Effects of the Dietary Replacement of Soybean Oil with Rubber Seed Oil on the Growth Performance, Carcass Trait, and Status of Lipid Metabolism in Pekin Ducks
Abstract
:1. Introduction
2. Materials and Methods
2.1. Animals, Diet, and Management
2.2. Data Collection and Sample Preparation
2.3. Plasma Biochemical Parameters
2.4. Liver and Breast Chemical Compositions
2.5. Liver Fatty Acid Profile
2.6. Liver Gene Expression
2.7. Statistical Analysis
3. Results
3.1. Growth Performance and Carcass Traits
3.2. Plasma Biochemical Parameters
3.3. Liver and Breast Chemical Composition
3.4. Liver Fatty Acid Profile
3.5. Liver Gene Expression
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
References
- Bai, Z.; Ma, W.; Ma, L.; Velthof, G.L.; Wei, Z.; Havlik, P.; Oenema, O.; FLee, M.R.F.; Zhang, F. China’s livestock transition: Driving forces, impacts, and consequences. Sci. Adv. 2018, 4, 8534. [Google Scholar] [CrossRef]
- Liu, J.; Zhao, L.; Cai, H.; Zhao, Z.; Wu, Y.; Wen, Z.; Yang, P. Antioxidant and Anti-Inflammatory Properties of Rubber Seed Oil in Lipopolysaccharide-Induced RAW 267.4 Macrophages. Nutrients 2022, 14, 1349. [Google Scholar] [CrossRef]
- Ahmad, J.; Yusup, S.; Bokhari, A.; Kamil, R.N.M. Study of fuel properties of rubber seed oil based biodiesel. Energy Convers. Manag. 2014, 78, 266–275. [Google Scholar] [CrossRef]
- Pi, Y.; Gao, S.T.; Ma, L.; Zhu, Y.X.; Wang, J.Q.; Zhang, J.M.; Xu, J.C.; Bu, D.P. Effectiveness of rubber seed oil and flaxseed oil to enhance the alpha-linolenic acid content in milk from dairy cows. J. Dairy. Sci. 2016, 99, 5719–5730. [Google Scholar] [CrossRef]
- Wen, Z.; Wu, Y.; Qi, Z.; Li, X.; Li, F.; Wu, X.; Yang, P. Rubber seed oil supplementation enriches n-3 polyunsaturated fatty acids and reduces cholesterol contents of egg yolks in laying hens. Food Chem. 2019, 301, 125198. [Google Scholar] [CrossRef]
- Liu, J.; Zhao, L.; Zhao, Z.; Wu, Y.; Cao, J.; Cai, H.; Yang, P.; Wen, Z. Rubber (Hevea brasiliensis) seed oil supplementation attenuates immunological stress and inflammatory response in lipopolysaccharide-challenged laying hens. Poult. Sci. 2022, 101, 102040. [Google Scholar] [CrossRef]
- Watanabe, Y.; Tatsuno, I. Prevention of Cardiovascular Events with Omega-3 Polyunsaturated Fatty Acids and the Mechanism Involved. J. Atheroscler. Thromb. 2020, 27, 183–198. [Google Scholar] [CrossRef] [PubMed]
- Yu, J.Z.; Wang, J.; Sheridan, S.D.; Perlis, R.H.; Rasenick, M.M. N-3 polyunsaturated fatty acids promote astrocyte differentiation and neurotrophin production independent of cAMP in patient-derived neural stem cells. Mol. Psychiatry 2021, 26, 4605–4615. [Google Scholar] [CrossRef]
- Tortosa-Caparros, E.; Navas-Carrillo, D.; Marin, F.; Orenes-Pinero, E. Anti-inflammatory effects of omega 3 and omega 6 polyunsaturated fatty acids in cardiovascular disease and metabolic syndrome. Crit. Rev. Food Sci. Nutr. 2017, 57, 3421–3429. [Google Scholar] [CrossRef] [PubMed]
- Abrescia, P.; Treppiccione, L.; Rossi, M.; Bergamo, P. Modulatory role of dietary polyunsaturated fatty acids in Nrf2-mediated redox homeostasis. Prog. Lipid Res. 2020, 80, 101066. [Google Scholar] [CrossRef] [PubMed]
- Zhang, T.T.; Xu, J.; Wang, Y.M.; Xue, C.H. Health benefits of dietary marine DHA/EPA-enriched glycerophospholipids. Prog. Lipid Res. 2019, 75, 100997. [Google Scholar] [CrossRef]
- Kutzner, L.; Esselun, C.; Franke, N.; Schoenfeld, K.; Eckert, G.P.; Schebb, N.H. Effect of dietary EPA and DHA on murine blood and liver fatty acid profile and liver oxylipin pattern depending on high and low dietary n6-PUFA. Food Funct. 2020, 11, 9177–9191. [Google Scholar] [CrossRef] [PubMed]
- Kalakuntla, S.; Nagireddy, N.K.; Panda, A.K.; Jatoth, N.; Thirunahari, R.; Vangoor, R.R. Effect of dietary incorporation of n-3 polyunsaturated fatty acids rich oil sources on fatty acid profile, keeping quality and sensory attributes of broiler chicken meat. Anim. Nutr. 2017, 3, 386–391. [Google Scholar] [CrossRef] [PubMed]
- Long, S.F.; Kang, S.; Wang, Q.Q.; Xu, Y.T.; Pan, L.; Hu, J.X.; Li, M.; Piao, X.S. Dietary supplementation with DHA-rich microalgae improves performance, serum composition, carcass trait, antioxidant status, and fatty acid profile of broilers. Poult. Sci. 2018, 97, 1881–1890. [Google Scholar] [CrossRef] [PubMed]
- Wu, Y.B.; Li, L.; Wen, Z.G.; Yan, H.J.; Yang, P.L.; Tang, J.; Xie, M.; Hou, S.S. Dual functions of eicosapentaenoic acid-rich microalgae: Enrichment of yolk with n-3 polyunsaturated fatty acids and partial replacement for soybean meal in diet of laying hens. Poult. Sci. 2019, 98, 350–357. [Google Scholar] [CrossRef]
- Folch, J.; Lees, M.; Stanley, G.H.S. A Simple Method for the Isolation and Purification of Total Lipides from Animal Tissues. J. Biol. Chem. 1957, 226, 497–509. [Google Scholar] [CrossRef]
- Wu, Y.; Tang, J.; Wen, Z.; Zhang, B.; Cao, J.; Zhao, L.; Guo, Z.; Xie, M.; Zhou, Z.; Hou, S. Dietary methionine deficiency stunts growth and increases fat deposition via suppression of fatty acids transportation and hepatic catabolism in Pekin ducks. J. Anim. Sci. Biotechnol. 2022, 13, 61. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Ibrahim, D.; El-Sayed, R.; Khater, S.I.; Said, E.N.; El-Mandrawy, S.A.M. Changing dietary n-6:n-3 ratio using different oil sources affects performance, behavior, cytokines mRNA expression and meat fatty acid profile of broiler chickens. Anim. Nutr. 2018, 4, 44–51. [Google Scholar] [CrossRef]
- Liu, Q.K. Triglyceride-lowering and anti-inflammatory mechanisms of omega-3 polyunsaturated fatty acids for atherosclerotic cardiovascular risk reduction. J. Clin. Lipidol. 2021, 15, 556–568. [Google Scholar] [CrossRef] [PubMed]
- Du, X.; Liu, Y.; Lu, L.; Wang, W.; Zeng, T.; Tian, Y.; Xu, X.; Shen, J.; Niu, D.; Lu, Y. Effects of dietary fats on egg quality and lipid parameters in serum and yolks of Shan Partridge Duck. Poult. Sci. 2017, 96, 1184–1190. [Google Scholar] [CrossRef]
- Li, M.; Zhai, S.; Xie, Q.; Tian, L.; Li, X.; Zhang, J.; Ye, H.; Zhu, Y.; Yang, L.; Wang, W. Effects of Dietary n-6:n-3 PUFA Ratios on Lipid Levels and Fatty Acid Profile of Cherry Valley Ducks at 15–42 Days of Age. J. Agric. Food Chem. 2017, 65, 9995–10002. [Google Scholar] [CrossRef]
- Luo, J.; Yang, H.; Song, B.L. Mechanisms and regulation of cholesterol homeostasis. Nat. Rev. Mol. Cell Biol. 2020, 21, 225–245. [Google Scholar] [CrossRef] [PubMed]
- Zhang, L.; Geng, Y.; Xiao, N.; Yin, M.; Mao, L.; Ren, G.; Zhang, C.; Liu, P.; Lu, N.; An, L.; et al. High Dietary n-6/n-3 PUFA Ratio Promotes HDL Cholesterol Level, but does not Suppress Atherogenesis in Apolipoprotein E-Null Mice 1. J. Atheroscler. Thromb. 2009, 75, 100997. [Google Scholar] [CrossRef] [PubMed]
- Huo, W.; Li, M.; Wang, J.; Wang, Z.; Huang, Y.; Chen, W. On growth performance, nutrient digestibility, blood T lymphocyte subsets, and cardiac antioxidant status of broilers. Anim. Nutr. 2019, 5, 68–73. [Google Scholar] [CrossRef] [PubMed]
- Pizzini, A.; Lunger, L.; Demetz, E.; Hilbe, R.; Weiss, G.; Ebenbichler, C.; Tancevski, I. The Role of Omega-3 Fatty Acids in Reverse Cholesterol Transport: A Review. Nutrients 2017, 9, 1099. [Google Scholar] [CrossRef]
- Han, C.; Wei, Y.; Wang, X.; Ba, C.; Shi, W. Protective effect of Salvia miltiorrhiza polysaccharides on liver injury in chickens. Poult. Sci. 2019, 98, 3496–3503. [Google Scholar] [CrossRef]
- Cui, X.Y.; Gou, Z.Y.; Abouelezz, K.F.M.; Li, L.; Lin, X.J.; Fan, Q.L.; Wang, Y.B.; Cheng, Z.G.; Ding, F.Y.; Jiang, S.Q. Alterations of the fatty acid composition and lipid metabolome of breast muscle in chickens exposed to dietary mixed edible oils. Animal 2020, 14, 1322–1332. [Google Scholar] [CrossRef]
- Brown, L.H.; Mutch, D.M. Mechanisms underlying N3-PUFA regulation of white adipose tissue endocrine function. Curr. Opin. Pharmacol. 2020, 52, 40–46. [Google Scholar] [CrossRef]
- Srinivas, V.; Molangiri, A.; Mallepogu, A.; Kona, S.R.; Ibrahim, A.; Duttaroy, A.K.; Basak, S. Maternal n-3 PUFA deficiency alters uterine artery remodeling and placental epigenome in the mice. J. Nutr. Biochem. 2021, 96, 108784. [Google Scholar] [CrossRef]
- Martin, G.G.; Landrock, D.; Chung, S.; Dangott, L.J.; Seeger, D.R.; Murphy, E.J.; Golovko, M.Y.; Kier, A.B.; Schroeder, F. Fabp1 gene ablation inhibits high-fat diet-induced increase in brain endocannabinoids. J. Neurochem. 2017, 140, 294–306. [Google Scholar] [CrossRef] [PubMed]
- Zhu, Y.; Gu, L.; Lin, X.; Liu, C.; Lu, B.; Cui, K.; Zhou, F.; Zhao, Q.; Prochownik, E.V.; Fan, C.; et al. Dynamic Regulation of ME1 Phosphorylation and Acetylation Affects Lipid Metabolism and Colorectal Tumorigenesis. Mol. Cell 2020, 77, 138–149.e135. [Google Scholar] [CrossRef] [PubMed]
- Jang, H.; Lee, G.Y.; Selby, C.P.; Lee, G.; Jeon, Y.G.; Lee, J.H.; Cheng, K.K.; Titchenell, P.; Birnbaum, M.J.; Xu, A.; et al. SREBP1c-CRY1 signalling represses hepatic glucose production by promoting FOXO1 degradation during refeeding. Nat. Commun. 2016, 7, 12180. [Google Scholar] [CrossRef] [PubMed]
- Gonzalez-Bohorquez, D.; Gallego Lopez, I.M.; Jaeger, B.N.; Pfammatter, S.; Bowers, M.; Semenkovich, C.F.; Jessberger, S. FASN-dependent de novo lipogenesis is required for brain development. Proc. Natl. Acad. Sci. USA 2022, 119, e2112040119. [Google Scholar] [CrossRef]
- Chitraju, C.; Walther, T.C.; Farese, R.V., Jr. The triglyceride synthesis enzymes DGAT1 and DGAT2 have distinct and overlapping functions in adipocytes. J. Lipid Res. 2019, 14, 1322–1332. [Google Scholar] [CrossRef] [PubMed]
- Lu, X.Y.; Shi, X.J.; Hu, A.; Wang, J.Q.; Ding, Y.; Jiang, W.; Sun, M.; Zhao, X.; Luo, J.; Qi, W.; et al. Feeding induces cholesterol biosynthesis via the mTORC1-USP20-HMGCR axis. Nature 2020, 588, 479–484. [Google Scholar] [CrossRef]
- Gelissen, I.C.; Harris, M.; Rye, K.A.; Quinn, C.; Brown, A.J.; Kockx, M.; Cartland, S.; Packianathan, M.; Kritharides, L.; Jessup, W. ABCA1 and ABCG1 synergize to mediate cholesterol export to apoA-I. Arter. Thromb. Vasc. Biol. 2006, 26, 534–540. [Google Scholar] [CrossRef] [PubMed]

| Items | Starter Phase (1 to 21 d) | Grower Phase (22 to 42 d) |
|---|---|---|
| Ingredients (%) | ||
| Corn | 56.90 | 64.05 |
| Soybean meal | 33.00 | 28.00 |
| Wheat bran | 3.00 | |
| Oil | 3.00 | 4.00 |
| CaHPO4 | 1.70 | 1.65 |
| Limestone | 0.85 | 0.80 |
| Salt | 0.30 | 0.30 |
| DL-Methionine | 0.15 | 0.15 |
| L-Lysine | 0.10 | 0.05 |
| Premix 1 | 1.00 | 1.00 |
| Total | 100.00 | 100.00 |
| Calculated values | ||
| ME (kcal/kg) 2 | 2925 | 3080 |
| Crude protein (%) 3 | 20.21 | 18.10 |
| Calcium (%) 3 | 0.93 | 0.88 |
| Total phosphorus (%) | 0.77 | 0.72 |
| Available phosphorus (%) | 0.45 | 0.42 |
| Methionine (%) | 0.45 | 0.43 |
| Lysine (%) | 1.14 | 0.95 |
| Methionine + Cysteine (%) | 0.79 | 0.74 |
| Threonine (%) | 0.75 | 0.67 |
| Tryptophan (%) | 0.23 | 0.20 |
| Valine (%) | 0.92 | 0.83 |
| Isoleucine (%) | 0.81 | 0.72 |
| Items | Starter Phase (1 to 21 d) | Grower Phase (22 to 42 d) | ||||||
|---|---|---|---|---|---|---|---|---|
| 3:0 | 2:1 | 1:2 | 0:3 | 3:0 | 2:1 | 1:2 | 0:3 | |
| C16:0 | 14.35 | 13.86 | 13.37 | 12.67 | 14.06 | 13.62 | 13.12 | 12.43 |
| C18:0 | 5.51 | 6.08 | 6.64 | 6.98 | 5.35 | 6.52 | 6.54 | 7.47 |
| C18:1 | 25.35 | 25.21 | 25.06 | 24.94 | 25.34 | 24.93 | 25.36 | 24.98 |
| C18:2N6(LA) | 44.60 | 42.56 | 40.37 | 39.17 | 45.25 | 41.52 | 40.00 | 38.04 |
| C18:3N3(ALA) | 6.45 | 9.19 | 12.03 | 14.34 | 7.29 | 10.60 | 12.83 | 14.96 |
| SFA | 21.36 | 21.14 | 21.20 | 20.54 | 20.85 | 21.62 | 20.66 | 20.96 |
| MUFA | 26,03 | 25.87 | 25.70 | 25.55 | 25.98 | 25.64 | 26.04 | 25.65 |
| PUFA | 52.61 | 52.99 | 53.10 | 53.90 | 53.18 | 52.75 | 53.29 | 53.39 |
| n-3 PUFA | 6.79 | 9.50 | 12.19 | 14.52 | 7.55 | 10.87 | 13.03 | 15.14 |
| n-6 PUFA | 45.82 | 43.49 | 40.91 | 39.39 | 45.63 | 41.88 | 40.26 | 38.26 |
| n-6/n-3 | 6.75 | 4.58 | 3.35 | 2.71 | 6.04 | 3.85 | 3.09 | 2.53 |
| Gene | GeneBank Accession No. | Primer Sequence (5′-3′) | Product Size (bp) |
|---|---|---|---|
| FABP1 | XM_005023289.5 | F: AGAGAAAGCCAAGACCGTTG R: GGTGATGGTGTCTCCGTTGA | 103 |
| ME1 | XM_038177167.1 | F: ATTTCGGAGGCCAAGAGGAC R: GCCAGTTTACCAACCGGGAT | 177 |
| SREBP1C | JQ080310.1 | F: AGCAGAGCAACCAGAAGCTG R: AGGGACTTGCTCTTCTGCAC | 70 |
| FASN | XM_027459847.2 | F: TCTGCACTGACTTCAAGCGT R: GTTGCATGACTGGGTCTGGA | 153 |
| DGAT2 | XM_027466264.2 | F: TTGGGTACCATCCACATGGC R: CAGGGTAGCAAGGTACGGTC | 161 |
| HMGCR | XM_027446071.2 | F: GGCGTAGCAGGACCATTGTA R: TTGCTCCTCCACCGAGACAT | 124 |
| ABCA1 | XM_038169977.1 | F: TGAGGACATGCGCTACGTTT R: TTGCACCCTGATGATTGCCT | 172 |
| apoA-I | XM_027444321.2 | F: AGCCCCTCCTGCATAAATAGC R: CGACTCTCATCTTCGGGCAG | 174 |
| β-actin | NM_001310421.1 | F: GGTATCGGCAGCAGTCTTA R: TTCACAGAGGCGAGTAACTT | 158 |
| Items | Age (Days) | Dietary SO:RSO Ratio | SEM | p-Value | |||
|---|---|---|---|---|---|---|---|
| 3:0 | 2:1 | 1:2 | 0:3 | ||||
| BW | 1 | 53.75 | 54.00 | 53.59 | 53.53 | 0.15 | 0.1729 |
| 21 | 1324.68 | 1301.56 | 1256.87 | 1287.81 | 16.44 | 0.0744 | |
| 42 | 2934.15 | 2950.62 | 2921.77 | 2872.20 | 45.28 | 0.6535 | |
| ADFI | 1–21 | 84.00 | 83.48 | 79.95 | 82.04 | 1.52 | 0.2836 |
| 22–42 | 169.20 | 169.81 | 174.46 | 170.60 | 3.71 | 0.7510 | |
| 1–42 | 126.60 | 126.65 | 127.21 | 126.32 | 2.12 | 0.9925 | |
| ADG | 1–21 | 59.94 | 59.41 | 57.77 | 58.78 | 0.78 | 0.0762 |
| 22–42 | 76.64 | 78.85 | 79.3 | 76.70 | 1.90 | 0.4960 | |
| 1–42 | 68.58 | 68.96 | 68.29 | 67.11 | 1.08 | 0.6557 | |
| F/G | 1–21 | 1.39 | 1.41 | 1.40 | 1.40 | 0.02 | 0.9354 |
| 22–42 | 2.21 | 2.16 | 2.21 | 2.26 | 0.04 | 0.4441 | |
| 1–42 | 1.85 | 1.83 | 1.86 | 188 | 0.02 | 0.4980 | |
| Items | Dietary SO:RSO Ratio | SEM | p-Value | |||
|---|---|---|---|---|---|---|
| 3:0 | 2:1 | 1:2 | 0:3 | |||
| Breast yield (%) | 13.15 | 13.14 | 12.79 | 12.89 | 0.50 | 0.9389 |
| Thigh yield (%) | 8.49 | 8.82 | 8.53 | 8.16 | 0.36 | 0.6310 |
| Abdominal fat (%) | 0.63 a | 0.55 ab | 0.54 ab | 0.44 b | 0.04 | 0.0327 |
| Heart (%) | 0.51 | 0.50 | 0.54 | 0.54 | 0.02 | 0.3591 |
| Liver (%) | 2.35 | 2.34 | 2.37 | 2.02 | 0.12 | 0.1158 |
| Gizzard (%) | 2.18 | 2.21 | 2.20 | 2.29 | 0.09 | 0.8693 |
| Spleen (%) | 0.06 | 0.06 | 0.08 | 0.07 | 0.01 | 0.0655 |
| Pancreas (%) | 0.27 | 0.28 | 0.31 | 0.30 | 0.01 | 0.0840 |
| Bursal (%) | 0.10 | 0.09 | 0.10 | 0.08 | 0.01 | 0.6036 |
| Caecum (%) | 0.27 | 0.31 | 0.31 | 0.23 | 0.03 | 0.1950 |
| Items | Dietary SO:RSO Ratio | SEM | p-Value | |||
|---|---|---|---|---|---|---|
| 3:0 | 2:1 | 1:2 | 0:3 | |||
| TP (g/L) | 29.05 | 27.43 | 28.45 | 28.58 | 0.96 | 0.6896 |
| ALB (g/L) | 12.34 | 12.77 | 12.22 | 11.67 | 0.59 | 0.6182 |
| GLB (g/L) | 17.15 | 14.64 | 15.84 | 16.49 | 0.86 | 0.2111 |
| TG (mmol/L) | 1.17 a | 0.86 b | 0.90 b | 0.75 b | 0.07 | 0.0087 |
| CHO (mmol/L) | 5.32 a | 4.18 b | 4.28 b | 4.10 b | 0.29 | 0.0189 |
| HDL-C (mmol/L) | 3.20 a | 1.90 b | 2.21 b | 1.90 b | 0.12 | <0.0001 |
| LDL-C (mmol/L) | 1.75 a | 1.45 b | 1.49 b | 1.40 b | 0.07 | 0.0073 |
| AST (U/L) | 4.51 | 3.68 | 3.89 | 3.90 | 0.54 | 0.7054 |
| ALT (U/L) | 19.80 a | 12.99 b | 9.13 c | 9.08 c | 0.96 | <0.0001 |
| Items | Dietary SO:RSO Ratio | SEM | p-Value | |||
|---|---|---|---|---|---|---|
| 3:0 | 2:1 | 1:2 | 0:3 | |||
| Liver | ||||||
| Moisture (%) | 69.09 c | 69.94 bc | 70.58 ab | 71.74 a | 0.42 | 0.0012 |
| Total fat (%) | 3.33 a | 2.52 b | 2.34 b | 2.27 b | 0.20 | 0.0149 |
| TG (μmol/g prot) | 286.54 a | 268.16 ab | 219.18 bc | 191.86 c | 17.54 | 0.0038 |
| CHO (μmol/g prot) | 62.22 a | 47.53 b | 49.17 b | 40.77 c | 3.97 | 0.0079 |
| Breast | ||||||
| Moisture (%) | 77.54 | 78.04 | 77.83 | 78.34 | 0.32 | 0.3464 |
| Total fat (%) | 1.42 a | 1.17 b | 1.22 b | 1.10 b | 0.07 | 0.0167 |
| TG (μmol/g prot) | 70.65 a | 59.10 ab | 65.89 a | 46.37 b | 6.64 | 0.0323 |
| CHO (μmol/g prot) | 55.81 a | 43.70 b | 44.03 b | 37.82 b | 3.81 | 0.0200 |
| Items | Dietary SO:RSO Ratio | SEM | p-Value | |||
|---|---|---|---|---|---|---|
| 3:0 | 2:1 | 1:2 | 0:3 | |||
| C14:0 | 0.46 | 0.37 | 0.32 | 0.34 | 0.07 | 0.5159 |
| C16:0 | 16.78 | 16.35 | 17.03 | 16.04 | 0.84 | 0.8425 |
| C16:1 | 0.97 | 0.98 | 0.85 | 0.90 | 0.19 | 0.9505 |
| C18:0 | 14.19 | 13.75 | 15.91 | 14.90 | 1.23 | 0.6380 |
| C18:1 | 19.01 | 18.01 | 17.82 | 18.20 | 1.72 | 0.9626 |
| C18:2 N6(LA) | 20.35 a | 17.95 b | 16.83 bc | 16.59 c | 0.34 | 0.0010 |
| C18:3 N3(ALA) | 1.38 c | 1.96 bc | 2.25 b | 3.13 a | 0.17 | 0.0018 |
| C20:2 N6 | 1.04 | 0.96 | 0.98 | 0.84 | 0.06 | 0.1526 |
| C20:3 N6 | 1.96 | 1.55 | 1.84 | 1.55 | 0.13 | 0.1287 |
| C20:4 N6(AA) | 15.87 | 15.52 | 15.99 | 15.73 | 1.59 | 0.9970 |
| C20:5 N3(EPA) | 0.29 c | 0.45 bc | 0.67 ab | 0.83 a | 0.09 | 0.0141 |
| C22:4 N6 | 2.65 a | 1.57 b | 2.09 ab | 1.54 b | 0.21 | 0.0373 |
| C22:5 N6 | 1.96 a | 1.19 b | 1.21 b | 0.95 b | 0.18 | 0.0229 |
| C22:5 N3(DPA) | 1.41 b | 2.09 ab | 2.47 ab | 2.97 a | 0.32 | 0.0441 |
| C22:6 N3(DHA) | 0.98 c | 1.55 bc | 1.88 b | 3.35 a | 0.23 | 0.0005 |
| SFA | 31.83 | 30.94 | 33.69 | 31.70 | 1.86 | 0.7609 |
| MUFA | 20.75 | 19.86 | 19.61 | 20.33 | 1.91 | 0.9745 |
| PUFA | 47.43 | 49.20 | 46.70 | 47.96 | 1.83 | 0.8039 |
| n-3 PUFA | 4.41 c | 6.77 b | 7.45 b | 10.47 a | 0.47 | 0.0001 |
| n-6 PUFA | 43.01 a | 40.79 ab | 37.89 b | 37.49 b | 1.17 | 0.0360 |
| n-6/n-3 | 9.75 a | 6.37 b | 5.28 c | 3.58 d | 0.30 | <0.0001 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhao, Z.; Guo, Y.; Zhuang, L.; Wu, Y.; Liu, J.; Cao, J.; Wu, Z.; Wen, Z. Effects of the Dietary Replacement of Soybean Oil with Rubber Seed Oil on the Growth Performance, Carcass Trait, and Status of Lipid Metabolism in Pekin Ducks. Agriculture 2023, 13, 1717. https://doi.org/10.3390/agriculture13091717
Zhao Z, Guo Y, Zhuang L, Wu Y, Liu J, Cao J, Wu Z, Wen Z. Effects of the Dietary Replacement of Soybean Oil with Rubber Seed Oil on the Growth Performance, Carcass Trait, and Status of Lipid Metabolism in Pekin Ducks. Agriculture. 2023; 13(9):1717. https://doi.org/10.3390/agriculture13091717
Chicago/Turabian StyleZhao, Zitao, Yanhong Guo, Lei Zhuang, Yongbao Wu, Jing Liu, Junting Cao, Zhanyue Wu, and Zhiguo Wen. 2023. "Effects of the Dietary Replacement of Soybean Oil with Rubber Seed Oil on the Growth Performance, Carcass Trait, and Status of Lipid Metabolism in Pekin Ducks" Agriculture 13, no. 9: 1717. https://doi.org/10.3390/agriculture13091717
APA StyleZhao, Z., Guo, Y., Zhuang, L., Wu, Y., Liu, J., Cao, J., Wu, Z., & Wen, Z. (2023). Effects of the Dietary Replacement of Soybean Oil with Rubber Seed Oil on the Growth Performance, Carcass Trait, and Status of Lipid Metabolism in Pekin Ducks. Agriculture, 13(9), 1717. https://doi.org/10.3390/agriculture13091717

