. [Google Scholar] [CrossRef] [PubMed]
- Segal, B.M.; Chang, J.T.; Shevach, E.M. CpG oligonucleotides are potent adjuvants for the activation of autoreactive encephalitogenic T cells in vivo. J. Immunol. 2000, 164, 5683–5688. [Google Scholar] [CrossRef] [PubMed]
- Tsunoda, I.; Tolley, N.D.; Theil, D.J.; Whitton, J.L.; Kobayashi, H.; Fujinami, R.S. Exacerbation of viral and autoimmune animal models for multiple sclerosis by bacterial DNA. Brain Pathol. 1999, 9, 481–493. [Google Scholar] [CrossRef] [PubMed]
- Lipford, G.B.; Sparwasser, T.; Zimmermann, S.; Heeg, K.; Wagner, H. CpG-DNA-mediated transient lymphadenopathy is associated with a state of Th1 predisposition to antigen-driven responses. J. Immunol. 2000, 165, 1228–1235. [Google Scholar] [CrossRef]
- Onel, B.; Lin, C.; Yang, D. DNA G-quadruplex and its potential as anticancer drug target. Sci. China Chem. 2014, 57, 1605–1614. [Google Scholar] [CrossRef] [PubMed]
- Spiegel, J.; Adhikari, S.; Balasubramanian, S. The structure and function of DNA G-quadruplexes. Trends Chem. 2020, 2, 123–136. [Google Scholar] [CrossRef] [PubMed]
- Sen, D.; Gilbert, W. A sodium-potassium switch in the formation of four-stranded G4-DNA. Nature 1990, 344, 410–414. [Google Scholar] [CrossRef]
- Sen, D.; Gilbert, W. Formation of parallel four-stranded complexes by guanine-rich motifs in DNA and its implications for meiosis. Nature 1988, 334, 364–366. [Google Scholar] [CrossRef] [PubMed]
- Sundquist, W.I.; Klug, A. Telomeric DNA dimerizes by formation of guanine tetrads between hairpin loops. Nature 1989, 342, 825–829. [Google Scholar] [CrossRef] [PubMed]
- Safitri, F.A.; Tu, A.T.T.; Hoshi, K.; Shobo, M.; Zhao, D.; Witarto, A.B.; Sumarsono, S.H.; Giri-Rachman, E.A.; Tsukakoshi, K.; Ikebukuro, K. Enhancement of the immunostimulatory effect of phosphodiester CpG oligodeoxynucleotides by an antiparallel guanine-quadruplex structural scaffold. Biomolecules 2021, 11, 1617. [Google Scholar] [CrossRef] [PubMed]
- Hoshi, K.; Yamazaki, T.; Sugiyama, Y.; Tsukakoshi, K.; Tsugawa, W.; Sode, K.; Ikebukuro, K. G-quadruplex structure improves the immunostimulatory effects of CpG oligonucleotides. Nucleic Acid Ther. 2019, 29, 224–229. [Google Scholar] [CrossRef]
- Tu, A.T.T.; Hoshi, K.; Ma, Y.; Oyama, T.; Suzuki, S.; Tsukakoshi, K.; Nagasawa, K.; Ikebukuro, K.; Yamazaki, T. Effects of G-quadruplex ligands on the topology, stability, and immunostimulatory properties of G-quadruplex-based CpG oligodeoxynucleotides. ACS Chem. Biol. 2022, 17, 1703–1713. [Google Scholar] [CrossRef] [PubMed]
- Yuan, W.F.; Wan, L.Y.; Peng, H.; Zhong, Y.M.; Cai, W.L.; Zhang, Y.Q.; Ai, W.B.; Wu, J.F. The influencing factors and functions of DNA G-quadruplexes. Cell Biochem. Funct. 2020, 38, 524–532. [Google Scholar] [CrossRef] [PubMed]
- Ma, Y.; Iida, K.; Nagasawa, K. Topologies of G-quadruplex: Biological functions and regulation by ligands. Biochem. Biophys. Res. Commun. 2020, 531, 3–17. [Google Scholar] [CrossRef] [PubMed]
- Luu, K.N.; Phan, A.T.; Kuryavyi, V.; Lacroix, L.; Patel, D.J. Structure of the human telomere in K+ solution: An intramolecular (3+1) G-quadruplex scaffold. J. Am. Chem. Soc. 2006, 128, 9963–9970. [Google Scholar] [CrossRef]
- Miyoshi, D.; Nakao, A.; Sugimoto, N. Structural transition from antiparallel to parallel G-quadruplex of d(G4T4G4) induced by Ca2+. Nucleic Acids Res. 2003, 31, 1156–1163. [Google Scholar] [CrossRef] [PubMed]
- Phan, A.T.; Modi, Y.S.; Patel, D.J. Propeller-type parallel-stranded G-quadruplexes in the human c-myc promoter. J. Am. Chem. Soc. 2004, 126, 8710–8716. [Google Scholar] [CrossRef] [PubMed]
- Hazel, P.; Huppert, J.; Balasubramanian, S.; Neidle, S. Loop-length-dependent folding of G-quadruplexes. J. Am. Chem. Soc. 2004, 126, 16405–16415. [Google Scholar] [CrossRef]
- Devi, G.; Winnerdy, F.R.; Ang, J.C.Y.; Lim, K.W.; Phan, A.T. Four-layered intramolecular parallel G-quadruplex with non-nucleotide loops: An ultra-stable self-folded DNA nano-scaffold. ACS Nano 2021, 16, 533–540. [Google Scholar] [CrossRef] [PubMed]
- Smargiasso, N.; Rosu, F.; Hsia, W.; Colson, P.; Baker, E.S.; Bowers, M.T.; De Pauw, E.; Gabelica, V. G-quadruplex DNA assemblies: Loop length, cation identity, and multimer formation. J. Am. Chem. Soc. 2008, 130, 10208–10216. [Google Scholar] [CrossRef] [PubMed]
- Tu, A.T.T.; Hoshi, K.; Ikebukuro, K.; Hanagata, N.; Yamazaki, T. Monomeric G-quadruplex-based CpG oligodeoxynucleotides as potent toll-like receptor 9 agonists. Biomacromolecules 2020, 21, 3644–3657. [Google Scholar] [CrossRef]
- Mergny, J.L.; Lacroix, L. UV melting of G-quadruplexes. Curr. Protoc. Nucleic Acid Chem. 2009, 37, 17.1.1–17.1.15. [Google Scholar] [CrossRef]
- Piotto, M.; Saudek, V.; Sklenář, V. Gradient-tailored excitation for single-quantum NMR spectroscopy of aqueous solutions. J. Biomol. NMR 1992, 2, 661–665. [Google Scholar] [CrossRef]
- Le, N.B.T.; Tu, A.T.T.; Zhao, D.; Yoshikawa, C.; Kawakami, K.; Kaizuka, Y.; Yamazaki, T. Influence of the Charge Ratio of Guanine-Quadruplex Structure-Based CpG Oligodeoxynucleotides and Cationic DOTAP Liposomes on Cytokine Induction Profiles. Biomolecules 2023, 13, 1639. [Google Scholar] [CrossRef] [PubMed]
- Umemura, K.; Ohtsuki, S.; Nagaoka, M.; Kusamori, K.; Inoue, T.; Takahashi, Y.; Takakura, Y.; Nishikawa, M. Critical contribution of macrophage scavenger receptor 1 to the uptake of nanostructured DNA by immune cells. Nanomedicine: Nanotechnology. Biol. Med. 2021, 34, 102386. [Google Scholar]
- Cheng, M.; Cheng, Y.; Hao, J.; Jia, G.; Zhou, J.; Mergny, J.-L.; Li, C. Loop permutation affects the topology and stability of G-quadruplexes. Nucleic Acids Res. 2018, 46, 9264–9275. [Google Scholar] [CrossRef] [PubMed]
- Yamamoto, Y.; Araki, H.; Shinomiya, R.; Hayasaka, K.; Nakayama, Y.; Ochi, K.; Shibata, T.; Momotake, A.; Ohyama, T.; Hagihara, M. Structures and catalytic activities of complexes between heme and all parallel-stranded monomeric G-quadruplex DNAs. Biochemistry 2018, 57, 5938–5948. [Google Scholar] [CrossRef] [PubMed]
- del Villar-Guerra, R.; Trent, J.O.; Chaires, J.B. Back Cover: G-Quadruplex Secondary Structure Obtained from Circular Dichroism Spectroscopy (Angew. Chem. Int. Ed. 24/2018). Angew. Chem. Int. Ed. 2018, 57, 7256. [Google Scholar] [CrossRef]
- Zhou, B.; Geng, Y.; Liu, C.; Miao, H.; Ren, Y.; Xu, N.; Shi, X.; You, Y.; Lee, T.; Zhu, G. Characterizations of distinct parallel and antiparallel G-quadruplexes formed by two-repeat ALS and FTD related GGGGCC sequence. Sci. Rep. 2018, 8, 2366. [Google Scholar] [CrossRef] [PubMed]
- del Villar-Guerra, R.; Trent, J.O.; Chaires, J.B. G-quadruplex secondary structure obtained from circular dichroism spectroscopy. Angew. Chem. 2018, 130, 7289–7293. [Google Scholar] [CrossRef]
- Iliev, D.B.; Skjæveland, I.; Jørgensen, J.B. CpG oligonucleotides bind TLR9 and RRM-Containing proteins in Atlantic Salmon (Salmo salar). BMC Immunol. 2013, 14, 12. [Google Scholar] [CrossRef] [PubMed]
- Nagaoka, M.; Liao, W.; Kusamori, K.; Nishikawa, M. Targeted Delivery of Immunostimulatory CpG Oligodeoxynucleotides to Antigen-Presenting Cells in Draining Lymph Nodes by Stearic Acid Modification and Nanostructurization. Int. J. Mol. Sci. 2022, 23, 1350. [Google Scholar] [CrossRef]
- Yakubov, L.A.; Deeva, E.A.; Zarytova, V.F.; Ivanova, E.M.; Ryte, A.S.; Yurchenko, L.V.; Vlassov, V.V. Mechanism of oligonucleotide uptake by cells: Involvement of specific receptors? Proc. Natl. Acad. Sci. USA 1989, 86, 6454–6458. [Google Scholar] [CrossRef] [PubMed]
- Loke, S.; Stein, C.; Zhang, X.; Mori, K.; Nakanishi, M.; Subasinghe, C.; Cohen, J.; Neckers, L. Characterization of oligonucleotide transport into living cells. Proc. Natl. Acad. Sci. USA 1989, 86, 3474–3478. [Google Scholar] [CrossRef]
- Kimura, Y.; Sonehara, K.; Kuramoto, E.; Makino, T.; Yamamoto, S.; Yamamoto, T.; Kataoka, T.; Tokunaga, T. Binding of oligoguanylate to scavenger receptors is required for oligonucleotides to augment NK cell activity and induce IFN. J. Biochem. 1994, 116, 991–994. [Google Scholar] [CrossRef] [PubMed]
- Ezzat, K.; Aoki, Y.; Koo, T.; McClorey, G.; Benner, L.; Coenen-Stass, A.; O’Donovan, L.; Lehto, T.; Garcia-Guerra, A.; Nordin, J. Self-assembly into nanoparticles is essential for receptor mediated uptake of therapeutic antisense oligonucleotides. Nano Lett. 2015, 15, 4364–4373. [Google Scholar] [CrossRef]
- Lee, K.; Huang, Z.N.; Mirkin, C.A.; Odom, T.W. Endosomal organization of CpG constructs correlates with enhanced immune activation. Nano Lett. 2020, 20, 6170–6175. [Google Scholar] [CrossRef] [PubMed]
- Bode, C.; Zhao, G.; Steinhagen, F.; Kinjo, T.; Klinman, D.M. CpG DNA as a vaccine adjuvant. Expert Rev. Vaccines 2011, 10, 499–511. [Google Scholar] [CrossRef]
- Tu, A.T.T.; Hoshi, K.; Yamazaki, T. Influence of loop permutation on immunostimulatory activities of CpG oligodeoxynucleotides forming monomeric guanine-quadruplex structures. Biomed. Res. Ther. 2022, 9, 5410–5417. [Google Scholar] [CrossRef]
- Miyoshi, D.; Karimata, H.; Sugimoto, N. Drastic effect of a single base difference between human and tetrahymena telomere sequences on their structures under molecular crowding conditions. Angew. Chem. 2005, 117, 3806–3810. [Google Scholar] [CrossRef]
- Jana, J.; Weisz, K. A Thermodynamic Perspective on Potential G-Quadruplex Structures as Silencer Elements in the MYC Promoter. Chem.–A Eur. J. 2020, 26, 17242–17251. [Google Scholar] [CrossRef]
- Garaiova, Z.; Strand, S.P.; Reitan, N.K.; Lélu, S.; Størset, S.Ø.; Berg, K.; Malmo, J.; Folasire, O.; Bjørkøy, A.; Davies, C.D.L. Cellular uptake of DNA–chitosan nanoparticles: The role of clathrin-and caveolae-mediated pathways. Int. J. Biol. Macromol. 2012, 51, 1043–1051. [Google Scholar] [CrossRef]
- Chang, T.; Qi, C.; Meng, J.; Zhang, N.; Bing, T.; Yang, X.; Cao, Z.; Shangguan, D. General cell-binding activity of intramolecular G-quadruplexes with parallel structure. PLoS ONE 2013, 8, e62348. [Google Scholar] [CrossRef] [PubMed]
- Clua, A.; Fàbrega, C.; García-Chica, J.; Grijalvo, S.; Eritja, R. Parallel G-quadruplex structures increase cellular uptake and cytotoxicity of 5-fluoro-2′-deoxyuridine oligomers in 5-fluorouracil resistant cells. Molecules 2021, 26, 1741. [Google Scholar] [CrossRef]
- Jensen, L.T.; Posewitz, M.C.; Srinivasan, C.; Winge, D.R. Mapping of the DNA binding domain of the copper-responsive transcription factor Mac1 from Saccharomyces cerevisiae. J. Biol. Chem. 1998, 273, 23805–23811. [Google Scholar] [CrossRef]
- Lahoud, M.H.; Ahmet, F.; Zhang, J.-G.; Meuter, S.; Policheni, A.N.; Kitsoulis, S.; Lee, C.-N.; O’Keeffe, M.; Sullivan, L.C.; Brooks, A.G. DEC-205 is a cell surface receptor for CpG oligonucleotides. Proc. Natl. Acad. Sci. USA 2012, 109, 16270–16275. [Google Scholar] [CrossRef]
- Moseman, A.P.; Moseman, E.A.; Schworer, S.; Smirnova, I.; Volkova, T.; von Andrian, U.; Poltorak, A. Mannose receptor 1 mediates cellular uptake and endosomal delivery of CpG-motif containing oligodeoxynucleotides. J. Immunol. 2013, 191, 5615–5624. [Google Scholar] [CrossRef] [PubMed]
- Platt, N.; Gordon, S. Scavenger receptors: Diverse activities and promiscuous binding of polyanionic ligands. Chem. Biol. 1998, 5, R193–R203. [Google Scholar] [CrossRef]
- Platt, N.; Gordon, S. Is the class A macrophage scavenger receptor (SR-A) multifunctional?—The mouse’s tale. J. Clin. Investig. 2001, 108, 649–654. [Google Scholar] [CrossRef] [PubMed]
- Zani, I.A.; Stephen, S.L.; Mughal, N.A.; Russell, D.; Homer-Vanniasinkam, S.; Wheatcroft, S.B.; Ponnambalam, S. Scavenger receptor structure and function in health and disease. Cells 2015, 4, 178–201. [Google Scholar] [CrossRef]
- Kohashi, H.; Nagata, R.; Tamenori, Y.; Amatani, T.; Ueda, Y.; Mori, Y.; Kasahara, Y.; Obika, S.; Shimojo, M. A novel transient receptor potential C3/C6 selective activator induces the cellular uptake of antisense oligonucleotides. Nucleic Acids Res. 2024, 52, 4784–4798. [Google Scholar] [CrossRef]
- De Dios, R.; Nguyen, L.; Ghosh, S.; McKenna, S.; Wright, C.J. CpG-ODN-mediated TLR9 innate immune signalling and calcium dyshomeostasis converge on the NFκB inhibitory protein IκBβ to drive IL1α and IL1β expression. Immunology 2020, 160, 64–77. [Google Scholar] [CrossRef] [PubMed]
Name | Sequence (5′-3′) | Length (bp) |
---|---|---|
GD2_H | GGGTTGGGGTCGTTTTGTCGTTGGGTTGGG | 30 |
GD2_AP | GGGTTGGGAGTCGTTTTGTCGTTAGGGTTGGG | 32 |
GD2_P | GGGTGGGAGTCGTTTTGTCGTTAGGGTGGG | 30 |
GD2_H-GpC | GGGTTGGGGTGCTTTTGTGCTTGGGTTGGG | 30 |
GD2_AP-GpC | GGGTTGGGAGTGCTTTTGTGCTTAGGGTTGGG | 32 |
GD2_P-GpC | GGGTGGGAGTGCTTTTGTGCTTAGGGTGGG | 30 |
ss30mer | GTCGTTTTGTCGTTTTGTCGTTTTGTCGTT | 30 |
ss32mer | GTCGTTTTGTCGTTTTGTCGTTTTGTCGTTTT | 32 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Pathak, S.; Le, N.B.T.; Oyama, T.; Odahara, Y.; Momotake, A.; Ikebukuro, K.; Kataoka-Hamai, C.; Yoshikawa, C.; Kawakami, K.; Kaizuka, Y.; et al. Immunostimulatory Effects of Guanine-Quadruplex Topologies as Scaffolds for CpG Oligodeoxynucleotides. Biomolecules 2025, 15, 95. https://doi.org/10.3390/biom15010095
Pathak S, Le NBT, Oyama T, Odahara Y, Momotake A, Ikebukuro K, Kataoka-Hamai C, Yoshikawa C, Kawakami K, Kaizuka Y, et al. Immunostimulatory Effects of Guanine-Quadruplex Topologies as Scaffolds for CpG Oligodeoxynucleotides. Biomolecules. 2025; 15(1):95. https://doi.org/10.3390/biom15010095
Chicago/Turabian StylePathak, Soumitra, Nguyen Bui Thao Le, Taiji Oyama, Yusuke Odahara, Atsuya Momotake, Kazunori Ikebukuro, Chiho Kataoka-Hamai, Chiaki Yoshikawa, Kohsaku Kawakami, Yoshihisa Kaizuka, and et al. 2025. "Immunostimulatory Effects of Guanine-Quadruplex Topologies as Scaffolds for CpG Oligodeoxynucleotides" Biomolecules 15, no. 1: 95. https://doi.org/10.3390/biom15010095
APA StylePathak, S., Le, N. B. T., Oyama, T., Odahara, Y., Momotake, A., Ikebukuro, K., Kataoka-Hamai, C., Yoshikawa, C., Kawakami, K., Kaizuka, Y., & Yamazaki, T. (2025). Immunostimulatory Effects of Guanine-Quadruplex Topologies as Scaffolds for CpG Oligodeoxynucleotides. Biomolecules, 15(1), 95. https://doi.org/10.3390/biom15010095