Effectiveness of Species- and Trichothecene-Specific Primers in Monitoring Fusarium graminearum Species Complex in Small Grain–Pea Intercropping Systems
Abstract
1. Introduction
2. Materials and Methods
2.1. Identification of Fusarium Species Using Species-Specific PCR (SCAR Analysis)
2.2. Trichothecene Production-Related Genotyping of F. graminearum Isolates
2.3. Statistical Analysis
3. Results
3.1. Effectiveness of Species- and Trichothecene-Specific Primers for the Characterization of the FGSC in Small Grain–Pea Intercropping Systems
3.2. Stratification of FGSC Members among Different Cereal Crops
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Pasquali, M.; Beyer, M.; Logrieco, A.; Audenaert, K.; Balmas, V.; Basler, R.; Boutigny, A.-L.; Chrpová, J.; Czembor, E.; Gagkaeva, T.; et al. A European Database of Fusarium graminearum and F. culmorum Trichothecene Genotypes. Front. Microbiol. 2016, 7, 406. [Google Scholar] [CrossRef] [PubMed]
- Aoki, T.; Ward, T.; Kistler, H.; O’Donnell, K. Systematics, Phylogeny and Trichothecene Mycotoxin Potential of Fusarium Head Blight Cereal Pathogens. Mycotoxins 2012, 62, 91–102. [Google Scholar] [CrossRef]
- Backhouse, D. Global Distribution of Fusarium graminearum, F. asiaticum and F. boothii from Wheat in Relation to Climate. Eur. J. Plant Pathol. 2014, 139, 161–173. [Google Scholar] [CrossRef]
- Kuppler, A.L.M.D.; Steiner, U.; Sulyok, M.; Krska, R.; Oerke, E.-C. Genotyping and Phenotyping of Fusarium graminearum Isolates from Germany Related to Their Mycotoxin Biosynthesis. Int. J. Food Microbiol. 2011, 151, 78–86. [Google Scholar] [CrossRef] [PubMed]
- Tok, F.M.; Arslan, M. Distribution and Genetic Chemotyping of Fusarium graminearum and Fusarium culmorum Populations in Wheat Fields in the Eastern Mediterranean Region of Turkey. Biotechnol. Biotechnol. Equip. 2016, 30, 254–260. [Google Scholar] [CrossRef][Green Version]
- Fredlund, E.; Gidlund, A.; Sulyok, M.; Börjesson, T.; Krska, R.; Olsen, M.; Lindblad, M. Deoxynivalenol and Other Selected Fusarium Toxins in Swedish Oats—Occurrence and Correlation to Specific Fusarium Species. Int. J. Food Microbiol. 2013, 167, 276–283. [Google Scholar] [CrossRef] [PubMed]
- Nielsen, L.K.; Jensen, J.D.; Nielsen, G.C.; Jensen, J.E.; Spliid, N.H.; Thomsen, I.K.; Justesen, A.F.; Collinge, D.B.; Jørgensen, L.N. Fusarium Head Blight of Cereals in Denmark: Species Complex and Related Mycotoxins. Phytopathology 2011, 101, 960–969. [Google Scholar] [CrossRef]
- Xu, X.-M.; Parry, D.W.; Nicholson, P.; Thomsett, M.A.; Simpson, D.; Edwards, S.G.; Cooke, B.M.; Doohan, F.M.; Brennan, J.M.; Moretti, A.; et al. Predominance and Association of Pathogenic Fungi Causing Fusarium Ear Blightin Wheat in Four European Countries. Eur. J. Plant Pathol. 2005, 112, 143–154. [Google Scholar] [CrossRef]
- O’Donnell, K.; Ward, T.J.; Robert, V.A.R.G.; Crous, P.W.; Geiser, D.M.; Kang, S. DNA Sequence-Based Identification of Fusarium: Current Status and Future Directions. Phytoparasitica 2015, 43, 583–595. [Google Scholar] [CrossRef]
- Župunski, V.; Jevtić, R.; Lalošević, M.; Mikić, S.; Orbović, B. The Applicability of Species- and Trichothecene-Specific Primers in Monitoring the Fusarium graminearum Species Complex and Its Impact on the Surveillance of Fusarium Head Blight in Winter Wheat in Serbia. Agronomy 2021, 11, 778. [Google Scholar] [CrossRef]
- Boutigny, A.-L.; Ward, T.J.; Coller, G.J.V.; Flett, B.; Lamprecht, S.C.; O’Donnell, K.; Viljoen, A. Analysis of the Fusarium graminearum Species Complex from Wheat, Barley and Maize in South Africa Provides Evidence of Species-Specific Differences in Host Preference. Fungal Genet. Biol. 2011, 48, 914–920. [Google Scholar] [CrossRef] [PubMed]
- Villafana, R.T.; Ramdass, A.C.; Rampersad, S.N. TRI Genotyping and Chemotyping: A Balance of Power. Toxins 2020, 12, 64. [Google Scholar] [CrossRef] [PubMed]
- Obradovic, A.; Stanković, S.; Krnjaja, V.; Nikolic, A.; Ignjatovic-Micic, D.; Stepanovic, J.; Duduk, B. Trichothecene Chemotype Diversity of Fusarium graminearum Isolated from Wheat, Maize and Barley in Serbia. Genetika 2017, 49, 355–364. [Google Scholar] [CrossRef]
- Župunski, V.; Jevtić, R.; Lalošević, M.; Orbović, B. Diversity of Trichothecene Genotypes of Fusarium graminearum Sensu Stricto from Winter Wheat in Serbia. Eur. J. Plant Pathol. 2019, 155, 461–473. [Google Scholar] [CrossRef]
- ISTA. ISTA International Rules for Seed Testing. ISTA Rules; International Seed Testing Association: Zurich, Switzerland, 2018. [Google Scholar] [CrossRef]
- Leslie, J.F.; Summerell, B.A. The Fusarium Laboratory Manual; Blackwell Publishing: Ames, IA, USA, 2006. [Google Scholar]
- Möller, E.M.; Bahnweg, G.; Sandermann, H.; Geiger, H.H. A Simple and Efficient Protocol for Isolation of High Molecular Weight DNA from Filamentous Fungi, Fruit Bodies, and Infected Plant Tissues. Nucleic Acids Res. 1992, 20, 6115–6116. [Google Scholar] [CrossRef]
- Nicholson, P.; Simpson, D.R.; Weston, G.; Rezanoor, H.N.; Lees, A.K.; Parry, D.W.; Joyce, D. Detection and Quantification of Fusarium culmorum and Fusarium graminearumin Cereals Using PCR Assays. Physiol. Mol. Plant Pathol. 1998, 53, 17–37. [Google Scholar] [CrossRef]
- Carter, J.P.; Rezanoor, H.N.; Holden, D.; Desjardins, A.E.; Plattner, R.D.; Nicholson, P. Variation in Pathogenicity Associated with the Genetic Diversity of Fusarium graminearum. Eur. J. Plant Pathol. 2002, 108, 573–583. [Google Scholar] [CrossRef]
- Amarasinghe, C.; Wang, J.-H.; Liao, Y.-C.; Fernando, D. Difference in TRI13 Gene Sequences between the 3-Acetyldeoxynivalenol Producing Fusarium graminearum Chemotypes from Canada and China. Int. J. Mol. Sci. 2011, 12, 6164–6175. [Google Scholar] [CrossRef]
- Chandler, E.; Simpson, D.; Thomsett, M.; Nicholson, P. Development of PCR Assays to Tri7 and Tri13 Trichothecene Biosynthetic Genes, and Characterisation of Chemotypes of Fusarium graminearum, Fusarium culmorum and Fusarium cerealis. Physiol. Mol. Plant Pathol. 2003, 62, 355–367. [Google Scholar] [CrossRef]
- Jennings, P.; Coates, M.E.; Walsh, K.; Turner, J.A.; Nicholson, P. Determination of Deoxynivalenol- and Nivalenol-Producing Chemotypes of Fusarium graminearum Isolated from Wheat Crops in England and Wales. Plant Pathol. 2004, 53, 643–652. [Google Scholar] [CrossRef]
- Wang, C.-L.; Cheng, Y.-H. Identification and Trichothecene Genotypes of Fusarium graminearum Species Complex from Wheat in Taiwan. Bot. Stud. 2017, 58, 4. [Google Scholar] [CrossRef] [PubMed]
- Yli-Mattila, T.; Gagkaeva, T. Molecular Chemotyping of Fusarium graminearum, F. culmorum, and F. cerealis Isolates from Finland and Russia. In Molecular Identification of Fungi; Springer: Berlin/Heidelberg, Germany, 2010; pp. 159–177. [Google Scholar]
- Zhang, H.; Lee, T.V.D.; Waalwijk, C.; Chen, W.; Xu, J.; Xu, J.; Zhang, Y.; Feng, J. Population Analysis of the Fusarium graminearum Species Complex from Wheat in China Show a Shift to More Aggressive Isolates. PLoS ONE 2012, 7, e31722. [Google Scholar] [CrossRef] [PubMed]
- Jurado, M.; Vázquez, C.; Patiño, B.; González-Jaén, M.T. PCR Detection Assays for the Trichothecene-Producing Species Fusarium graminearum, Fusarium culmorum, Fusarium poae, Fusarium equiseti and Fusarium sporotrichioides. Syst. Appl. Microbiol. 2005, 28, 562–568. [Google Scholar] [CrossRef] [PubMed]
- Demeke, T.; Clear, R.M.; Patrick, S.K.; Gaba, D. Species-Specific PCR-Based Assays for the Detection of Fusarium Species and a Comparison with the Whole Seed Agar Plate Method and Trichothecene Analysis. Int. J. Food Microbiol. 2005, 103, 271–284. [Google Scholar] [CrossRef] [PubMed]
- Sanoubar, R.; Seigner, L. Detection, Identification and Quantification of Fusarium graminearum and Fusarium culmorum in Wheat Kernels by PCR Techniques. J. Plant Pathol. Microbiol. 2015, 6, 1–8. [Google Scholar] [CrossRef]
- Paul, R.K. Multicollinearity: Causes, Effects and Remedies; IASRI: New Delhi, India, 2006. [Google Scholar]
- Bursac, Z.; Gauss, C.H.; Williams, D.K.; Hosmer, D.W. Purposeful Selection of Variables in Logistic Regression. Source Code Biol. Med. 2008, 3, 17. [Google Scholar] [CrossRef]
- Karelov, A.; Borzykh, O.; Kozub, N.; Sozinov, I.; Yanse, L.; Sozinova, O.; Tkalenko, H.; Mishchenko, L.; Blume, Y. Current Approaches to Identification of Fusarium Fungi Infecting Wheat. Cytol. Genet. 2021, 55, 433–446. [Google Scholar] [CrossRef]
- Ji, L.; Cao, K.; Hu, T.; Wang, S. Determination of Deoxynivalenol and Nivalenol Chemotypes of Fusarium graminearum Isolates from China by PCR Assay. J. Phytopathol. 2007, 155, 505–512. [Google Scholar] [CrossRef]
- Irzykowska, L.; Bocianowski, J.; Baturo-Cieśniewska, A. Association of Mating-Type with Mycelium Growth Rate and Genetic Variability of Fusarium culmorum. Open Life Sci. 2013, 8, 701–711. [Google Scholar] [CrossRef]
- Yörük, E.; Albayrak, G. Chemotyping of Fusarium graminearum and F. Culmorum Isolates from Turkey by PCR Assay. Mycopathologia 2012, 173, 53–61. [Google Scholar] [CrossRef]
- Wang, J.-H.; Ndoye, M.; Zhang, J.-B.; Li, H.-P.; Liao, Y.-C. Population Structure and Genetic Diversity of the Fusarium graminearum Species Complex. Toxins 2011, 3, 1020–1037. [Google Scholar] [CrossRef] [PubMed]
- Jurgenson, J.E.; Bowden, R.L.; Zeller, K.A.; Leslie, J.F.; Alexander, N.J.; Plattner, R.D. A Genetic Map of Gibberella Zeae (Fusarium graminearum). Genetics 2002, 160, 1451–1460. [Google Scholar] [CrossRef] [PubMed]
- Astolfi, P.; Santos, J.D.; Schneider, L.; Gomes, L.B.; Silva, C.N.; Tessmann, D.J.; Ponte, E.M.D. Molecular Survey of Trichothecene Genotypes of Fusarium graminearum Species Complex from Barley in Southern Brazil. Int. J. Food Microbiol. 2011, 148, 197–201. [Google Scholar] [CrossRef]
- Lee, J.; Chang, I.-Y.; Kim, H.; Yun, S.-H.; Leslie, J.F.; Lee, Y.-W. Genetic Diversity and Fitness of Fusarium graminearum Populations from Rice in Korea. Appl. Environ. Microbiol. 2009, 75, 3289–3295. [Google Scholar] [CrossRef] [PubMed]
- Živanov, D.; Jevtic, R.; Živanov, S.T.; Vasiljević, S.; Masirevic, S. Control of Winter Forage Pea Diseases by Pea-Oat Intercropping under Field Conditions. Pestic. Phytomedicine 2014, 29435, 131–136. [Google Scholar] [CrossRef]
- Shtaya, M.; Emeran, A.; Fernández-Aparicio, M.; Abu-Qaoud, H.; Abdallah, J.; Rubiales, D. Effects of Crop Mixtures on Rust Development on Faba Bean Grown in Mediterranean Climates. Crop Prot. 2021, 146, 105686. [Google Scholar] [CrossRef]
- Zhang, C.; Dong, Y.; Tang, L.; Zheng, Y.; Makowski, D.; Yu, Y.; Zhang, F.; Werf, W.V.D. Intercropping Cereals with Faba Bean Reduces Plant Disease Incidence Regardless of Fertilizer Input; a Meta-Analysis. Eur. J. Plant Pathol. 2019, 154, 931–942. [Google Scholar] [CrossRef]
- Drakopoulos, D.; Kägi, A.; Six, J.; Zorn, A.; Wettstein, F.E.; Bucheli, T.D.; Forrer, H.-R.; Vogelgsang, S. The Agronomic and Economic Viability of Innovative Cropping Systems to Reduce Fusarium Head Blight and Related Mycotoxins in Wheat. Agric. Syst. 2021, 192, 103198. [Google Scholar] [CrossRef]
- Glazebrook, J. Contrasting Mechanisms of Defense Against Biotrophic and Necrotrophic Pathogens. Annu. Rev. Phytopathol. 2005, 43, 205–227. [Google Scholar] [CrossRef]
- Kissoudis, C.; Wiel, C.V.D.; Visser, R.G.F.; Linden, G.V.D. Enhancing Crop Resilience to Combined Abiotic and Biotic Stress through the Dissection of Physiological and Molecular Crosstalk. Front. Plant Sci. 2014, 5, 207. [Google Scholar] [CrossRef]
- Yasuda, M.; Ishikawa, A.; Jikumaru, Y.; Seki, M.; Umezawa, T.; Asami, T.; Maruyama-Nakashita, A.; Kudo, T.; Shinozaki, K.; Yoshida, S.; et al. Antagonistic Interaction between Systemic Acquired Resistance and the Abscisic Acid–Mediated Abiotic Stress Response in Arabidopsis. Plant Cell 2008, 20, 1678–1692. [Google Scholar] [CrossRef] [PubMed]
Primer Set | Nucleotide Sequence (5′–3′) | Size of Amplified PCR Fragment (bp) | PCR Conditions |
---|---|---|---|
Fg16F Fg16R | CTCCGGATATGTTGCGTCAA GGTAGGTATCCGACATGGCAA | 420 (SCAR 1) 400 (SCAR 6) | initial denaturation: 95 °C, 3 min denaturation, annealing and elongation (38 cycle): 95 °C, 30 s 62 °C, 20 s 72 °C, 45 s final extension: 72 °C, 5 min |
FgrF FgcR | GTTGATGGGTAAAAGTGTG CTCTCATATACCCTCCG | 500 | initial denaturation: 94 °C, 85 s denaturation, annealing and elongation (25 cycles): 95 °C, 35 s 53 °C, 30 s 72 °C, 30 s final extension: 72 °C, 5 min |
Primer Set | Nucleotide Sequence (5′–3′) | Size of Amplified PCR Fragment (bp) | PCR Conditions |
---|---|---|---|
Tri303F/ Tri303R | GATGGCCGCAAGTGGA GCCGGACTGCCCTATTG | 586 | initial denaturation: 94 °C, 2 min denaturation, annealing and elongation (30 cycles): 94 °C, 30 s 60 °C, 1 min 72 °C, 2 min final extension: 72 °C, 10 min |
Tri315F/ Tri315R | CTCGCTGAAGTTGGACGTAA GTCTATGCTCTCAACGGACAAC | 864 | |
Tri-5F Tri-5R | AGCGACTACAGGCTTCCCTC AAACCATCCAGTTCTCCATCTG | 544 | initial denaturation: 95 °C, 3 min denaturation, annealing and elongation (38 cycles): 95 °C, 30 s 62 °C, 20 s 72 °C, 45 s final extension: 72 °C, 5 min |
Species Level | Tri5 | Tri3 | ||||
---|---|---|---|---|---|---|
FGSC | Number of Isolates | Morphology of FGSC | F. graminearum s. stricto (Fg16F/R) | F. graminearum s. lato (FgrF/FgcR) | Tri5F/R | Tri315F/R (15-AcDON) |
F. graminearum s. stricto | 32 | + | + | n/a | n/a | + |
F. graminearum s. lato | 13 | + | - | + | + | + |
F. graminearum s. lato | 3 | + | - | + | + | - |
Unidentified | 2 | + | - | - | + | - |
Unidentified | 3 | + | - | - | + | + |
Effectiveness of primer pairs | 60.3% | 76.2% | 100% | 90.6% |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Župunski, V.; Jevtić, R.; Grčak, M.; Lalošević, M.; Orbović, B.; Živanov, D.; Knežević, D. Effectiveness of Species- and Trichothecene-Specific Primers in Monitoring Fusarium graminearum Species Complex in Small Grain–Pea Intercropping Systems. Agriculture 2022, 12, 834. https://doi.org/10.3390/agriculture12060834
Župunski V, Jevtić R, Grčak M, Lalošević M, Orbović B, Živanov D, Knežević D. Effectiveness of Species- and Trichothecene-Specific Primers in Monitoring Fusarium graminearum Species Complex in Small Grain–Pea Intercropping Systems. Agriculture. 2022; 12(6):834. https://doi.org/10.3390/agriculture12060834
Chicago/Turabian StyleŽupunski, Vesna, Radivoje Jevtić, Milosav Grčak, Mirjana Lalošević, Branka Orbović, Dalibor Živanov, and Desimir Knežević. 2022. "Effectiveness of Species- and Trichothecene-Specific Primers in Monitoring Fusarium graminearum Species Complex in Small Grain–Pea Intercropping Systems" Agriculture 12, no. 6: 834. https://doi.org/10.3390/agriculture12060834
APA StyleŽupunski, V., Jevtić, R., Grčak, M., Lalošević, M., Orbović, B., Živanov, D., & Knežević, D. (2022). Effectiveness of Species- and Trichothecene-Specific Primers in Monitoring Fusarium graminearum Species Complex in Small Grain–Pea Intercropping Systems. Agriculture, 12(6), 834. https://doi.org/10.3390/agriculture12060834