Distinguishing Clinical Enterococcus faecium Strains and Resistance to Vancomycin Using a Simple In-House Screening Test
Abstract
1. Introduction
2. Results
2.1. Identification and TestingVvancomycin-Resistant Strains
2.2. Evaluation of In-House VREfm Screening Broth
3. Discussion
4. Materials and Methods
4.1. Bacterial Strains
4.2. Microbiological Analysis
4.3. In-House VREfm Screening Broth
4.4. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- O’Driscoll, T.; Crank, C.W. Vancomycin-resistant enterococcal infections: Epidemiology, clinical manifestations, and optimal management. Infect. Drug Resist. 2015, 8, 217–230. [Google Scholar] [PubMed]
- Tacconelli, E.; Carrara, E.; Savoldi, A.; Harbarth, S.; Mendelson, M.; Monnet, D.L.; Pulcini, C.; Kahlmeter, G.; Kluytmans, J.; Carmeli, Y.; et al. WHO Pathogens Priority List Working Group. Discovery, research, and development of new antibiotics: The WHO priority list of antibiotic-resistant bacteria and tuberculosis. Lancet Infect. Dis. 2018, 18, 318–327. [Google Scholar] [CrossRef] [Scilit]
- Rios, R.; Reyes, J.; Carvajal, L.P.; Rincon, S.; Panesso, D.; Echeverri, A.M.; Dinh, A.; Kolokotronis, S.O.; Narechania, A.; Tran, T.T.; et al. Genomic epidemiology of vancomycin-resistant Enterococcus faecium (VREfm) in Latin America: Revisiting the global VRE population structure. Sci. Rep. 2020, 10, 5636. [Google Scholar] [CrossRef] [Scilit]
- Paladino, J.A.; Sunderlin, J.L.; Adelman, M.H.; Singer, M.E.; Schentag, J.J. Observations on vancomycin use in U.S. hospitals. Am. J. Health Syst. Pharm. 2007, 64, 1633–1641. [Google Scholar] [CrossRef] [Scilit]
- Kühn, I.; Iversen, A.; Finn, M.; Greko, C.; Burman, L.G.; Blanch, A.R.; Vilanova, X.; Manero, A.; Taylor, H.; Caplin, J.; et al. Occurrence and relatedness of vancomycin-resistant enterococci in animals, humans, and the environment in different European regions. Appl. Environ. Microbiol. 2005, 71, 5383–5890. [Google Scholar] [CrossRef] [Scilit]
- Shrestha, S.; Kharel, S.; Homagain, S.; Aryal, R.; Mishra, S.K. Prevalence of vancomycin-resistant enterococci in Asia-A systematic review and meta-analysis. J. Clin. Pharm. 2021, 46, 1226–1237. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Linden, P.K. Treatment options for vancomycin-resistant enterococcal infections. Drugs 2002, 62, 425–441. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Raza, T.; Ullah, S.R.; Mehmood, K.; Andleeb, S. Vancomycin resistant Enterococci: A brief review. J. Pak. Med. Assoc. 2018, 68, 768–772. [Google Scholar]
- Bassetti, M.; Poulakou, G.; Ruppe, E.; Bouza, E.; Van Hal, S.J.; Brink, A. Antimicrobial resistance in the next 30 years, humankind, bugs and drugs: A visionary approach. Intensive Care Med. 2017, 43, 1464–1475. [Google Scholar] [CrossRef] [Scilit]
- Metan, G.; Zarakolu, P.; Unal, S. Rapid detection of antibacterial resistance in emerging Gram-positive cocci. J. Hosp. Infect. 2005, 61, 93–99. [Google Scholar] [CrossRef] [Scilit]
- Endtz, H.P.; Van Den Braak, N.; Van Belkum, A.; Goessens, W.H.; Kref, D.; Stroebel, A.B.; Verbrugh, H.A. Comparison of eight methods to detect vancomycin resistance in enterococci. J. Clin. Microbiol. 1998, 36, 592–594. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gorrie, C.; Higgs, C.; Carter, G.; Stinear, T.P.; Howden, B. Genomics of vancomycin-resistant Enterococcus faecium. Microb. Genom 2019, 5, e000283. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ulu-Kilic, A.; Özhan, E.; Altun, D.; Perçin, D.; Güneş, T.; Alp, E. Is it worth screening for vancomycin-resistant Enterococcus faecium colonization? Financial burden of screening in a developing country. Am. J. Infect. Control. 2016, 44, e45–e49. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kramer, T.S.; Remschmidt, C.; Werner, S.; Behnke, M.; Schwab, F.; Werner, G.; Gastmeier, P.; Leistner, R. The importance of adjusting for enterococcus species when assessing the burden of vancomycin resistance: A cohort study including over 1000 cases of enterococcal bloodstream infections. Antimicrob. Resist. Infect. Control 2018, 7, 133. [Google Scholar] [CrossRef] [Scilit]
- Kallstrom, G.; Doern, C.D.; Dunne, W.M., Jr. Evaluation of a chromogenic agar under development to screen for VRE colonization. J. Clin. Microbiol. 2010, 48, 999–1001. [Google Scholar] [CrossRef] [Scilit]
- Teixeira, L.M.; Carvalho, M.G.S.; Shewmaker, P.L.; Facklam, R.R. Enterococcus. In Manual of Clinical Microbiology, 10th ed.; Versalovic, J., Carroll, K.C., Funke, G., Jorgensen, J.H., Landry, M.L., Warnock, D.W., Eds.; ASM Press: Washington, DC, USA, 2011; pp. 350–364. [Google Scholar]
- Adhikari, L. High-level aminoglycoside resistance and reduced susceptibility to vancomycin in nosocomial enterococci. J. Glob. Infect. Dis. 2010, 2, 231–235. [Google Scholar] [CrossRef] [Scilit]
- Zhou, W.; Zhou, H.; Sun, Y.; Gao, S.; Zhang, Y.; Cao, X.; Zhang, Z.; Shen, H.; Zhang, C. Characterization of clinical enterococci isolates, focusing on the vancomycin-resistant enterococci in a tertiary hospital in China: Based on the data from 2013 to 2018. BMC Infect. Dis. 2020, 20, 356. [Google Scholar] [CrossRef] [Scilit]
- Gold, H.S. Vancomycin-resistant enterococci: Mechanisms and clinical observations. Clin. Infect. Dis. 2001, 33, 210–219. [Google Scholar] [CrossRef] [Scilit]
- Arredondo-Alonso, S.; Top, J.; Corander, J.; Willems, R.J.L.; Schürch, A.C. Mode and dynamics of vanA-type vancomycin resistance dissemination in Dutch hospitals. Genome Med. 2021, 13, 9. [Google Scholar] [CrossRef] [Scilit]
- Hughes, A.; Ballard, S.; Sullivan, S.; Marshall, C. An outbreak of vanA vancomycin-resistant Enterococcus faecium in a hospital with endemic vanB VRE. Infect. Dis. Health 2019, 24, 82–91. [Google Scholar] [CrossRef] [Scilit]
- Correa-Martinez, C.L.; Tönnies, H.; Froböse, N.J.; Mellmann, A.; Kampmeier, S. Transmission of vancomycin-resistant enterococci in the hospital setting: Uncovering the patient-environment interplay. Microorganisms 2020, 8, 203. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Armin, S.; Zahedani, S.S.; Rahbar, M.; Azimi, L. Prevalence and resistance profiles of vancomycin-resistant enterococcal isolates in Iran; An Eight-month Report from Nine Major Cities. Infect. Disord. Drug Targets 2020, 20, 828–833. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dziri, R.; El Kara, F.; Barguellil, F.; Ouzari, H.I.; El Asli, M.S.; Klibi, N. Vancomycin-resistant Enterococcus faecium in Tunisia: Emergence of novel clones. Microb. Drug Resist. 2019, 25, 469–474. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fioriti, S.; Simoni, S.; Caucci, S.; Morroni, G.; Ponzio, E.; Coccitto, S.N.; Brescini, L.; Cirioni, O.; Menzo, S.; Biavasco, F.; et al. Trend of clinical vancomycin-resistant enterococci isolated in a regional Italian hospital from 2001 to 2018. Braz. J. Microbiol. 2020, 51, 1607–1613. [Google Scholar] [CrossRef] [Scilit]
- Fujiya, Y.; Harada, T.; Sugawara, Y.; Akeda, Y.; Yasuda, M.; Masumi, A.; Hayashi, J.; Tanimura, N.; Tsujimoto, Y.; Shibata, W.; et al. Transmission dynamics of a linear vanA-plasmid during a nosocomial multiclonal outbreak of vancomycin-resistant enterococci in a non-endemic area, Japan. Sci. Rep. 2021, 11, 14780. [Google Scholar] [CrossRef] [Scilit]
- Resende, M.; Caierão, J.; Prates, J.G.; Narvaez, G.A.; Dias, C.A.; d’Azevedo, P.A. Emergence of vanA vancomycin-resistant Enterococcus faecium in a hospital in Porto Alegre, South Brazil. J. Infect. Dev. Ctries 2014, 8, 160–167. [Google Scholar] [CrossRef] [Scilit]
- Simner, P.J.; Adam, H.; Baxter, M.; McCracken, M.; Golding, G.; Karlowsky, J.A.; Nichol, K.; Lagacé-Wiens, P.; Gilmour, M.W.; Canadian Antimicrobial Resistance Alliance (CARA); et al. Epidemiology of vancomycin-resistant enterococci in Canadian hospitals (CANWARD study, 2007 to 2013). Antimicrob. Agents Chemother. 2015, 59, 4315–4317. [Google Scholar] [CrossRef] [Scilit]
- Jackson, C.R.; Fedorka-Cray, P.J.; Barrett, J.B. Use of a genus- and species-specific multiplex PCR for identification of enterococci. J. Clin. Microbiol. 2004, 42, 3558–3565. [Google Scholar] [CrossRef] [Scilit]
- Pérez-Hernández, X.; Méndez-Alvarez, S.; Claverie-Martín, F. A PCR assay for rapid detection of vancomycin-resistant enterococci. Diagn. Microbiol. Infect. Dis. 2002, 42, 273–277. [Google Scholar] [CrossRef] [Scilit]
- Clinical and Laboratory Standards Institute. Performance Standards for Antimicrobial Susceptibility Testing, 31st ed.; CLSI Document M100; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2021. [Google Scholar]
- McHugh, M.L. Interrater reliability: The kappa statistic. Biochem. Med. 2012, 22, 276–282. [Google Scholar] [CrossRef] [Scilit]


| Enterococci | Total | van Gene | MIC Value (μg/mL) | N | MIC Interpretation | In-House VREfm Screening Broth | Sensitivity | Specificity | |||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Tube A (No Vancomycin) | Tube B (Containing Vancomycin) | ||||||||||||
| Turbidity | Color | N | Turbidity | Color | N | ||||||||
| E. faecium (n = 71) | 48 | vanA | 128 | 41 | Resistance | + | Red | 41 | + | Red | 41 | 100% | 80% |
| 64 | 7 | + | Red | 7 | + | Red | 7 | ||||||
| 13 | vanB | 64 | 9 | + | Red | 9 | + | Red | 9 | ||||
| 32 | 4 | + | Red | 4 | + | Red | 4 | ||||||
| 10 | none | 4 | 5 | Susceptible | + | Red | 5 | + | Red | 2 | |||
| 2 | 3 | + | Red | 3 | - | ||||||||
| 1 | 2 | + | Red | 2 | - | ||||||||
| E. faecalis (n = 14) | 3 | vanA | 128 | 1 | Resistance | + | Colorless | 1 | + | Colorless | 1 | 100% | 66.6% |
| 64 | 2 | + | Colorless | 2 | + | Colorless | 2 | ||||||
| 2 | vanB | 32 | 2 | + | Colorless | 2 | + | Colorless | 2 | ||||
| 9 | none | 4 | 4 | Susceptible | + | Colorless | 4 | + | Colorless | 3 | |||
| 2 | 2 | + | Colorless | 2 | - | ||||||||
| 1 | 1 | + | Colorless | 1 | - | ||||||||
| 0.5 | 2 | + | Colorless | 2 | - | ||||||||
| E. gallinarum (n = 10) | 10 | vanC1 | 64 | 1 | Resistance | + | Colorless | 1 | + | Colorless | 1 | 90% | ND * |
| 32 | 3 | + | Colorless | 3 | + | Colorless | 3 | ||||||
| 16 | 2 | Intermediate | + | Colorless | 2 | + | Colorless | 2 | |||||
| 8 | 4 | + | Colorless | 4 | + | Colorless | 3 | ||||||
| E. casseliflavus (n = 5) | 5 | vanC2/C3 | 32 | 1 | Resistance | + | Colorless | 1 | + | Colorless | 1 | 80% | ND * |
| 16 | 1 | Intermediate | + | Colorless | 1 | + | Colorless | 1 | |||||
| 8 | 3 | + | Colorless | 3 | + | Colorless | 2 | ||||||
| E. muntdii (n = 4) | 4 | none | 0.5 | 3 | Susceptible | + | Colorless | 3 | - | ND * | 100% | ||
| 0 | 1 | + | Colorless | 1 | - | ||||||||
| E. raffinosus (n = 1) | 1 | none | 0.25 | 1 | Susceptible | + | Colorless | 1 | - | ND * | 100% | ||
| Total | 105 | 105 | 105 | 84 | |||||||||
| In-House Screening Broth | Broth Microdilution | Validity | |
|---|---|---|---|
| Positive (Vancomycin Not-Susceptible) * | Negative (Vancomycin Susceptible) | ||
| Positive (vancomycin resistance) | 79 | 5 | Accuracy = 93.3% |
| Negative (vancomycin susceptible) | 2 | 19 | |
| Validity | Sensitivity = 97.5% | Specificity = 79.2% | |
| In-House Screening Broth | PCR | Validity | |
|---|---|---|---|
| vanA, vanB, vanC1/C2/C3 | None | ||
| Positive (vancomycin resistance) | 79 | 5 | Accuracy = 93.3% |
| Negative (vancomycin susceptible) | 2 | 19 | |
| Validity | Sensitivity = 97.5% | Specificity = 79.2% | |
| Primer Name | Sequence (5′-3′) | Target | PCR Product Size (bp) | Reference |
|---|---|---|---|---|
| E. faecium-FL1 | GAAAAAACAATAGAAGAATTAT | sodA | 215 | [29] |
| E. faecium-FL2 | TGCTTTTTTGAATTCTTCTTTA | |||
| E. faecalis-FM1 | ACTTATGTGACTAACTTAACC | sodA | 360 | |
| E. faecalis-FM2 | TAATGGTGAATCTTGGTTTGG | |||
| vanA-A1 | GGGAAAACGACAATTGC | vanA | 732 | [30] |
| vanA-A2 | GTACAATGCGGCCGTTA | |||
| vanB-B1 | ATGGGAAGCCGATAGTC | vanB | 635 | |
| vanB-B2 | GATTTCGTTCCTCGACC | |||
| vanC1-C1 | GGTATCAAGGAAACCTC | vanC1 | 822 | |
| vanC1-C2 | CTTCCGCCATCATAGCT | |||
| vanC2/3-D1 | CTCCTACGATTCTCTTG | vanC2/C3 | 438 | |
| vanC2/3-D2 | CGAGCAAGACCTTTAAG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Saenhom, N.; Boueroy, P.; Chopjitt, P.; Hatrongjit, R.; Kerdsin, A. Distinguishing Clinical Enterococcus faecium Strains and Resistance to Vancomycin Using a Simple In-House Screening Test. Antibiotics 2022, 11, 286. https://doi.org/10.3390/antibiotics11030286
Saenhom N, Boueroy P, Chopjitt P, Hatrongjit R, Kerdsin A. Distinguishing Clinical Enterococcus faecium Strains and Resistance to Vancomycin Using a Simple In-House Screening Test. Antibiotics. 2022; 11(3):286. https://doi.org/10.3390/antibiotics11030286
Chicago/Turabian StyleSaenhom, Natkamon, Parichart Boueroy, Peechanika Chopjitt, Rujirat Hatrongjit, and Anusak Kerdsin. 2022. "Distinguishing Clinical Enterococcus faecium Strains and Resistance to Vancomycin Using a Simple In-House Screening Test" Antibiotics 11, no. 3: 286. https://doi.org/10.3390/antibiotics11030286
APA StyleSaenhom, N., Boueroy, P., Chopjitt, P., Hatrongjit, R., & Kerdsin, A. (2022). Distinguishing Clinical Enterococcus faecium Strains and Resistance to Vancomycin Using a Simple In-House Screening Test. Antibiotics, 11(3), 286. https://doi.org/10.3390/antibiotics11030286

