Inhibition of Quorum Sensing and Virulence Factors of Pseudomonas aeruginosa by Biologically Synthesized Gold and Selenium Nanoparticles
Abstract
:1. Introduction
2. Results
2.1. Isolation and Purification of STREPTOMYCES
2.2. Synthesis of Nanometals
2.3. Characterization of Nanometals
2.3.1. Color Change and UV-Vis Spectra Analysis
2.3.2. Determination of Particle Size and Zeta Potential
2.3.3. TEM Imaging
2.3.4. Energy Dispersive X-ray Diffraction (EDX)
2.3.5. FTIR Spectroscopy Measurements
2.4. Genotypic and Morphological Characters of Streptomyces S91
2.5. Anti-QS Activity of the Biosynthesized Nanometals
2.6. Minimal Inhibitory and Minimal Bactericidal Concentration
2.7. Effect on Bacterial Viability
2.8. Anti-Biofilm Effect of the Prepared Nanometals
2.9. Virulence Factors Inhibition by the Formed Nanometals
2.10. RT-PCR Analysis
3. Discussion
4. Materials and Methods
4.1. Microorganisms, Media, and Chemicals
4.2. Isolation of Soil Microorganisms
4.3. Purification, Microscopic Examination, and Storage of Bacterial Isolates
4.4. Screening Streptomyces Isolates for Survival under High Salt Concentrations
4.5. Synthesis of Nanometals
4.6. Characterization of the Synthesized Nanometals
4.6.1. Color Change and UV-Visible Spectroscopic Analysis
4.6.2. Particle Size Analysis, Polydispersity Index, and Zeta Potential
4.6.3. Transmission Electron Microscopy
4.6.4. Energy Dispersive X-ray Diffraction Analysis
4.6.5. FTIR Spectroscopy Measurements:
4.7. Characterization of Streptomyces
4.7.1. Molecular Characterization of Streptomyces Isolates
4.7.2. Morphological and Biochemical Characterization of Streptomyces Isolates
4.8. Antimicrobial and Antivirulence Effects of the Synthesized Nanometals
4.8.1. Violacein Inhibition Assay by the Double Layer Agar Diffusion Method
4.8.2. Evaluation of Minimum Inhibitory Concentration and Minimum Bactericidal Concentration
4.8.3. Effect of the Biosynthesized Nanometals on the Viability of P. aeruginosa Isolates
4.8.4. Biofilm Inhibition Assay
4.8.5. Quantitative Estimation of Virulence Factors
Pyocyanin Level Assay
Elastase Activity Assay
Total Protease Assay
4.9. Real-Time PCR
4.10. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Acknowledgments
Conflicts of Interest
References
- Ventola, C.L. The antibiotic resistance crisis: Part 1: Causes and threats. Pharm. Ther. 2015, 40, 277–283. [Google Scholar]
- Marston, H.D.; Dixon, D.M.; Knisely, J.M.; Palmore, T.N.; Fauci, A.S.J.J. Antimicrobial resistance. JAMA 2016, 316, 1193–1204. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Reygaert, W.C. An overview of the antimicrobial resistance mechanisms of bacteria. AIMS Microbiol. 2018, 4, 482. [Google Scholar] [CrossRef] [PubMed]
- Rudramurthy, G.R.; Swamy, M.K.; Sinniah, U.R.; Ghasemzadeh, A.J.M. Nanoparticles: Alternatives against drug-resistant pathogenic microbes. Molecules 2016, 21, 836. [Google Scholar] [CrossRef] [PubMed]
- Hall, C.W.; Mah, T.F. Molecular mechanisms of biofilm-based antibiotic resistance and tolerance in pathogenic bacteria. FEMS Microbiol. Rev. 2017, 41, 276–301. [Google Scholar] [CrossRef]
- Lee, J.; Zhang, L. The hierarchy quorum sensing network in Pseudomonas aeruginosa. Protein Cell 2015, 6, 26–41. [Google Scholar] [CrossRef] [Green Version]
- Déziel, E.; Gopalan, S.; Tampakaki, A.P.; Lépine, F.; Padfield, K.E.; Saucier, M.; Xiao, G.; Rahme, L.G. The contribution of MvfR to Pseudomonas aeruginosa pathogenesis and quorum sensing circuitry regulation: Multiple quorum sensing-regulated genes are modulated without affecting lasRI, rhlRI or the production of N-acyl-L-homoserine lactones. Mol. Microbiol. 2005, 55, 998–1014. [Google Scholar] [CrossRef]
- Pesci, E.C.; Milbank, J.B.; Pearson, J.P.; McKnight, S.; Kende, A.S.; Greenberg, E.P.; Iglewski, B.H. Quinolone signaling in the cell-to-cell communication system of Pseudomonas aeruginosa. Proc. Natl. Acad. Sci. USA 1999, 96, 11229–11234. [Google Scholar] [CrossRef] [Green Version]
- Gallagher, L.A.; McKnight, S.L.; Kuznetsova, M.S.; Pesci, E.C.; Manoil, C. Functions required for extracellular quinolone signaling by Pseudomonas aeruginosa. J. Bacteriol. 2002, 184, 6472–6480. [Google Scholar] [CrossRef] [Green Version]
- Lee, J.; Wu, J.; Deng, Y.; Wang, J.; Wang, C.; Wang, J.; Chang, C.; Dong, Y.; Williams, P.; Zhang, L.H. A cell-cell communication signal integrates quorum sensing and stress response. Nat. Chem. Biol. 2013, 9, 339–343. [Google Scholar] [CrossRef]
- Sahoo, S.K.; Parveen, S.; Panda, J.J. The present and future of nanotechnology in human health care. Nanomed. Nanotechnol. Biol. Med. 2007, 3, 20–31. [Google Scholar] [CrossRef]
- Shaker, M.A.; Shaaban, M.I. Formulation of carbapenems loaded gold nanoparticles to combat multi-antibiotic bacterial resistance: In vitro antibacterial study. Int. J. Pharm. 2017, 525, 71–84. [Google Scholar] [CrossRef] [PubMed]
- El-Mowafy, M.; Elgaml, A.; Shaaban, M. New Approaches for Competing Microbial Resistance and Virulence. In Microorganisms; IntechOpen Limited: London, UK, 2019. [Google Scholar]
- Rai, M.; Shegokar, R. Metal Nanoparticles in Pharma; Springer: Berlin/Heidelberg, Germany, 2017. [Google Scholar]
- Huh, A.J.; Kwon, Y.J. “Nanoantibiotics”: A new paradigm for treating infectious diseases using nanomaterials in the antibiotics resistant era. J. Control. Release Off. J. Control. Release Soc. 2011, 156, 128–145. [Google Scholar] [CrossRef] [PubMed]
- Sharma, M.; Prasher, P.J.N. Metallic Nanoparticles at the Biointerface: Current Perspectives and Future Challenges. Nanotechnology 2020, 261–276. [Google Scholar]
- Lemire, J.A.; Harrison, J.J.; Turner, R.J. Antimicrobial activity of metals: Mechanisms, molecular targets and applications. Nat. Rev. Microbiol. 2013, 11, 371–384. [Google Scholar] [CrossRef] [PubMed]
- Hu, X.; Zhang, Y.; Ding, T.; Liu, J.; Zhao, H. Multifunctional Gold Nanoparticles: A Novel Nanomaterial for Various Medical Applications and Biological Activities. Front. Bioeng. Biotechnol. 2020, 8, 990. [Google Scholar] [CrossRef] [PubMed]
- Khurana, A.; Tekula, S.; Saifi, M.A.; Venkatesh, P.; Godugu, C. Therapeutic applications of selenium nanoparticles. Biomed. Pharmacother. 2019, 111, 802–812. [Google Scholar] [CrossRef] [PubMed]
- Zeng, H.; Combs, G.F., Jr. Selenium as an anticancer nutrient: Roles in cell proliferation and tumor cell invasion. J. Nutr. Biochem. 2008, 19, 1–7. [Google Scholar] [CrossRef]
- Ferro, C.; Florindo, H.F.; Santos, H.A. Selenium Nanoparticles for Biomedical Applications: From Development and Characterization to Therapeutics. Adv. Healthc. Mater. 2021, 10, 2100598. [Google Scholar] [CrossRef]
- Shaaban, M.; Elgaml, A.; Habib, E.E. Biotechnological applications of quorum sensing inhibition as novel therapeutic strategies for multidrug resistant pathogens. Microb. Pathog. 2019, 127, 138–143. [Google Scholar] [CrossRef]
- Ramalingam, V. Multifunctionality of gold nanoparticles: Plausible and convincing properties. Adv. Colloid Interface Sci. 2019, 271, 101989. [Google Scholar] [CrossRef] [PubMed]
- Smitha, S.; Philip, D.; Gopchandran, K.; Spectroscopy, B. Green synthesis of gold nanoparticles using Cinnamomum zeylanicum leaf broth. Acta Part A Mol. Biomol. Spectrosc. 2009, 74, 735–739. [Google Scholar] [CrossRef] [PubMed]
- Procópio, R.E.; Silva, I.R.; Martins, M.K.; Azevedo, J.L.; Araújo, J.M. Antibiotics produced by Streptomyces. Braz. J. Infect. Dis. Off. Publ. Braz. Soc. Infect. Dis. 2012, 16, 466–471. [Google Scholar] [CrossRef] [Green Version]
- Ribeiro da Cunha, B.; Fonseca, L.P.; Calado, C.R.J.A. Antibiotic discovery: Where have we come from, where do we go? Antibiotics 2019, 8, 45. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Al-Ansari, M.; Alkubaisi, N.; Vijayaragavan, P.; Murugan, K. Antimicrobial potential of Streptomyces sp. to the Gram positive and Gram negative pathogens. J. Infect. Public Health 2019, 12, 861–866. [Google Scholar] [CrossRef]
- Arasu, M.V.; Al-Dhabi, N.A.; Choi, K.C. Identification of novel quinine metabolite from marine actinomycetes with antifungal and anticancer bio-prospective. Fresenius Environ. Bull. 2015, 24, 3281–3287. [Google Scholar]
- Medina Cruz, D.; Mi, G.; Webster, T.J. Synthesis and characterization of biogenic selenium nanoparticles with antimicrobial properties made by Staphylococcus aureus, methicillin-resistant Staphylococcus aureus (MRSA), Escherichia coli, and Pseudomonas aeruginosa. J. Biomed. Mater. Res. Part A 2018, 106, 1400–1412. [Google Scholar] [CrossRef] [PubMed]
- Saitou, N.; Nei, M. The neighbor-joining method: A new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 1987, 4, 406–425. [Google Scholar] [CrossRef]
- Franci, G.; Falanga, A.; Galdiero, S.; Palomba, L.; Rai, M.; Morelli, G.; Galdiero, M.J.M. Silver nanoparticles as potential antibacterial agents. Molecules 2015, 20, 8856–8874. [Google Scholar] [CrossRef] [Green Version]
- Rai, A.; Prabhune, A.; Perry, C.C. Antibiotic mediated synthesis of gold nanoparticles with potent antimicrobial activity and their application in antimicrobial coatings. J. Mater. Chem. 2010, 20, 6789–6798. [Google Scholar] [CrossRef] [Green Version]
- Sadiq, I.M.; Chowdhury, B.; Chandrasekaran, N.; Mukherjee, A. Antimicrobial sensitivity of Escherichia coli to alumina nanoparticles. Nanomed. Nanotechnol. Biol. Med. 2009, 5, 282–286. [Google Scholar] [CrossRef]
- Mukherjee, A.; Sadiq, I.M.; Prathna, T.; Chandrasekaran, N. Antimicrobial activity of aluminium oxide nanoparticles for potential clinical applications. Sci. Microb. Pathog. Commun. Curr. Res. Technol. Adv. 2011, 1, 245–251. [Google Scholar]
- Padmavathy, N.; Vijayaraghavan, R. Enhanced bioactivity of ZnO nanoparticles—An antimicrobial study. Sci. Technol. Adv. Mater. 2008, 9, 035004. [Google Scholar] [CrossRef] [PubMed]
- Chatterjee, A.K.; Sarkar, R.K.; Chattopadhyay, A.P.; Aich, P.; Chakraborty, R.; Basu, T.J.N. A simple robust method for synthesis of metallic copper nanoparticles of high antibacterial potency against E. coli. Nanotechnology 2012, 23, 085103. [Google Scholar] [CrossRef] [PubMed]
- Behera, S.S.; Patra, J.K.; Pramanik, K.; Panda, N.; Thatoi, H. Characterization and evaluation of antibacterial activities of chemically synthesized iron oxide nanoparticles. World J. Nano Sci. Eng. 2012, 02, 196–200. [Google Scholar] [CrossRef] [Green Version]
- Andronescu, E.; Brown, J.M.; Oktar, F.N.; Agathopoulos, S.; Chou, J.; Obata, A. Nanomaterials for medical applications: Benefits and risks. J. Nanomater. 2016, 2016, 8284319. [Google Scholar] [CrossRef]
- Kharissova, O.V.; Dias, H.R.; Kharisov, B.I.; Pérez, B.O.; Pérez, V.M.J. The greener synthesis of nanoparticles. Trends Biotechnol. 2013, 31, 240–248. [Google Scholar] [CrossRef]
- Hammami, I.; Alabdallah, N.M. Gold nanoparticles: Synthesis properties and applications. J. King Saud Univ.-Sci. 2021, 33, 101560. [Google Scholar] [CrossRef]
- Mughal, B.; Zaidi, S.Z.J.; Zhang, X.; Hassan, S. Biogenic Nanoparticles: Synthesis, Characterisation and Applications. Appl. Sci. 2021, 11, 2598. [Google Scholar] [CrossRef]
- Katas, H.; Lim, C.S.; Nor Azlan, A.Y.H.; Buang, F.; Mh Busra, M.F. Antibacterial activity of biosynthesized gold nanoparticles using biomolecules from Lignosus rhinocerotis and chitosan. Saudi Pharm. J. 2019, 27, 283–292. [Google Scholar] [CrossRef]
- Wang, L.; Hu, C.; Shao, L. The antimicrobial activity of nanoparticles: Present situation and prospects for the future. Int. J. Nanomed. 2017, 12, 1227. [Google Scholar] [CrossRef] [Green Version]
- Husseiny, M.; Abd El-Aziz, M.; Badr, Y.; Mahmoud, M.; Spectroscopy, B. Biosynthesis of gold nanoparticles using Pseudomonas aeruginosa. Spectrochim. Acta Part A Mol. Biomol. Spectrosc. 2007, 67, 1003–1006. [Google Scholar] [CrossRef] [PubMed]
- Fesharaki, P.J.; Nazari, P.; Shakibaie, M.; Rezaie, S.; Banoee, M.; Abdollahi, M.; Shahverdi, A.R. Biosynthesis of selenium nanoparticles using Klebsiella pneumoniae and their recovery by a simple sterilization process. Braz. J. Microbiol. 2010, 41, 461–466. [Google Scholar] [CrossRef]
- Ranjitha, V.; Ravishankar, V.R. Extracellular synthesis of selenium nanoparticles from an actinomycetes streptomyces griseoruber and evaluation of its cytotoxicity on HT-29 cell line. Pharm. Nanotechnol. 2018, 6, 61–68. [Google Scholar] [CrossRef] [PubMed]
- Ranjitha, V.; Rai, V.R. Actinomycetes mediated synthesis of gold nanoparticles from the culture supernatant of Streptomyces griseoruber with special reference to catalytic activity. 3 Biotech 2017, 7, 299. [Google Scholar] [CrossRef]
- Li, Y.; Li, Y.; Li, Q.; Fan, X.; Gao, J.; Luo, Y. Rapid biosynthesis of gold nanoparticles by the extracellular secretion of Bacillus niabensis 45: Characterization and antibiofilm activity. J. Chem. 2016, 2016. [Google Scholar] [CrossRef] [Green Version]
- Składanowski, M.; Wypij, M.; Laskowski, D.; Golińska, P.; Dahm, H.; Rai, M. Silver and gold nanoparticles synthesized from Streptomyces sp. isolated from acid forest soil with special reference to its antibacterial activity against pathogens. J. Clust. Sci. 2017, 28, 59–79. [Google Scholar] [CrossRef] [Green Version]
- Ahmad, M.S.; Yasser, M.M.; Sholkamy, E.N.; Ali, A.M.; Mehanni, M. Anticancer activity of biostabilized selenium nanorods synthesized by Streptomyces bikiniensis strain Ess_amA-1. Int. J. Nanomed. 2015, 10, 3389. [Google Scholar]
- Balagurunathan, R.; Radhakrishnan, M.; Rajendran, R.B.; Velmurugan, D. Biosynthesis of gold nanoparticles by actinomycete Streptomyces viridogens strain HM10. Indian J. Biochem. Biophys. 2011, 48, 331–335. [Google Scholar] [PubMed]
- Sharma, N.; Pinnaka, A.K.; Raje, M.; Fnu, A.; Bhattacharyya, M.S.; Choudhury, A.R. Exploitation of marine bacteria for production of gold nanoparticles. Microb. Cell Factories 2012, 11, 86. [Google Scholar] [CrossRef] [Green Version]
- Molnár, Z.; Bódai, V.; Szakacs, G.; Erdélyi, B.; Fogarassy, Z.; Sáfrán, G.; Varga, T.; Kónya, Z.; Tóth-Szeles, E.; Szűcs, R.; et al. Green synthesis of gold nanoparticles by thermophilic filamentous fungi. Sci. Rep. 2018, 8, 3943. [Google Scholar] [CrossRef]
- Wang, P.; Wang, X.; Wang, L.; Hou, X.; Liu, W.; Chen, C. Interaction of gold nanoparticles with proteins and cells. Sci. Technol. Adv. Mater. 2015, 16, 034610. [Google Scholar] [CrossRef] [PubMed]
- Mollick, M.M.R.; Rana, D.; Dash, S.K.; Chattopadhyay, S.; Bhowmick, B.; Maity, D.; Mondal, D.; Pattanayak, S.; Roy, S.; Chakraborty, M. Studies on green synthesized silver nanoparticles using Abelmoschus esculentus (L.) pulp extract having anticancer (in vitro) and antimicrobial applications. Arab. J. Chem. 2019, 12, 2572–2584. [Google Scholar] [CrossRef] [Green Version]
- Ponce, A.; Aguilar, J.A.; Tate, J.; Yacamán, M.J. Advances in the electron diffraction characterization of atomic clusters and nanoparticles. Nanoscale Adv. 2021, 3, 311–325. [Google Scholar] [CrossRef]
- Sett, A.; Gadewar, M.; Sharma, P.; Deka, M.; Bora, U. Green synthesis of gold nanoparticles using aqueous extract of Dillenia indica. Adv. Nat. Sci. Nanosci. Nanotechnol. 2016, 7, 025005. [Google Scholar] [CrossRef]
- Tam, K.; Ho, C.; Lee, J.; Lai, M.; Chang, C.; Rheem, Y.; Chen, H.; Hur, N.; Myung, V.J.B.B.B. Critical evaluation of nanoparticle tracking analysis (NTA) by nanosight for the measurement of nanoparticles and protein aggregates. Pharm. Res. 2010, 74, 696–700. [Google Scholar]
- Kora, A.J. Bacillus cereus, selenite-reducing bacterium from contaminated lake of an industrial area: A renewable nanofactory for the synthesis of selenium nanoparticles. Bioresour. Bioprocess. 2018, 5, 30. [Google Scholar] [CrossRef] [Green Version]
- Shankar, S.S.; Rai, A.; Ankamwar, B.; Singh, A.; Ahmad, A.; Sastry, M. Biological synthesis of triangular gold nanoprisms. Nat. Mater. 2004, 3, 482–488. [Google Scholar] [CrossRef] [PubMed]
- Manivasagan, P.; Bharathiraja, S.; Bui, N.Q.; Jang, B.; Oh, Y.O.; Lim, I.G.; Oh, J. Doxorubicin-loaded fucoidan capped gold nanoparticles for drug delivery and photoacoustic imaging. Int. J. Biol. Macromol. 2016, 91, 578–588. [Google Scholar] [CrossRef]
- Khan, F.; Manivasagan, P.; Lee, J.W.; Pham, D.T.N.; Oh, J.; Kim, Y.M. Fucoidan-Stabilized Gold Nanoparticle-Mediated Biofilm Inhibition, Attenuation of Virulence and Motility Properties in Pseudomonas aeruginosa PAO1. Mar. Drugs 2019, 17, 208. [Google Scholar] [CrossRef] [Green Version]
- Prasad, K.; Vyas, P.; Prajapati, V.; Patel, P.; Selvaraj, K.J.M.; Letters, N. Biomimetic synthesis of selenium nanoparticles using cell-free extract of Microbacterium sp. ARB05. Micro Nano Lett. 2012, 7, 1–4. [Google Scholar] [CrossRef]
- Santanu, S.; Sowmiya, R.; Balakrishnaraja, R. Biosynthesis of selenium nanoparticles using citrus reticulata peel extract. World J. Pharm. Res. 2015, 4, 1322–1330. [Google Scholar]
- Cremonini, E.; Zonaro, E.; Donini, M.; Lampis, S.; Boaretti, M.; Dusi, S.; Melotti, P.; Lleo, M.M.; Vallini, G. Biogenic selenium nanoparticles: Characterization, antimicrobial activity and effects on human dendritic cells and fibroblasts. Microb. Biotechnol. 2016, 9, 758–771. [Google Scholar] [CrossRef]
- Zhang, C.; Zhai, X.; Zhao, G.; Ren, F.; Leng, X. Synthesis, characterization, and controlled release of selenium nanoparticles stabilized by chitosan of different molecular weights. Carbohydr. Polym. 2015, 134, 158–166. [Google Scholar] [CrossRef] [PubMed]
- Sengani, M. Identification of potential antioxidant indices by biogenic gold nanoparticles in hyperglycemic Wistar rats. Environ. Toxicol. Pharmacol. 2017, 50, 11–19. [Google Scholar] [CrossRef]
- Mittal, A.K.; Chisti, Y.; Banerjee, U.C. Synthesis of metallic nanoparticles using plant extracts. Biotechnol. Adv. 2013, 31, 346–356. [Google Scholar] [CrossRef] [PubMed]
- Orr, H.A. The genetic theory of adaptation: A brief history. Nat. Rev. Genet. 2005, 6, 119–127. [Google Scholar] [CrossRef] [PubMed]
- Gebreyohannes, G.; Nyerere, A.; Bii, C.; Sbhatu, D.B. Challenges of intervention, treatment, and antibiotic resistance of biofilm-forming microorganisms. Heliyon 2019, 5, e02192. [Google Scholar] [CrossRef] [Green Version]
- Saxena, P.; Joshi, Y.; Rawat, K.; Bisht, R. Biofilms: Architecture, Resistance, Quorum Sensing and Control Mechanisms. Indian J. Microbiol. 2019, 59, 3–12. [Google Scholar] [CrossRef]
- Ali, S.G.; Ansari, M.A.; Alzohairy, M.A.; Alomary, M.N.; AlYahya, S.; Jalal, M.; Khan, H.M.; Asiri, S.M.M.; Ahmad, W.; Mahdi, A.A.; et al. Biogenic Gold Nanoparticles as Potent Antibacterial and Antibiofilm Nano-Antibiotics against Pseudomonas aeruginosa. Antibiotics 2020, 9, 100. [Google Scholar] [CrossRef] [Green Version]
- Parasuraman, P.; Antony, A.P.; B, S.L.S.; Sharan, A.; Siddhardha, B.; Kasinathan, K.; Bahkali, N.A.; Dawoud, T.M.S.; Syed, A. Antimicrobial photodynamic activity of toluidine blue encapsulated in mesoporous silica nanoparticles against Pseudomonas aeruginosa and Staphylococcus aureus. Biofouling 2019, 35, 89–103. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sandri, A.; Ortombina, A.; Boschi, F.; Cremonini, E.; Boaretti, M.; Sorio, C.; Melotti, P.; Bergamini, G.; Lleo, M. Inhibition of Pseudomonas aeruginosa secreted virulence factors reduces lung inflammation in CF mice. Virulence 2018, 9, 1008–1018. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ahmed, S.; Rudden, M.; Smyth, T.J.; Dooley, J.S.G.; Marchant, R.; Banat, I.M. Natural quorum sensing inhibitors effectively downregulate gene expression of Pseudomonas aeruginosa virulence factors. Appl. Microbiol. Biotechnol. 2019, 103, 3521–3535. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Prateeksha; Singh, B.R.; Shoeb, M.; Sharma, S.; Naqvi, A.H.; Gupta, V.K.; Singh, B.N. Scaffold of Selenium Nanovectors and Honey Phytochemicals for Inhibition of Pseudomonas aeruginosa Quorum Sensing and Biofilm Formation. Front. Cell. Infect. Microbiol. 2017, 7, 93. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Samanta, S.; Singh, B.R.; Adholeya, A. Intracellular Synthesis of Gold Nanoparticles Using an Ectomycorrhizal Strain EM-1083 of Laccaria fraterna and Its Nanoanti-quorum Sensing Potential Against Pseudomonas aeruginosa. Indian J. Microbiol. 2017, 57, 448–460. [Google Scholar] [CrossRef]
- Li, X.-H.; Lee, J.-H. Quorum sensing-dependent post-secretional activation of extracellular proteases in Pseudomonas aeruginosa. J. Biol. Chem. 2019, 294, 19635–19644. [Google Scholar] [CrossRef]
- McKnight, S.L.; Iglewski, B.H.; Pesci, E.C. The Pseudomonas quinolone signal regulates rhl quorum sensing in Pseudomonas aeruginosa. J. Bacteriol. 2000, 182, 2702–2708. [Google Scholar] [CrossRef] [Green Version]
- Pearson, J.P.; Gray, K.M.; Passador, L.; Tucker, K.D.; Eberhard, A.; Iglewski, B.H.; Greenberg, E. Structure of the autoinducer required for expression of Pseudomonas aeruginosa virulence genes. Proc. Natl. Acad. Sci. USA 1994, 91, 197–201. [Google Scholar] [CrossRef] [Green Version]
- Pearson, J.P.; Passador, L.; Iglewski, B.H.; Greenberg, E. A second N-acylhomoserine lactone signal produced by Pseudomonas aeruginosa. Proc. Natl. Acad. Sci. USA 1995, 92, 1490–1494. [Google Scholar] [CrossRef] [Green Version]
- Pearson, J.P.; Pesci, E.C.; Iglewski, B.H. Roles of Pseudomonas aeruginosa las and rhl quorum-sensing systems in control of elastase and rhamnolipid biosynthesis genes. J. Bacteriol. 1997, 179, 5756–5767. [Google Scholar] [CrossRef] [Green Version]
- Jeffrey, L.S.H. Isolation, characterization and identification of actinomycetes from agriculture soils at Semongok, Sarawak. Afr. J. Biotechnol. 2008, 7, 3697–3702. [Google Scholar]
- Shaaban, M.; El-Mahdy, A.M. Biosynthesis of Ag, Se, and ZnO nanoparticles with antimicrobial activities against resistant pathogens using waste isolate Streptomyces enissocaesilis. IET Nanobiotechnol. 2018, 12, 741–747. [Google Scholar] [CrossRef] [PubMed]
- Shamsuzzaman; Mashrai, A.; Khanam, H.; Aljawfi, R.N. Biological synthesis of ZnO nanoparticles using C. albicans and studying their catalytic performance in the synthesis of steroidal pyrazolines. Arab. J. Chem. 2017, 10, S1530–S1536. [Google Scholar] [CrossRef] [Green Version]
- Haiss, W.; Thanh, N.T.; Aveyard, J.; Fernig, D.G. Determination of size and concentration of gold nanoparticles from UV−Vis spectra. Anal. Chem. 2007, 79, 4215–4221. [Google Scholar] [CrossRef] [PubMed]
- Fraczek, M.G.; Zhao, C.; Dineen, L.; Lebedinec, R.; Bowyer, P.; Bromley, M.; Delneri, D. Fast and reliable PCR amplification from Aspergillus fumigatus spore suspension without traditional DNA extraction. Curr. Protoc. Microbiol. 2019, 54, e89. [Google Scholar] [CrossRef]
- Maidak, B.L.; Cole, J.R.; Lilburn, T.G.; Parker, C.T., Jr.; Saxman, P.R.; Stredwick, J.M.; Garrity, G.M.; Li, B.; Olsen, G.J.; Pramanik, S.; et al. The RDP (ribosomal database project) continues. Nucleic Acids Res. 2000, 28, 173–174. [Google Scholar] [CrossRef] [Green Version]
- Tamura, K.; Peterson, D.; Peterson, N.; Stecher, G.; Nei, M.; Kumar, S. MEGA5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 2011, 28, 2731–2739. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- McClean, K.H.; Winson, M.K.; Fish, L.; Taylor, A.; Chhabra, S.R.; Camara, M.; Daykin, M.; Lamb, J.H.; Swift, S.; Bycroft, B.W. Quorum sensing and Chromobacterium violaceum: Exploitation of violacein production and inhibition for the detection of N-acylhomoserine lactones. Microbiology 1997, 143, 3703–3711. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- McLean, R.J.; Pierson, L.S., III; Fuqua, C. A simple screening protocol for the identification of quorum signal antagonists. J. Microbiol. Methods 2004, 58, 351–360. [Google Scholar] [CrossRef]
- CLSI. Performance Standards for Antimicrobial Susceptibility Testing. In Clinical and Laboratory Standards Institute, 27th ed.; CLSI: Wayne, PA, USA, 2017. [Google Scholar]
- Nalca, Y.; Jänsch, L.; Bredenbruch, F.; Geffers, R.; Buer, J.; Häussler, S. Quorum-sensing antagonistic activities of azithromycin in Pseudomonas aeruginosa PAO1: A global approach. Antimicrob. Agents Chemother. 2006, 50, 1680–1688. [Google Scholar] [CrossRef] [Green Version]
- O’Toole, G.A. Microtiter dish biofilm formation assay. J. Vis. Exp. JoVE 2011, 47, 2437. [Google Scholar] [CrossRef] [PubMed]
- Essar, D.W.; Eberly, L.; Hadero, A.; Crawford, I. Identification and characterization of genes for a second anthranilate synthase in Pseudomonas aeruginosa: Interchangeability of the two anthranilate synthases and evolutionary implications. J. Bacteriol. 1990, 172, 884–900. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Adonizio, A.; Kong, K.-F.; Mathee, K. Inhibition of quorum sensing-controlled virulence factor production in Pseudomonas aeruginosa by South Florida plant extracts. Antimicrob. Agents Chemother. 2008, 52, 198–203. [Google Scholar] [CrossRef] [Green Version]
- El-Shaer, S.; Shaaban, M.; Barwa, R.; Hassan, R. Control of quorum sensing and virulence factors of Pseudomonas aeruginosa using phenylalanine arginyl β-naphthylamide. J. Med. Microbiol. 2016, 65, 1194–1204. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]














| P. aeruginosa | MICs /MBCs of NPs (µg/mL) | 1/2 MIC (µg/mL) | 1/4 MIC (µg/mL) | |
|---|---|---|---|---|
| Au-NPs | PAO-JP2 | 9.2/18.5 | 4.6 | 2.3 |
| PAO1 | 36.9/147.7 | 18.5 | 9.2 | |
| PAO14 | 18.5/36.9 | 9.2 | 4.6 | |
| KU6 | 18.5/147.7 | 9.2 | 4.6 | |
| 52 | 18.5/73.9 | 9.2 | 4.6 | |
| Se-NP | PAO-JP2 | 4.6/74.02 | 2.3 | 1.2 |
| PAO1 | 592.2/1184.4 | 296.1 | 148.1 | |
| PAO14 | 592.2/1184.4 | 296.1 | 148.1 | |
| KU6 | 592.2/1184.4 | 296.1 | 148.1 | |
| 52 | 1184.4/1184.4 | 592.2 | 296.1 | |
| PAO-JP2 | ˂2/˂2 | ˂2 | ˂2 | |
| Ceftazidime | PAO1 | 4/16 | 2 | 1 |
| PAO14 | 64/128 | 32 | 16 | |
| KU6 | 16/128 | 8 | 4 | |
| 52 | 4/8 | 2 | 1 | |
| PAO-JP2 | ˂2/˂2 | ˂2 | ˂2 | |
| PAO1 | 16/128 | 8 | 4 | |
| PAO14 | 8/2048 | 4 | 2 | |
| Ciprofloxacin | KU6 | 256/256 | 128 | 64 |
| 52 | 256/512 | 128 | 64 |
| Primer | Sequence (5′→3′) | Annealing Temperature (°C) | Amplicon (bp) |
|---|---|---|---|
| RpoD For | CGAACTGCTTGCCGACTT | 56 | 131 |
| RpoD Rev | GCGAGAGCCTCAAGGATAC | ||
| LasI For | CGCACATCTGGGAACTCA | 56 | 176 |
| LasI Rev | CGGCACGGATCATCATCT | ||
| LasR For | CTGTGGATGCTCAAGGACTAC | 56 | 133 |
| LasR Rev | AACTGGTCTTGCCGATGG | ||
| RhlI For | GTAGCGGGTTTGCGGATG | 58 | 101 |
| RhlI Rev | CGGCATCAGGTCTTCATCG | ||
| RhlR For | GCCAGCGTCTTGTTCGG | 56 | 160 |
| RhlR rev | CGGTCTGCCTGAGCCATC | ||
| PqsA For | GACCGGCTGTATTCGATTC | 58 | 74 |
| PqsA rev | GCTGAACCAGGGAAAGAAC | ||
| PqsR For | CTGATCTGCCGGTAATTGG | 56 | 142 |
| PqsR rev | ATCGACGAGGAACTGAAGA | ||
| LasB For | GGTAGAACGCACGGTTGT | 56 | 165 |
| LasB rev | GGCAAGAACGACTTCCTGAT | ||
| ToxA For | CCGCCGAAGACGATGCTT | 58 | 85 |
| ToxA rev | CACCGCCAACTGGAGGAG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Elshaer, S.L.; Shaaban, M.I. Inhibition of Quorum Sensing and Virulence Factors of Pseudomonas aeruginosa by Biologically Synthesized Gold and Selenium Nanoparticles. Antibiotics 2021, 10, 1461. https://doi.org/10.3390/antibiotics10121461
Elshaer SL, Shaaban MI. Inhibition of Quorum Sensing and Virulence Factors of Pseudomonas aeruginosa by Biologically Synthesized Gold and Selenium Nanoparticles. Antibiotics. 2021; 10(12):1461. https://doi.org/10.3390/antibiotics10121461
Chicago/Turabian StyleElshaer, Soha Lotfy, and Mona I. Shaaban. 2021. "Inhibition of Quorum Sensing and Virulence Factors of Pseudomonas aeruginosa by Biologically Synthesized Gold and Selenium Nanoparticles" Antibiotics 10, no. 12: 1461. https://doi.org/10.3390/antibiotics10121461
APA StyleElshaer, S. L., & Shaaban, M. I. (2021). Inhibition of Quorum Sensing and Virulence Factors of Pseudomonas aeruginosa by Biologically Synthesized Gold and Selenium Nanoparticles. Antibiotics, 10(12), 1461. https://doi.org/10.3390/antibiotics10121461

