Next Article in Journal
About Functional Foods: The Probiotics and Prebiotics State of Art
Next Article in Special Issue
Clinical Aspects of Bacterial Distribution and Antibiotic Resistance in the Reproductive System of Equids
Previous Article in Journal
Dynamics-Based Regulatory Switches of Type II Antitoxins: Insights into New Antimicrobial Discovery
Previous Article in Special Issue
Tetracycline, Macrolide and Lincosamide Resistance in Streptococcus canis Strains from Companion Animals and Its Genetic Determinants
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Antibiotics
Volume 12
Issue 4
10.3390/antibiotics12040636
antibiotics-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Antimicrobial Resistant Coagulase-Negative Staphylococci Carried by House Flies (Musca domestica) Captured in Swine and Poultry Farms

by
Fabrizio Bertelloni
1,*,
Giulia Cagnoli
1,
Flavio Bresciani
1,
Bruno Scotti
2,
Luca Lazzerini
2,
Marco Marcucci
3,
Giuseppe Colombani
3 and
Valentina Virginia Ebani
1
1
Department of Veterinary Science, University of Pisa, Viale delle Piagge 2, 56124 Pisa, Italy
2
Sede Sicurezza Alimentare e Sanità Pubblica Veterinaria, Zona Versilia, Azienda Usl Toscana Nord Ovest, Via Martiri di S. Anna 12, 55045 Pietrasanta, Italy
3
Sede Sicurezza Alimentare e Sanità Pubblica Veterinaria, Zona Valle del Serchio, Azienda Usl Toscana Nord Ovest, Via IV Novembre 10, 55027 Gallicano, Italy
*
Author to whom correspondence should be addressed.
Antibiotics 2023, 12(4), 636; https://doi.org/10.3390/antibiotics12040636
Submission received: 23 February 2023 / Revised: 20 March 2023 / Accepted: 22 March 2023 / Published: 23 March 2023
(This article belongs to the Special Issue Antimicrobial Resistance and Zoonoses)
Versions Notes

Abstract

:
House flies (Musca domestica) are very diffuse insects attracted by biological materials. They are abundantly present in farm environments and can frequently come in contact with animals, feed, manure, waste, surfaces, and fomites; consequently, these insects could be contaminated, carry, and disperse several microorganisms. The aim of this work was to evaluate the presence of antimicrobial-resistant staphylococci in house flies collected in poultry and swine farms. Thirty-five traps were placed in twenty-two farms; from each trap, 3 different kinds of samples were tested: attractant material present in the traps, the body surface of house flies and the body content of house flies. Staphylococci were detected in 72.72% of farms, 65.71% of traps and 43.81% of samples. Only coagulase-negative staphylococci (CoNS) were isolated, and 49 isolates were subjected to an antimicrobial susceptibility test. Most of the isolates were resistant to amikacin (65.31%), ampicillin (46.94%), rifampicin (44.90%), tetracycline (40.82%) and cefoxitin (40.82%). Minimum Inhibitory concentration assay allowed to confirm 11/49 (22.45%) staphylococci as methicillin-resistant; 4 of them (36.36%) carried the mecA gene. Furthermore, 53.06% of the isolates were classified as multidrug-resistant (MDR). Higher levels of resistance and multidrug resistance were detected in CoNS isolated from flies collected in poultry farms than in swine farms. Therefore, house flies could carry MDR and methicillin-resistant staphylococci, representing a possible source of infection for animals and humans.

1. Introduction

Members of the Staphylococcus genus are ubiquitous bacteria. More than 80 species and subspecies exist, generally distinguished in Coagulase Positive Staphylococci (CoPS) and Coagulase Negative Staphylococci (CoNS) [1,2]. CoPS, mainly represented by Staphylococcus aureus subs. aureus (S. aureus) are important pathogens of humans and animals [2]. CoNS are opportunistic pathogens. However, in recent years, their virulence and pathogenic potential have been widely revaluated [3,4].
Like other bacteria, staphylococci could acquire resistance to several antimicrobials, representing a serious complication of staphylococcal infections [5,6]. One of the main problems related to Staphylococcus spp. is methicillin resistance. This characteristic is associated with the acquisition of a set of genes called staphylococcal cassette chromosome mec (SCCmec). These genes confer resistance to β-lactam antibiotics, including penicillins and cephalosporins [7,8]. The SCCmec harbors a gene called mec that encodes for a modified specific penicillin-binding protein (PBP2a) with a decreased binding affinity to β-lactams [7]. The mecA gene is the first identified and the most dispersed worldwide, but some homologous genes, such as mecB and mecC, exist [9]. The SCCmec, particularly harboring mecA, is mainly associated with S. aureus, and S. aureus strains carrying mecA are defined as methicillin-resistant Staphylococcus aureus (MRSA) [7]. Methicillin-resistant coagulase-negative staphylococci (MRCoNS) have been detected, too, and emerged as important opportunistic pathogens in recent years [10,11].
Both CoPS and CoNS are common inhabitants of skin and mucous membranes of domestic and wild animals, as well as humans, and can be considered typical zoonotic bacteria [1,2,12]. In addition, among domestic animals, swine and poultry are frequently carriers and reservoirs of staphylococci [13,14,15,16] and, potentially, the source of human infections [17,18].
In farm environments, insects could contribute to the spreading and persistence of pathogenic and antimicrobial-resistant bacteria. In particular, the role of flies was explored from this point of view [19,20,21]. However, most studies are focused on Gram-negative bacteria, particularly Enterobacteriaceae, whereas few data on flies as carriers of staphylococci at the farm level are available. Poudel and coworkers did not detect S. aureus in house flies sampled in poultry, dairy cattle, and beef cow farms. Still, they found CoNS in 85.00%, 67.50% and 82.76% of samples, respectively, 52.94%, 66.66% and 12.50% of isolates from poultry, dairy cattle, and beef cow, respectively, were resistant to one or more antimicrobials, too [22]. Akter and colleagues reported the isolation of S. aureus from 60% and 75% of Musca domestica samples collected in poultry and dairy farms, respectively [23]. Stelder and collaborators detected 7.8% and 5.4% of methicillin-resistant S. aureus strains in stable flies and house flies collected on a pig farm [24].
This study aimed to evaluate the presence of Staphylococcus spp. in Musca domestica collected in medium size poultry and swine farms located in central Italy, to assess the antimicrobial resistance of the isolates, and to evaluate the presence of methicillin-resistant staphylococcal strains.

2. Results

2.1. Farms and Samples

Seven poultry farms and fifteen swine farms were enrolled in the study. Ten traps were placed in poultry farms, while 25 were placed in swine farms. Overall, 105 samples were processed for microbiological investigation: 35 samples for each type A, B and C; sample A represent the attractant substrate inside the traps, sample B represents the insect’s external surface body and sample C the internal body content of the flies. Insects were captured with all the traps, and house flies alone were found in them. Detailed information about farms, traps and samples is resumed in Table 1.

2.2. Staphylococcus spp. Isolation, Characterization and Antimicrobial Resistance

Staphylococci were isolated from 23/35 (65.71%) traps from 16/22 (72.72%) farms. In detail, Staphylococcus spp. was detected in 16/35 (45.71%), 16/35 (45.71%) and 14/35 (40.00%) type A, B and C samples, respectively; no statistical differences emerged (p > 0.05). In some cases, the detection of these bacteria inside or on the body of insects (samples B and C) was not associated with the positivity of the broth inside the trap (sample A) and vice versa. Particularly, staphylococci were isolated from all 3 kinds of samples only in 8 traps. In 10 farms, more than 1 trap was placed; Staphylococcus spp. was isolated from all the traps within the same farm only in five cases. However, staphylococci were found in 9/10 (90.00%) farms where more than 1 trap was used and in 7/12 (58.33%) farms where only 1 trap was placed. Although using more traps allowed a more abundant detection of staphylococci, no statistical difference emerged (p > 0.05).
Overall, 46/105 (43.81%) samples resulted positive and 49 different Staphylococcus spp. isolates were collected and subsequently analyzed. Particularly, 18, 16 and 15 isolates were from type A, B and C samples, respectively. Only coagulase-negative staphylococci were found. In detail, the following species were identified: S. epidermidis (14 isolates), S. xylosus (9 isolates), S. lentus (7 isolates), S. haemolyticus (5 isolates), S. sciuri (5 isolates), S. cohnii spp urealyticus (4 isolates), S. saprophyticus (3 isolates) and S. warneri (2 isolates).
Considering swine, 10/15 (66.66%) farms, 15/25 (60.00%) traps, and 28/75 (37.33%) samples were positive. Whereas, considering poultry, 6/7 (85.71%) farms, 8/10 (80.00%) traps and 18/30 (60.00%) samples were positive. No statistical differences emerged in the positivity rate between swine and poultry farms and traps (p > 0.05). In contrast, more samples collected from poultry were positive than samples collected from swine settings (p < 0.05).
Table 2 summarizes data about antimicrobial resistance in Staphylococcus spp. isolates.
High percentages of resistance were detected for amikacin (65.31% resistant isolates), ampicillin (46.94% resistant isolates), rifampicin (44.90% resistant isolates), tetracycline (40.82% resistant isolates) and cefoxitin (40.82% resistant isolates). The most effective antimicrobial resulted in amoxicillin-clavulanate (85.71% susceptible isolates), chloramphenicol (75.51% susceptible isolates), trimethoprim-sulfamethoxazole (71.43% susceptible isolates), ciprofloxacin (69.39% susceptible isolates), gentamicin (69.39% susceptible isolates) and ceftiofur (65.31% susceptible isolates).
None of the isolates was resistant to vancomycin. In particular, 40/49 (81.63%) isolates were susceptible, and the remaining 9/49 (18.37%) were classified as intermediate.
The 20 isolates resistant to cefoxitin were tested to determine oxacillin MIC. Among them, 11/20 (55.00%) were confirmed as methicillin-resistant, and 9/20 (45.00%) resulted susceptible. In addition, four out of eleven phenotypic-resistant strains scored positive for the gene mecA; the gene mecC was undetected.
For the following antimicrobials, a higher percentage of resistant staphylococci was detected among isolates from poultry than among isolates from swine: cefoxitin, ceftiofur, enrofloxacin, gentamicin, amikacin, erythromycin, and trimethoprim-sulfamethoxazole (p < 0.05).
No differences emerged between isolates from swine and poultry in relation to vancomycin resistance and methicillin resistance (p > 0.05). Furthermore, 2 mecA-positive strains were recovered from swine and 2 from poultry samples.
Staphylococcus spp. isolates were resistant from 0 to 10 different antimicrobials. Based on the antimicrobial resistance profile, 26/49 (53.06%) isolates were classified as multidrug-resistant (MDR), showing resistance to at least 1 antimicrobial in three or more different antimicrobial classes [25]. It was possible to isolate MDR strains from 14/22 (63.64%) farms. In particular, 6/7 (85.71%) and 8/15 (53.33%) poultry and swine farms were positive for MDR strains, respectively; no statistical differences emerged (p > 0.05). It was possible to isolate MDR strains from 16/35 (45.71%) traps. In particular, from 7/10 (70.00%) and 9/25 (36.00%), traps placed in poultry and swine farms, MDR strains were detected, respectively; no statistical differences emerged (p > 0.05). Finally, 25/105 (23.81%) samples were positive for MDR staphylococci: 8/35 (22.86%), 9/35 (25.71%) and 8/35 (22.86%) type A, B and C samples, respectively; no statistical differences were detected (p > 0.05). In particular, 14/30 (46.67%) and 11/75 (14.67%) samples collected from poultry and swine farms allowed the isolation of MDR strains; samples from poultry farms allowed more often the isolation of MDR staphylococci (p < 0.05).
All methicillin-resistant isolates were multidrug-resistant.
Table 3 reports detailed data on MDR isolates obtained in this study.

3. Discussion

The present study has investigated the potential role of house flies in the carriage and dispersion of antimicrobial-resistant staphylococci in medium-size swine and poultry farms.
Three different kinds of samples were evaluated. Sample A, the attractant broth present inside the trap, gives information about environmental contamination and the contamination carried out by insects. Sample B, the rinsing solution of the external body of the flies, provides information on the staphylococci present on the surface of the captured house flies. Finally, sample C, the homogenate of the insect bodies, provides data about the staphylococci inside the flies. A more detailed evaluation of the importance and meaning of the evaluation of all three samples was previously published [26].
In the present study, Staphylococcus spp. were isolated from more than 60% of traps and in more than 70% of farms, confirming the high diffusion of bacteria belonging to this genus. However, less than 50% of samples scored positive, without differences among samples A, B and C; furthermore, staphylococci were isolated from all three kinds of samples only in a little number of traps (8/35—22.86%). Acquired data suggested that the external surface and the digestive tract of house flies could be contaminated by Staphylococcus spp. Only CoNS were detected; this result is unsurprising because CoNS are more frequently detected than CoPS in healthy swine or poultry [13,14,15]. Obtained data correspond to other studies where CoNS were more frequently detected in house flies than CoPS [22]. Sobur and colleagues reported a high isolation rate (52%) of S. aureus in house flies. However, in this case, sampling was performed inside or near a human hospital, and this could explain the frequent detection of this pathogen [27].
The most effective antimicrobials were amoxicillin-clavulanate, chloramphenicol, trimethoprim-sulfamethoxazole, ciprofloxacin, gentamicin and ceftiofur, with more than 60% of isolates resulting susceptible. More than 40% of tested staphylococci were resistant to amikacin, ampicillin, rifampicin, tetracycline and cefoxitin. In 2019 and 2020, in Italy, the most sold antimicrobials for farm animals were penicillins and tetracyclines, followed by sulfonamides, lincosamides and aminoglycosides [28]; this could partially explain the resistance detected. However, a real comparison with other works is difficult to perform. First, few studies exploring the presence and antimicrobial resistance of staphylococci in house flies are available. Second, because the panels of antimicrobials tested differ among the studies, and third, because detected antimicrobial resistance reflects the location and geographic area where insects come from. In a survey about bacteria from flies captured in hospital and non-hospital settings, CoPS and CoNS showed moderate resistance to ciprofloxacin only [29]. A study performed on house flies captured in different locations, including animal facilities, reported an increased resistance only for tetracyclines and amoxicillin, whereas most of the tested staphylococcal isolates were susceptible to the other tested antimicrobials [22]. Akter et al. evaluated the antimicrobial resistance of S. aureus strains isolated from house flies collected in different settings, including poultry and dairy farms; most strains were resistant to amoxicillin, penicillin, streptomycin, erythromycin, and tetracycline, whereas most effective antimicrobials were ciprofloxacin and chloramphenicol [23]. Odetoyin and collaborators analyzed S. aureus strains from house flies collected in different locations. The antimicrobial susceptibility test showed diffuse resistance to amoxicillin and trimethoprim-sulfamethoxazole and susceptibility to chloramphenicol, amoxicillin-clavulanate, gentamycin and ciprofloxacin [30]. Sobur and coworkers found a high percentage of S. aureus resistant to amoxicillin and oxacillin in house flies collected near a human hospital; most strains were susceptible to ciprofloxacin and gentamicin [27]. In a recent study on CoNS isolated from house flies collected from different environments, a high percentage of tested staphylococci were resistant to oxacillin and penicillin but susceptible to tetracycline, ciprofloxacin, gentamicin, and chloramphenicol [31].
One of the main problems associated with Staphylococcus spp. is methicillin resistance; it is related to a mobile genetic element carrying mecA or homologous genes, conferring broad-spectrum β-lactam resistance [7]. In the present study, 22.44% of isolated staphylococci were methicillin-resistant by phenotypic test. Only 4 isolates (36.36% of methicillin-resistant and 8.16% of the total tested isolates) carried the mecA gene, whereas mecC was undetected. Sobur and collaborators found higher percentages of oxacillin resistant (84.13%) and mecA-positive (57.7%) staphylococci collected from house flies; however, these authors focused on S. aureus and flies collected in a human hospital setting [27]. Akter and collaborators reported a higher percentage of mecA-positive staphylococci in house flies. In this case, only S. aureus was tested, and most MRSA was isolated from insects collected in a human hospital [23]. Other authors reported a high percentage (90.63%) of oxacillin-resistant CoNS isolated from house flies but the absence of mecA-positive strains [31]. Molecular detection of mecA or mecC genes was considered the gold standard method and the key point to classify a Staphylococcus strain as methicillin-resistant. However, other mec homologous exist; these genes are less diffuse and generally not located on mobile genetic elements [7], and for this were not searched in our study. Furthermore, other resistance mechanisms were identified, especially in S. aureus, such as overexpression of β-lactamases producing genes, for example, blaZ, or point mutation of PBP [32,33,34].
Vancomycin was used in humans to treat methicillin-resistant Staphylococcus infections [35]. All tested isolates obtained in the present study were classified as susceptible or intermediate against vancomycin. This aligns with other studies, reporting no detection of vancomycin-resistant CoNS [36,37].
In the present survey, 53.06% of isolates were multidrug resistant; it was possible to detect MDR strains from more than 50% of swine and almost all poultry farms. The resistance to multiple antimicrobials represents an excellent advantage for bacteria and a serious threat to humans and veterinary medicine, limiting the available therapeutic options. Our data contrast with other studies using the same criteria to classify multidrug-resistant staphylococci. Indeed, lower percentages of MDR CoNS were reported by other authors, ranging between 0.8% and 12.5% [22,31]. However, the MDR detection rate from house flies similar to our study was obtained by some authors analyzing S. aureus strains and adopting the same MDR classification criteria [27,30].
Although no differences emerged in the detection rate of staphylococci between house flies collected in swine and poultry farms, antimicrobial resistance was higher in isolates of poultry origin. Indeed, for 7 out of 14 antimicrobials tested, a higher percentage of resistant isolates was detected in staphylococci from poultry farms than from swine farms. Furthermore, MDR strains were more often detected from samples collected in poultry farms. Official data report a similar quantity of sold antimicrobials in Italy for swine and poultry in recent years [28]. However, in this study, small-medium size farms were analyzed, and we could hypothesize a stronger use of antimicrobials in poultry flocks. In addition, results of other works seem to suggest a more abundant use of antimicrobials in poultry farms, reporting higher detection of antimicrobial-resistant bacteria or antimicrobial-resistance genes [38,39,40].

4. Materials and Methods

4.1. Farms, Traps, Insects Collection and Processing

Samples collection and processing methods were previously described [26]. Briefly, samples were collected from June 2019 to September 2019 in poultry and swine farms located in North-west Tuscany, Central Italy, under the area of competence of “Az. USL di Versilia, Valle del Serchio e Piana di Lucca”.
Home-made traps were used to capture the insects; sterile glass jars filled with freshly prepared and sterilized fish broth as attractant substrate were employed. Traps were located inside the animal breeding rooms, far from windows and doors and not accessible to animals.
Three different samples (A, B, C) were obtained from each trap. First, the attractant material remaining inside the trap was collected and analyzed. This represents sample A. The house flies external surface body was washed with a sterile saline solution, and the washing solution was used as sample B. Finally, the insect bodies were decontaminated and homogenized in a sterile saline solution with a Stomacher. The obtained homogenate represented sample C.

4.2. Staphylococcus spp. Isolation

To isolate bacteria from the Staphylococcus genus, 1 mL of each sample (A, B and C) was diluted from 10−1 to 10−3 in sterile saline water. Successively, 0.1 mL from each dilution and the original sample were inoculated with the spread-plate technique on Mannitol Salt Agar (MSA) (Thermo Fisher Diagnostics, Milan, Italy) to obtain single isolated colonies; plates were incubated at 37 °C for 24 h. From each sample, up to 3 distinct and different colonies were selected and purified on Tryptic Soy Agar (TSA) (Thermo Fisher Diagnostics). Isolates were confirmed by Gram staining and catalase tests. Staphylococcus spp. isolates were further tested for coagulase with rabbit plasma (Biolife, Milan, Italy); 1 to 3 isolates from each sample were selected based on the coagulase test and mannitol fermentation. Species identification was carried out with API STAPH® (bioMérieux SA, Marcy l’Etoile, France) following the manufacturers’ instructions. All typed isolates were cultured in Brain Heart Infusion broth (BHI) (Thermo Fisher Diagnostics) and frozen at −80 °C with the addition of 20% glycerol.

4.3. Antimicrobial Susceptibility Tests

All obtained isolates were tested for antimicrobial resistance with the disk diffusion method described by CLSI [41]. The following antimicrobial (Thermo Fisher Diagnostics) were employed: ampicillin (10 µg), amoxicillin-clavulanate (20/10 μg), cefoxitin (30 μg), ceftiofur (30 μg), chloramphenicol (30 μg), tetracycline (30 μg), enrofloxacin (5 μg), ciprofloxacin (5 μg), gentamicin (10 μg), amikacin (30 μg), trimethoprim-sulfamethoxazole (1.25/23.75 μg), erythromycin (15 μg) and rifampicin (5 μg). Vancomycin resistance of staphylococci isolates was evaluated, too; as suggested by CLSI, Minimum Inhibitory Concentration (MIC) was assessed for this purpose, using the broth microdilution method [42]. Results were interpreted in accordance with CLSI and EUCAST guidelines [42,43,44]. Escherichia coli ATCC 25922, Staphylococcus aureus ATCC 25923 and Staphylococcus aureus ATCC 29213 were internal quality controls.
Oxacillin MIC was evaluated for Staphylococcus spp. isolates resulting resistant or intermediate to cefoxitin [42]. Isolates confirmed as resistant were subjected to molecular detection of mecA and mecC genes employing primers (Table 4), and PCR protocols previously described [45,46]. DNA was extracted from overnight cultures using a commercial kit, Quick-DNA Miniprep Plus Kit (Zymo Research, Irvine, CA, USA), following manufacturer instructions. PCR assays were done in an automated thermal cycler (SimpliAmp™ Thermal Cycler, Applied Biosystems, Waltham, MA, USA). PCRs reactions were carried out in 25 µL final volume, containing 12.5 µL DreamTaq Hot Start Green Master Mix (Life Technologies Italia, Milan, Italy), 0.1 µM of primers MecA147-F and MecA147-R, or 0.5 μM of primers mecLGA251 f and mecLGA251 r, 3 µL of extracted DNA and ultrapure water to reach the final volume. Sterile distilled water was employed as negative control; DNA extracted from Staphylococcus aureus ATCC 43300 was used as a positive control for mecA. The DNA extracted from previously isolated and characterized field strains was used as a positive control for mecC. PCR products were run in 1.5% agarose gel at 100 V for 45 min, using 100 bp DNA Ladder Ready to Load (Solis BioDyne, Tartu, Estonia) as DNA marker; the gel was stained with ethidium bromide and observed under UV light.

4.4. Statistical Analyses

Obtained results were analyzed with Chi-square (X2) test. The Chi-square (X2) test was employed to compare isolation rates and antimicrobial resistance of staphylococci between poultry and swine farms and among sample types. The statistical significance threshold was set at a p-value ≤ 0.05.

5. Conclusions

Data obtained in the present investigation confirm that house flies could carry antimicrobial-resistant staphylococci representing a potential vector for bacterial dispersion. Only CoNS were isolated from the analyzed samples; these bacteria act as opportunistic pathogens and are frequently involved in human and animal infections. A high proportion of isolated bacteria were multidrug-resistant, suggesting an abundant circulation of MDR staphylococci in farmed animals. Although a low proportion of methicillin-resistant and mecA-positive CoNS was detected, our data show the circulation of these bacteria in medium-small poultry and swine farms. They suggest that M. domestica could be relevant in spreading MDR and methicillin-resistant coagulase-negative staphylococci.
House flies are common insects in every ecosystem and abundantly diffuse in farm environments. As a result, they can easily and frequently come in contact with animals’ bodies, representing an irritant and, sometimes, stressful factor. A good biosecurity plan to reduce the number of houses flies in farm environments could help reduce animals’ stress and prevent the dispersion of antimicrobial-resistant, potentially pathogenic bacteria.

Author Contributions

Conceptualization, V.V.E.; methodology, F.B. (Fabrizio Bertelloni) and F.B. (Flavio Bresciani); formal analysis, F.B. (Fabrizio Bertelloni), F.B. (Flavio Bresciani) and G.C. (Giulia Cagnoli); investigation, F.B. (Flavio Bresciani), B.S., L.L., M.M., G.C. (Giuseppe Colombani); resources, V.V.E.; data curation, F.B. (Fabrizio Bertelloni) and F.B. (Flavio Bresciani); writing—original draft preparation, F.B. (Fabrizio Bertelloni); writing—review and editing, F.B. (Fabrizio Bertelloni) and V.V.E.; supervision, V.V.E. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the University of Pisa, Fondi di Ateneo and grant number PRA_2020_88.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are available within the article.

Acknowledgments

A special thanks to all farmers that collaborate with this research.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Becker, K.; Heilmann, C.; Peters, G. Coagulase-negative staphylococci. Clin. Microbiol. Rev. 2014, 27, 870–926. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  2. Haag, A.F.; Fitzgerald, J.R.; Penadés, J.R. Staphylococcus aureus in Animals. Microbiol. Spectr. 2019, 7, GPP3-0060-2019. [Google Scholar] [CrossRef] [PubMed]
  3. Argemi, X.; Hansmann, Y.; Prola, K.; Prévost, G. Coagulase-negative staphylococci pathogenomics. Int. J. Mol. Sci. 2019, 20, 1215. [Google Scholar] [CrossRef] [Green Version]
  4. Heilmann, C.; Ziebuhr, W.; Becker, K. Are coagulase-negative staphylococci virulent? Clin. Microbiol. Infect. 2019, 25, 1071–1080. [Google Scholar] [CrossRef] [PubMed]
  5. Mlynarczyk-Bonikowska, B.; Kowalewski, C.; Krolak-Ulinska, A.; Marusza, W. Molecular mechanisms of drug resistance in Staphylococcus aureus. Int. J. Mol. Sci. 2022, 23, 8088. [Google Scholar] [CrossRef]
  6. Poku, E.; Cooper, K.; Cantrell, A.; Harnan, S.; Sin, M.A.; Zanuzdana, A.; Hoffmann, A. Systematic review of time lag between antibiotic use and rise of resistant pathogens among hospitalized adults in Europe. JAC-Antimicrob. Resist. 2023, 5, dlad001. [Google Scholar] [CrossRef]
  7. Lakhundi, S.; Zhang, K. Methicillin-Resistant Staphylococcus aureus: Molecular characterization, evolution, and epidemiology. Clin. Microbiol. Rev. 2018, 31, e00020-18. [Google Scholar] [CrossRef] [Green Version]
  8. Liu, J.; Chen, D.; Peters, B.M.; Li, L.; Li, B.; Xu, Z.; Shirliff, M.E. Staphylococcal chromosomal cassettes mec (SCCmec): A mobile genetic element in methicillin-resistant Staphylococcus aureus. Microb. Pathog. 2016, 101, 56–67. [Google Scholar] [CrossRef]
  9. Becker, K.; Ballhausen, B.; Köck, R.; Kriegeskorte, A. Methicillin resistance in Staphylococcus isolates: The “mec alphabet” with specific consideration of mecC, a mec homolog associated with zoonotic S. aureus lineages. Int. J. Med. Microbiol. 2014, 304, 794–804. [Google Scholar] [CrossRef]
  10. Al-Haqan, A.; Boswihi, S.S.; Pathan, S.; Udo, E.E. Antimicrobial resistance and virulence determinants in coagulase-negative staphylococci isolated mainly from preterm neonates. PLoS ONE 2020, 15, e0236713. [Google Scholar] [CrossRef]
  11. Chon, J.W.; Lee, U.J.; Bensen, R.; West, S.; Paredes, A.; Lim, J.; Khan, S.; Hart, M.E.; Phillips, K.S.; Sung, K. Virulence characteristics of mecA-positive multidrug-resistant clinical coagulase-negative staphylococci. Microorganisms 2020, 8, 659. [Google Scholar] [CrossRef] [PubMed]
  12. Becker, K.; Both, A.; Weißelberg, S.; Heilmann, C.; Rohde, H. Emergence of coagulase-negative staphylococci. Expert Rev. Anti. Infect. Ther. 2020, 18, 349–366. [Google Scholar] [CrossRef] [PubMed]
  13. Silva, V.; Caniça, M.; Ferreira, E.; Vieira-Pinto, M.; Saraiva, C.; Pereira, J.E.; Capelo, J.L.; Igrejas, G.; Poeta, P. Multidrug-Resistant Methicillin-Resistant Coagulase-Negative Staphylococci in Healthy Poultry Slaughtered for Human Consumption. Antibiotics 2022, 11, 365. [Google Scholar] [CrossRef] [PubMed]
  14. Marek, A.; Stepień-Pyśniak, D.; Pyzik, E.; Adaszek, Ł.; Wilczyński, J.; Winiarczyk, S. Occurrence and characterization of Staphylococcus bacteria isolated from poultry in Western Poland. Berl. Munch. Tierarztl. Wochenschr. 2016, 129, 147–152. [Google Scholar]
  15. Bonvegna, M.; Grego, E.; Sona, B.; Stella, M.C.; Nebbia, P.; Mannelli, A.; Tomassone, L. Occurrence of methicillin-resistant coagulase-negative staphylococci (MRCoNS) and methicillin-resistant Staphylococcus aureus (MRSA) from pigs and farm environment in northwestern italy. Antibiotics 2021, 10, 676. [Google Scholar] [CrossRef]
  16. Moreno-Flores, A.; Potel-Alvarellos, C.; Francisco-Tomé, M.; Constenla-Caramés, L.; Pérez-Roth, E.; López-Cotón, C.; Comesaña-Da Vila, E.; Eiroa-de la Puente, L.; Álvarez-Fernández, M. Methicillin-resistant Staphylococcus aureus in swine housed indoors in Galicia, Spain. Enferm. Infecc. Microbiol. Clin. 2020, 38, 16–20. [Google Scholar] [CrossRef]
  17. Randad, P.R.; Larsen, J.; Kaya, H.; Pisanic, N.; Ordak, C.; Price, L.B.; Aziz, M.; Nadimpalli, M.L.; Rhodes, S.; Stewart, J.R.; et al. Transmission of Antimicrobial-Resistant Staphylococcus aureus Clonal Complex 9 between Pigs and Humans, United States. Emerg. Infect. Dis. 2021, 27, 740–748. [Google Scholar] [CrossRef]
  18. Chen, C.; Wu, F. Livestock-associated methicillin-resistant Staphylococcus aureus (LA-MRSA) colonization and infection among livestock workers and veterinarians: A systematic review and meta-analysis. Occup. Environ. Med. 2021, 78, 530–540. [Google Scholar] [CrossRef]
  19. Gwenzi, W.; Chaukura, N.; Muisa-Zikali, N.; Teta, C.; Musvuugwa, T.; Rzymski, P.; Abia, A.L.K. Insects, Rodents, and Pets as Reservoirs, Vectors, and Sentinels of Antimicrobial Resistance. Antibiotics 2021, 10, 68. [Google Scholar] [CrossRef]
  20. Fukuda, A.; Usui, M.; Okamura, M.; Dong-Liang, H.; Tamura, Y. Role of flies in the maintenance of antimicrobial resistance in farm environments. Microb. Drug Resist. 2019, 25, 127–132. [Google Scholar] [CrossRef]
  21. Khamesipour, F.; Lankarani, K.B.; Honarvar, B.; Kwenti, T.E. A systematic review of human pathogens carried by the housefly (Musca domestica L.). BMC Public Health 2018, 18, 1049. [Google Scholar] [CrossRef] [PubMed]
  22. Poudel, A.; Hathcock, T.; Butaye, P.; Kang, Y.; Price, S.; Macklin, K.; Walz, P.; Cattley, R.; Kalalah, A.; Adekanmbi, F.; et al. Multidrug-Resistant Escherichia coli, Klebsiella pneumoniae and Staphylococcus spp. in houseflies and blowflies from farms and their environmental settings. Int. J. Environ. Res. Public Health 2019, 16, 3583. [Google Scholar] [CrossRef] [Green Version]
  23. Akter, S.; Sabuj, A.A.M.; Haque, Z.F.; Rahman, M.T.; Kafi, M.A.; Saha, S. Detection of antibiotic-resistant bacteria and their resistance genes from houseflies. Vet. World 2020, 13, 266. [Google Scholar] [CrossRef]
  24. Stelder, J.J.; Kjær, L.J.; Jensen, L.B.; Boklund, A.E.; Denwood, M.; Carlsen, M.; Bødker, R. Livestock-associated MRSA survival on house flies (Musca domestica) and stable flies (Stomoxys calcitrans) after removal from a Danish pig farm. Sci. Rep. 2021, 11, 3527. [Google Scholar] [CrossRef]
  25. Magiorakos, A.P.; Srinivasan, A.; Carey, R.B.; Carmeli, Y.; Falagas, M.E.; Giske, C.G.; Harbarth, S.; Hindler, J.F.; Kahlmeter, G.; Olsson-Liljequist, B.; et al. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: An international expert proposal for interim standard definitions for acquired resistance. Clin. Microbiol. Infect. 2012, 18, 268–281. [Google Scholar] [CrossRef] [Green Version]
  26. Bertelloni, F.; Bresciani, F.; Cagnoli, G.; Scotti, B.; Lazzerini, L.; Marcucci, M.; Colombani, G.; Bilei, S.; Bossù, T.; Marchis, M.L.D.; et al. House flies (Musca domestica) from swine and poultry farms carrying antimicrobial resistant Enterobacteriaceae and Salmonella. Vet. Sci. 2023, 10, 118. [Google Scholar] [CrossRef]
  27. Sobur, M.A.; Islam, M.S.; Haque, Z.F.; Orubu, E.S.F.; Toniolo, A.; Choudhury, M.A.; Rahman, M.T. Higher seasonal temperature enhances the occurrence of methicillin resistance of Staphylococcus aureus in house flies (Musca domestica) under hospital and environmental settings. Folia Microbiol. 2022, 67, 109–119. [Google Scholar] [CrossRef]
  28. European Medicines Agency. Sales of Veterinary Antimicrobial Agents in 31 European Countries in 2019 and 2020; European Medicines Agency: Amsterdam, The Netherlands, 2021. [Google Scholar]
  29. Nazari, M.; Mahrabi, T.; Hosseini, S.M.; Alikhani, M.Y. Bacterial contamination of adult house flies (Musca domestica) and sensitivity of these bacteria to various antibiotics, captured from Hamadan City, Iran. J. Clin. Diagn. Res. 2017, 11, DC04. [Google Scholar] [CrossRef]
  30. Odetoyin, B.; Adeola, B.; Olaniran, O. Frequency and antimicrobial resistance patterns of bacterial species isolated from the body surface of the housefly (Musca domestica) in Akure, Ondo State, Nigeria. J. Arthropod. Borne. Dis. 2020, 14, 88. [Google Scholar] [CrossRef] [Green Version]
  31. Sudagidan, M.; Ozalp, V.C.; Can, Ö.; Eligül, H.; Yurt, M.N.Z.; Tasbasi, B.B.; Acar, E.E.; Kavruk, M.; Koçak, O. Surface microbiota and associated staphylococci of houseflies (Musca domestica) collected from different environmental sources. Microb. Pathog. 2022, 164, 105439. [Google Scholar] [CrossRef]
  32. Nomura, R.; Nakaminami, H.; Takasao, K.; Muramatsu, S.; Kato, Y.; Wajima, T.; Noguchi, N. A class A β-lactamase produced by borderline oxacillin-resistant Staphylococcus aureus hydrolyses oxacillin. J. Glob. Antimicrob. Resist. 2020, 22, 244–247. [Google Scholar] [CrossRef] [PubMed]
  33. Hryniewicz, M.M.; Garbacz, K. Borderline oxacillin-resistant Staphylococcus aureus (BORSA)—A more common problem than expected? J. Med. Microbiol. 2017, 66, 1367–1373. [Google Scholar] [CrossRef] [PubMed]
  34. Scholtzek, A.D.; Hanke, D.; Walther, B.; Eichhorn, I.; Stöckle, S.D.; Klein, K.S.; Gehlen, H.; Lübke-Becker, A.; Schwarz, S.; Feßler, A.T. Molecular Characterization of equine Staphylococcus aureus isolates exhibiting reduced oxacillin susceptibility. Toxins 2019, 11, 535. [Google Scholar] [CrossRef] [Green Version]
  35. Appelbaum, P.C.; Bozdogan, B. Vancomycin resistance in Staphylococcus aureus. Clin. Lab. Med. 2004, 24, 381–402. [Google Scholar] [CrossRef]
  36. Ashagrie, D.; Genet, C.; Abera, B. Vancomycin-resistant enterococci and coagulase-negative staphylococci prevalence among patients attending at Felege Hiwot Comprehensive Specialized Hospital, Bahir Dar, Ethiopia. PLoS ONE 2021, 16, e0249823. [Google Scholar] [CrossRef]
  37. Al-Tamimi, M.; Abu-Raideh, J.; Himsawi, N.; Khasawneh, A.; Hawamdeh, H. Methicillin and vancomycin resistance in coagulase-negative Staphylococci isolated from the nostrils of hospitalized patients. J. Infect. Dev. Ctries. 2020, 14, 28–35. [Google Scholar] [CrossRef]
  38. Rothrock, M.J.; Min, B.R.; Castleberry, L.; Waldrip, H.; Parker, D.; Brauer, D.; Pitta, D.; Indugu, N. Antibiotic resistance, antimicrobial residues, and bacterial community diversity in pasture-raised poultry, swine, and beef cattle manures. J. Anim. Sci. 2021, 99, skab144. [Google Scholar] [CrossRef]
  39. De Jong, A.; El Garch, F.; Hocquet, D.; Prenger-Berninghoff, E.; Dewulf, J.; Migura-Garcia, L.; Perrin-Guyomard, A.; Veldman, K.T.; Janosi, S.; Skarzynska, M.; et al. European-wide antimicrobial resistance monitoring in commensal Escherichia coli isolated from healthy food animals between 2004 and 2018. J. Antimicrob. Chemother. 2022, 77, 3301–3311. [Google Scholar] [CrossRef]
  40. Osorio, V.; Sabater i Mezquita, A.; Balcázar, J.L. Comparative metagenomics reveals poultry and swine farming are hotspots for multidrug and tetracycline resistance. Environ. Pollut. 2023, 322, 121239. [Google Scholar] [CrossRef]
  41. CLSI, (Clinical and Laboratory Standards Institute). M02-A12—Performance Standards for Antimicrobial Disk Susceptibility Tests, 12th ed.; Approved Standard; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2015; pp. 1–96. [Google Scholar]
  42. CLSI, (Clinical and Laboratory Standards Institute). M100 Performance Standards for Antimicrobial Susceptibility Testing A CLSI Supplement for Global Application, 28th ed.; CLSI Supplement M100; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2018. [Google Scholar]
  43. CLSI, (Clinical and Laboratory Standards Institute). Performance Standards for Antimicrobial Disk and Dilution Susceptibility Tests for Bacteria Isolated From Animals, 5th ed.; CLSI Supplement VET01S; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2020. [Google Scholar]
  44. EUCAST, (The European Committee on Antimicrobial Susceptibility Testing). Breakpoint Tables for Interpretation of MICs and Zone Diameters; Version 13.0; The European Committee on Antimicrobial Susceptibility Testing: Basel, Switzerland, 2023. [Google Scholar]
  45. Cuny, C.; Layer, F.; Strommenger, B.; Witte, W. Rare Occurrence of Methicillin-Resistant Staphylococcus aureus CC130 with a novel mecA homologue in humans in Germany. PLoS ONE 2011, 6, e24360. [Google Scholar] [CrossRef] [Green Version]
  46. Zhang, K.; McClure, J.A.; Elsayed, S.; Louie, T.; Conly, J.M. Novel multiplex PCR assay for characterization and concomitant subtyping of staphylococcal cassette chromosome mec types I to V in methicillin-resistant Staphylococcus aureus. J. Clin. Microbiol. 2005, 43, 5026–5033. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Table
Table 1. Positive farms, traps, and samples to Staphylococcus spp.
Table 1. Positive farms, traps, and samples to Staphylococcus spp.
FarmsFarmed
Animals		Traps IDNumber of Positive Traps
to Staphylococcus spp.		Positive Samples to Staphylococcus spp.
ABC
1Poultry12/2+++
2+−−
2Swine30/1−−−
3Swine41/1++−
4Poultry51/1+++
5Poultry61/2−−−
7+++
6Poultry80/1−−−
7Poultry91/1+−−
8Swine102/2++−
11+−+
9Swine121/1−+−
10Swine131/1−−+
11Poultry142/2+++
15−−+
12Swine160/1−−−
13Swine171/2−−−
18++−
14Swine190/1−−−
15Swine201/1+++
16Swine210/1−−−
17Poultry221/1+++
18Swine233/3−−+
24++−
25−+−
19Swine260/2−−−
27−−−
20Swine282/2−++
29++−
21Swine302/3−−+
31−−−
32+++
22Swine331/3−−−
34−−−
35+++
Table
Table 2. Results of disk diffusion test carried out on Staphylococcus spp. isolates.
Table 2. Results of disk diffusion test carried out on Staphylococcus spp. isolates.
AntimicrobialSusceptibleIntermediateResistant
N° of Isolates%N° of Isolates%N° of Isolates%
Ampicillin2653.0600.002346.94
Amoxicillin-clavulanate4285.7100.00714.29
Cefoxitin2959.1800.002040.82
Ceftiofur3265.3148.161326.53
Chloramphenicol3775.5148.16816.33
Tetracycline2551.0248.162040.82
Enrofloxacin2551.021632.65816.33
Ciprofloxacin3469.39816.33714.29
Gentamicin3469.3924.081326.53
Amikacin1734.6900.003265.31
Trimethoprim-sulfamethoxazole3571.4336.121122.45
Erythromycin816.332244.901938.78
Rifampicin2142.86612.242244.90
Table
Table 3. Antimicrobial resistance profile of the multidrug-resistant Staphylococcus spp. isolates.
Table 3. Antimicrobial resistance profile of the multidrug-resistant Staphylococcus spp. isolates.
Isolate
Number		FarmFarmed
Animal		Traps
ID		Sample
Type		SpeciesAntimicrobial Resistance Profile
01Aa1Poultry1AS. xylosusAMP AMC FOX EFT TE ENR CIP CN AK E
01Ab1Poultry1AS. lentusAMP AMC EFT TE ENR AK SXT E RD
01B1Poultry1BS. xylosusAMP EFT TE ENR CIP CN AK E RD
01C1Poultry1CS. epidermidisAMP FOX EFT ENR CIP CN AK RD
02A1Poultry2AS. warneriAMP AMC FOX EFT TE CN AK SXT E RD
04A3Swine4AS. epidermidisAMP AMC FOX EFT C CN AK E RD *
04B3Swine4BS. epidermidisAMP FOX EFT C TE CIP CN AK E RD *
05A4Poultry5AS. lentusEFT TE AK SXT E RD
05B4Poultry5BS. saprophyticusAMP FOX C TE CN AK SXT E RD
05C4Poultry5CS. haemolyticusAMP EFT TE ENR CN AK RD
07A5Poultry7AS. epidermidisAMP AMC FOX EFT C TE ENR CIP CN AK *
07B5Poultry7BS. epidermidisAMP AMC AK SXT E RD
07C5Poultry7CS. epidermidisAMP FOX C TE ENR CIP CN AK SXT E *
09A7Poultry9AS. lentusTE CN AK E RD
10Ab8Swine10AS. xylosusC TE E
10B8Swine10BS. epidermidisAMP ENR CIP CN AK SXT RD
12B9Swine12BS. xylosusAMP EFT TE E RD
13C10Swine13CS. chonii ssp. urealyticusAMP FOX EFT TE CN AK SXT ERD
14A11Poultry14AS. chonii ssp. urealyticusAMP AK E
18B13Swine18BS. sciuriAMP AK RD
22B17Poultry22BS. haemolyticusAK SXT RD
22C17Poultry22CS. haemolyticusFOX TE AK SXT RD
23C18Swine23CS. xylosusAMP AMC C TE E RD
24B18Swine24BS. xylosusAMP E RD
28C20Swine28CS. epidermidisAMP FOX EFT AK RD
30C21Swine30CS. xylosusAMP AK E
Legend: AMP = Ampicillin, AMC = Amoxicillin-clavulanate, FOX = Cefoxitin, EFT = Ceftiofur, C = Chloramphenicol, TE = Tetracycline, ENR = Enrofloxacin, CIP = Ciprofloxacin, CN = Gentamicin, AK = Amikacin, SXT = Trimethoprim-sulfamethoxazole, E = Erythromycin, RD = rifampicin; * = mecA positive.
Table
Table 4. Primers employed in the study and related relevant information.
Table 4. Primers employed in the study and related relevant information.
GenePrimerOligonucleotide Sequence (5′-3′)Annealing
Temperature		Amplicon
Size (bp)		Reference
mecAMecA147-FGTGAAGATATACCAAGTGATT50 °C147[46]
MecA147-RATGCGCTATAGATTGAAAGGAT
mecCmecLGA251 fGCTCCTAATGCTAATGCA50 °C304[45]
mecLGA251 rTAAGCAATAATGACTACC
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Bertelloni, F.; Cagnoli, G.; Bresciani, F.; Scotti, B.; Lazzerini, L.; Marcucci, M.; Colombani, G.; Ebani, V.V. Antimicrobial Resistant Coagulase-Negative Staphylococci Carried by House Flies (Musca domestica) Captured in Swine and Poultry Farms. Antibiotics 2023, 12, 636. https://doi.org/10.3390/antibiotics12040636

AMA Style

Bertelloni F, Cagnoli G, Bresciani F, Scotti B, Lazzerini L, Marcucci M, Colombani G, Ebani VV. Antimicrobial Resistant Coagulase-Negative Staphylococci Carried by House Flies (Musca domestica) Captured in Swine and Poultry Farms. Antibiotics. 2023; 12(4):636. https://doi.org/10.3390/antibiotics12040636

Chicago/Turabian Style

Bertelloni, Fabrizio, Giulia Cagnoli, Flavio Bresciani, Bruno Scotti, Luca Lazzerini, Marco Marcucci, Giuseppe Colombani, and Valentina Virginia Ebani. 2023. "Antimicrobial Resistant Coagulase-Negative Staphylococci Carried by House Flies (Musca domestica) Captured in Swine and Poultry Farms" Antibiotics 12, no. 4: 636. https://doi.org/10.3390/antibiotics12040636

APA Style

Bertelloni, F., Cagnoli, G., Bresciani, F., Scotti, B., Lazzerini, L., Marcucci, M., Colombani, G., & Ebani, V. V. (2023). Antimicrobial Resistant Coagulase-Negative Staphylococci Carried by House Flies (Musca domestica) Captured in Swine and Poultry Farms. Antibiotics, 12(4), 636. https://doi.org/10.3390/antibiotics12040636

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop