Effect of Different Sealers on the Cytocompatibility and Osteogenic Potential of Human Periodontal Ligament Stem Cells: An In Vitro Study
Abstract
:1. Introduction
2. Materials and Methods
2.1. Materials Preparation
2.2. Periodontal Ligament Stem Cells Isolation
2.3. Characterization and Identification of Isolated PDL Cells
2.3.1. Characterization by MSC Cell Surface Markers Expression
2.3.2. Multilineage Differentiation Potential
2.4. Cell Viability Assay
2.5. Scratch Wound Assay
2.6. Induction of hPDLSCs Osteogenic Differentiation
2.7. Cell Mineralization Assay
2.8. Assessment of Alkaline Phosphatase (ALP) Enzyme Activity
2.9. Osteogenic Gene Marker Expression
2.10. Hydroxyl and Calcium Ion Leaching Evaluation
2.11. Statistical Analysis
3. Results
3.1. Isolation and Characterization of Periodontal Ligament Stem Cells
3.2. Cell Viability Assay
3.3. Cell Migration Assay
3.4. Mineralization Assay
3.5. Alkaline Phosphatase Activity Assay
3.6. Osteogenic Marker Gene Expression
3.7. pH-Values
3.8. Calcium Ion RELEASE
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Schilder, H. Cleaning and shaping the root canal. Dent. Clin. N. Am. 1974, 18, 269–296. [Google Scholar] [CrossRef] [PubMed]
- Tomson, R.M.; Polycarpou, N.; Tomson, P.L. Contemporary obturation of the root canal system. Br. Dent. J. 2014, 216, 315–322. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Schilder, H. Filling root canals in three dimensions. Dent. Clin. N. Am. 1967, 11, 723–744. [Google Scholar] [CrossRef]
- Camilleri, J. Sealers and warm gutta-percha obturation techniques. J. Endod. 2015, 41, 72–78. [Google Scholar] [CrossRef]
- Aminoshariae, A.; Kulild, J.C. The impact of sealer extrusion on endodontic outcome: A systematic review with meta-analysis. Aust. Endod. J. 2020, 46, 123–129. [Google Scholar] [CrossRef] [PubMed]
- Brignardello-Petersen, R. There may be a higher risk of developing nonhealing of periapical lesions with sealer extrusion. J. Am. Dent. Assoc. 2020, 151, e22. [Google Scholar] [CrossRef]
- Collado-González, M.; Tomás-Catalá, C.J.; Oñate-Sánchez, R.E.; Moraleda, J.M.; Rodríguez-Lozano, F.J. Cytotoxicity of guttaflow bioseal, guttaflow2, mta fillapex, and ah plus on human periodontal ligament stem cells. J. Endod. 2017, 43, 816–822. [Google Scholar] [CrossRef]
- Zhu, W.; Liang, M. Periodontal ligament stem cells: Current status, concerns, and future prospects. Stem Cells Int. 2015, 2015, 972313. [Google Scholar] [CrossRef] [Green Version]
- Seo, B.M.; Miura, M.; Gronthos, S.; Bartold, P.M.; Batouli, S.; Brahim, J.; Young, M.; Robey, P.G.; Wang, C.Y.; Shi, S. Investigation of multipotent postnatal stem cells from human periodontal ligament. Lancet 2004, 364, 149–155. [Google Scholar] [CrossRef]
- Zhang, Z.; Deng, M.; Hao, M.; Tang, J. Periodontal ligament stem cells in the periodontitis niche: Inseparable interactions and mechanisms. J. Leukoc. Biol. 2021, 110, 565–576. [Google Scholar] [CrossRef]
- Liu, O.; Xu, J.; Ding, G.; Liu, D.; Fan, Z.; Zhang, C.; Chen, W.; Ding, Y.; Tang, Z.; Wang, S. Periodontal ligament stem cells regulate b lymphocyte function via programmed cell death protein 1. Stem Cells. 2013, 31, 1371–1382. [Google Scholar] [CrossRef]
- Liu, J.; Chen, B.; Bao, J.; Zhang, Y.; Lei, L.; Yan, F. Macrophage polarization in periodontal ligament stem cells enhanced periodontal regeneration. Stem Cell Res. Ther. 2019, 10, 320. [Google Scholar] [CrossRef] [Green Version]
- Zheng, C.; Chen, J.; Liu, S.; Jin, Y. Stem cell-based bone and dental regeneration: A view of microenvironmental modulation. Int. J. Oral Sci. 2019, 11, 23. [Google Scholar] [CrossRef] [Green Version]
- Persson, C.; Engqvist, H. Premixed calcium silicate cement for endodontic applications: Injectability, setting time and radiopacity. Biomatter 2011, 1, 76–80. [Google Scholar] [CrossRef] [Green Version]
- Donnermeyer, D.; Bürklein, S.; Dammaschke, T.; Schäfer, E. Endodontic sealers based on calcium silicates: A systematic review. Odontology 2019, 107, 421–436. [Google Scholar] [CrossRef] [PubMed]
- Parirokh, M.; Torabinejad, M. Mineral trioxide aggregate: A comprehensive literature review—Part iii: Clinical applications, drawbacks, and mechanism of action. J. Endod. 2010, 36, 400–413. [Google Scholar] [CrossRef]
- Al-Haddad, A.; Ab Aziz, Z.A.C. Bioceramic-Based Root Canal Sealers: A Review. Int J. Biomater. 2016, 2016, 9753210. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Peters, O.A. Research that matters—Biocompatibility and cytotoxicity screening. Int. Endod. J. 2013, 46, 195–197. [Google Scholar] [CrossRef] [PubMed]
- Nagendrababu, V.; Murray, P.E.; Ordinola-Zapata, R.; Peters, O.A.; Rôças, I.N.; Siqueira, J.F., Jr.; Priya, E.; Jayaraman, J.; Pulikkotil, S.; Camilleri, J.; et al. Prile 2021 guidelines for reporting laboratory studies in endodontology: A consensus-based development. Int. Endod. J. 2021, 54, 1482–1490. [Google Scholar] [CrossRef]
- Collado-González, M.; García-Bernal, D.; Oñate-Sánchez, R.E.; Ortolani-Seltenerich, P.S.; Álvarez-Muro, T.; Lozano, A.; Forner, L.; Llena, C.; Moraleda, J.M.; Rodríguez-Lozano, F.J. Cytotoxicity and bioactivity of various pulpotomy materials on stem cells from human exfoliated primary teeth. Int. Endod. J. 2017, 50 (Suppl. S2), e19–e30. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dahake, P.T.; Panpaliya, N.P.; Kale, Y.J.; Dadpe, M.V.; Kendre, S.B.; Bogar, C. Response of stem cells from human exfoliated deciduous teeth (shed) to three bioinductive materials—An in vitro experimental study. Saudi Dent. J. 2020, 32, 43–51. [Google Scholar] [CrossRef]
- Feng, F.; Akiyama, K.; Liu, Y.; Yamaza, T.; Wang, T.M.; Chen, J.H.; Wang, B.B.; Huang, G.T.; Wang, S.; Shi, S. Utility of pdl progenitors for in vivo tissue regeneration: A report of 3 cases. Oral Dis. 2010, 16, 20–28. [Google Scholar] [CrossRef]
- Nyska, A.; Schiffenbauer, Y.S.; Brami, C.T.; Maronpot, R.R.; Ramot, Y. Histopathology of biodegradable polymers: Challenges in interpretation and the use of a novel compact mri for biocompatibility evaluation. Polym. Adv. Technol. 2014, 25, 461–467. [Google Scholar] [CrossRef]
- Rodríguez-Lozano, F.J.; López-García, S.; García-Bernal, D.; Sanz, J.L.; Lozano, A.; Pecci-Lloret, M.P.; Melo, M.; López-Ginés, C.; Forner, L. Cytocompatibility and bioactive properties of the new dual-curing resin-modified calcium silicate-based material for vital pulp therapy. Clin. Oral Investig. 2021, 25, 5009–5024. [Google Scholar] [CrossRef] [PubMed]
- Wang, P.; Wang, Y.; Tang, W.; Wang, X.; Pang, Y.; Yang, S.; Wei, Y.; Gao, H.; Wang, D.; Cao, Z. Bone morphogenetic protein-9 enhances osteogenic differentiation of human periodontal ligament stem cells via the jnk pathway. PLoS ONE 2017, 12, e0169123. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Belal, R.S.; Edanami, N.; Yoshiba, K.; Yoshiba, N.; Ohkura, N.; Takenaka, S.; Noiri, Y. Comparison of calcium and hydroxyl ion release ability and in vivo apatite-forming ability of three bioceramic-containing root canal sealers. Clin. Oral Investig. 2022, 26, 1443–1451. [Google Scholar] [CrossRef]
- Elbanna, A.; Atta, D.; Sherief, D.I. In vitro bioactivity of newly introduced dual-cured resin-modified calcium silicate cement. Dent. Res. J. 2022, 19, 1. [Google Scholar] [CrossRef]
- Sultana, N.; Singh, M.; Nawal, R.R.; Chaudhry, S.; Yadav, S.; Mohanty, S.; Talwar, S. Evaluation of biocompatibility and osteogenic potential of tricalcium silicate-based cements using human bone marrow-derived mesenchymal stem cells. J. Endod. 2018, 44, 446–451. [Google Scholar] [CrossRef]
- de Souza Costa, C.A.; Hebling, J.; Scheffel, D.L.; Soares, D.G.; Basso, F.G.; Ribeiro, A.P. Methods to evaluate and strategies to improve the biocompatibility of dental materials and operative techniques. Dent. Mater. 2014, 30, 769–784. [Google Scholar] [CrossRef]
- Hosseinpour, S.; Gaudin, A.; Peters, O.A. A critical analysis of research methods and experimental models to study biocompatibility of endodontic materials. Int. Endod. J. 2022, 55 (Suppl. S2), 346–369. [Google Scholar] [CrossRef]
- Sanz, J.L.; Guerrero-Gironés, J.; Pecci-Lloret, M.P.; Pecci-Lloret, M.R.; Melo, M. Biological interactions between calcium silicate-based endodontic biomaterials and periodontal ligament stem cells: A systematic review of in vitro studies. Int. Endod. J. 2021, 54, 2025–2043. [Google Scholar] [CrossRef]
- Szczurko, G.; Pawińska, M.; Łuczaj-Cepowicz, E.; Kierklo, A.; Marczuk-Kolada, G.; Hołownia, A. Effect of root canal sealers on human periodontal ligament fibroblast viability: Ex vivo study. Odontology 2018, 106, 245–256. [Google Scholar] [CrossRef] [Green Version]
- Kim, Y.B.; Baek, S.H.; Bae, K.S. In vivo study on the biocompatibility of new resin-based root canal sealers. J. Korean Acad. Conserv. Dent. 2002, 27, 122–134. [Google Scholar] [CrossRef] [Green Version]
- Park, S.Y.; Lee, W.C.; Lim, S.S. Cytotoxicity and antibacterial property of new resin-based sealer. J. Korean Acad. Conserv. Dent. 2003, 28, 162–168. [Google Scholar] [CrossRef] [Green Version]
- Lim, E.S.; Park, Y.B.; Kwon, Y.S.; Shon, W.J.; Lee, K.W.; Min, K.S. Physical properties and biocompatibility of an injectable calcium-silicate-based root canal sealer: In vitro and in vivo study. BMC Oral Health. 2015, 15, 129. [Google Scholar] [CrossRef] [Green Version]
- Mann, A.; Zeng, Y.; Kirkpatrick, T.; van der Hoeven, R.; Silva, R.; Letra, A.; de Souza, L.C. Evaluation of the physicochemical and biological properties of endosequence bc sealer hiflow. J. Endod. 2022, 48, 123–131. [Google Scholar] [CrossRef] [PubMed]
- Jung, S.; Sielker, S.; Hanisch, M.R.; Libricht, V.; Schäfer, E.; Dammaschke, T. Cytotoxic effects of four different root canal sealers on human osteoblasts. PLoS ONE 2018, 13, e0194467. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jung, S.; Libricht, V.; Sielker, S.; Hanisch, M.R.; Schäfer, E.; Dammaschke, T. Evaluation of the biocompatibility of root canal sealers on human periodontal ligament cells ex vivo. Odontology 2019, 107, 54–63. [Google Scholar] [CrossRef]
- Kim, M.; Hayashi, M.; Yu, B.; Lee, T.K.; Kim, R.H.; Jo, D. Cytotoxicity and genotoxicity of epoxy resin-based root canal sealers before and after setting procedures. Life 2022, 12, 847. [Google Scholar] [CrossRef] [PubMed]
- Sanz, J.L.; López-García, S.; Lozano, A.; Pecci-Lloret, M.P.; Llena, C.; Guerrero-Gironés, J.; Rodríguez-Lozano, F.J.; Forner, L. Microstructural composition, ion release, and bioactive potential of new premixed calcium silicate–based endodontic sealers indicated for warm vertical compaction technique. Clin. Oral Investig. 2021, 25, 1451–1462. [Google Scholar] [CrossRef]
- Oh, H.; Kim, E.; Lee, S.; Park, S.; Chen, D.; Shin, S.J.; Kim, E.; Kim, S. Comparison of biocompatibility of calcium silicate-based sealers and epoxy resin-based sealer on human periodontal ligament stem cells. Materials 2020, 13, 5242. [Google Scholar] [CrossRef]
- Pedano, M.S.; Li, X.; Li, S.; Sun, Z.; Cokic, S.M.; Putzeys, E.; Yoshihara, K.; Yoshida, Y.; Chen, Z.; Van Landuyt, K. Freshly-mixed and setting calcium-silicate cements stimulate human dental pulp cells. Dent. Mater. 2018, 34, 797–808. [Google Scholar] [CrossRef]
- Sudo, K.; Kanno, M.; Miharada, K.; Ogawa, S.; Hiroyama, T.; Saijo, K.; Nakamura, Y. Mesenchymal progenitors able to differentiate into osteogenic, chondrogenic, and/or adipogenic cells in vitro are present in most primary fibroblast-like cell populations. Stem Cells 2007, 25, 1610–1617. [Google Scholar] [CrossRef]
- Li, J.; Zhang, F.; Zhang, N.; Geng, X.; Meng, C.; Wang, X.; Yang, Y. Osteogenic capacity and cytotherapeutic potential of periodontal ligament cells for periodontal regeneration in vitro and in vivo. PeerJ 2019, 7, e6589. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bruderer, M.; Richards, R.G.; Alini, M.; Stoddart, M.J. Role and regulation of runx2 in osteogenesis. Eur. Cell Mater. 2014, 28, 269–286. [Google Scholar] [CrossRef] [PubMed]
- Simonet, W.S.; Lacey, D.L.; Dunstan, C.R.; Kelley, M.C.; Chang, M.S.; Lüthy, R.; Nguyen, H.Q.; Wooden, S.; Bennett, L.; Boone, T. Osteoprotegerin: A novel secreted protein involved in the regulation of bone density. Cell 1997, 89, 309–319. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Saygili, G.; Saygili, S.; Tuglu, I.; Capar, I.D. In vitro cytotoxicity of guttaflow bioseal, guttaflow 2, ah-plus and mta fillapex. Iran. Endod. J. 2017, 12, 354. [Google Scholar] [CrossRef]
- Mandal, P.; Zhao, J.; Sah, S.K.; Huang, Y.; Liu, J. In vitro cytotoxicity of guttaflow 2 on human gingival fibroblasts. J. Endod. 2014, 40, 1156–1159. [Google Scholar] [CrossRef]
- Silva, E.J.; Neves, A.A.; De-Deus, G.; Accorsi-Mendonça, T.; Moraes, A.P.; Valentim, R.M.; Moreira, E.J. Cytotoxicity and gelatinolytic activity of a new silicon-based endodontic sealer. J. Appl. Biomater. Funct Mater. 2015, 13, 376–380. [Google Scholar] [CrossRef] [Green Version]
- Accardo, C.; Himel, V.T.; Lallier, T.E. A novel guttaflow sealer supports cell survival and attachment. J. Endod. 2014, 40, 231–234. [Google Scholar] [CrossRef]
- Liu, P.; Guan, R.; Ye, X.; Jiang, J.; Liu, M.; Huang, G.; Chen, X. Toxicity of nano-and micro-sized silver particles in human hepatocyte cell line l02. J. Phys. Conf. Seri. 2011, 304, 012036. [Google Scholar] [CrossRef] [Green Version]
- Aksel, H.; Makowka, S.; Bosaid, F.; Guardian, M.G.; Sarkar, D.; Azim, A.A. Effect of heat application on the physical properties and chemical structure of calcium silicate-based sealers. Clin. Oral Investig. 2021, 25, 2717–2725. [Google Scholar] [CrossRef] [PubMed]
- Rodríguez-Lozano, F.J.; López-García, S.; García-Bernal, D.; Tomás-Catalá, C.J.; Santos, J.M.; Llena, C.; Lozano, A.; Murcia, L.; Forner, L. Chemical composition and bioactivity potential of the new endosequence bc sealer formulation hiflow. Int. Endod. J. 2020, 53, 1216–1228. [Google Scholar] [CrossRef] [PubMed]
- Yang, X.; Tian, J.; Li, M.; Chen, W.; Liu, H.; Wang, Z.; Haapasalo, M.; Shen, Y.; Wei, X. Biocompatibility of a new calcium silicate-based root canal sealer mediated via the modulation of macrophage polarization in a rat model. Materials 2022, 15, 1962. [Google Scholar] [CrossRef]
- Queiroz, M.B.; Torres, F.F.E.; Rodrigues, E.M.; Viola, K.S.; Bosso-Martelo, R.; Chavez-Andrade, G.M.; Guerreiro-Tanomaru, J.M.; Tanomaru-Filho, M. Physicochemical, biological, and antibacterial evaluation of tricalcium silicate-based reparative cements with different radiopacifiers. Dent. Mater. 2021, 37, 311–320. [Google Scholar] [CrossRef]
- Rodríguez-Lozano, F.J.; Collado-González, M.; Tomás-Catalá, C.J.; García-Bernal, D.; López, S.; Oñate-Sánchez, R.E.; Moraleda, J.M.; Murcia, L. Guttaflow bioseal promotes spontaneous differentiation of human periodontal ligament stem cells into cementoblast-like cells. Dent. Mater. 2019, 35, 114–124. [Google Scholar] [CrossRef]
- Moser, S.C.; van der Eerden, B.C. Osteocalcin—A versatile bone-derived hormone. Front. Endocrinol. 2019, 9, 794. [Google Scholar] [CrossRef] [Green Version]
- Udagawa, N.; Takahashi, N.; Yasuda, H.; Mizuno, A.; Itoh, K.; Ueno, Y.; Shinki, T.; Gillespie, M.T.; Martin, T.J.; Higashio, K.; et al. Osteoprotegerin produced by osteoblasts is an important regulator in osteoclast development and function. Endocrinology 2000, 141, 3478–3484. [Google Scholar] [CrossRef]
- Candeiro, G.T.; Moura-Netto, C.D.; D’Almeida-Couto, R.S.; Azambuja-Júnior, N.; Marques, M.M.; Cai, S.; Gavini, G. Cytotoxicity, genotoxicity and antibacterial effectiveness of a bioceramic endodontic sealer. Int. Endod. J. 2016, 49, 858–864. [Google Scholar] [CrossRef]
- Zhang, W.; Li, Z.; Peng, B. Ex vivo cytotoxicity of a new calcium silicate–based canal filling material. Int. Endod. J. 2010, 43, 769–774. [Google Scholar] [CrossRef]
- Zhou, H.; Du, T.; Shen, Y.; Wang, Z.; Zheng, Y.; Haapasalo, M. In vitro cytotoxicity of calcium silicate–containing endodontic sealers. J. Endod. 2015, 41, 56–61. [Google Scholar] [CrossRef] [PubMed]
- Donnermeyer, D.; Schemkämper, P.; Bürklein, S.; Schäfer, E. Short and long-term solubility, alkalizing effect, and thermal persistence of premixed calcium silicate-based sealers: Ah plus bioceramic sealer vs. Total fill bc sealer. Materials 2022, 15, 7320. [Google Scholar] [CrossRef] [PubMed]
- Souza, L.C.; Neves, G.S.; Kirkpatrick, T.; Letra, A.; Silva, R. Physicochemical and biological properties of ah plus bioceramic. J. Endod. 2023, 49, 69–76. [Google Scholar] [CrossRef]
- Okabe, T.; Sakamoto, M.; Takeuchi, H.; Matsushima, K. Effects of ph on mineralization ability of human dental pulp cells. J. Endod. 2006, 32, 198–201. [Google Scholar] [CrossRef]
- Poggio, C.; Dagna, A.; Ceci, M.; Meravini, M.V.; Colombo, M.; Pietrocola, G. Solubility and ph of bioceramic root canal sealers: A comparative study. J. Clin. Exp. Dent. 2017, 9, e1189–e1194. [Google Scholar] [CrossRef]
- Monfoulet, L.E.; Becquart, P.; Marchat, D.; Vandamme, K.; Bourguignon, M.; Pacard, E.; Viateau, V.; Petite, H.; Logeart-Avramoglou, D. The ph in the microenvironment of human mesenchymal stem cells is a critical factor for optimal osteogenesis in tissue-engineered constructs. Tissue Eng. Part A 2014, 20, 1827–1840. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Sealer | Manufacturer | Composition |
---|---|---|
VDW.1Seal | Dentsply Sirona, Munich, Germany | Zirconium dioxide, tricalcium silicate, dimethyl sulfoxide, lithium carbonate, thickening agents |
Endosequence BC Sealer HiFlow | Brasseler USA Savannah, GA, USA | Zirconia, dicalcium silicate, tricalcium silicate, calcium hydroxide, and fillers |
GuttaFlow-2 | Coltene Whaledent, Langenau, Switzerland | Gutta-percha powder, polydimethylsiloxane, silicone oil, zirconium dioxide, platinum catalyst, micro-silver, paraffin oil. |
ADSeal | Meta Biomed, Cheongju, Korea | Base paste: Epoxy oligomer resin, ethylene glycol salicylate, zirconium oxide, calcium phosphate, bismuth subcarbonate Catalyst paste: Poly aminobenzoate, triethanolamine, zirconium oxide calcium phosphate, bismuth subcarbonate, calcium oxide |
Forward Sequence | Reverse Sequence | Gene Accession Number | |
---|---|---|---|
RUNX2 | GTTATGAAAAACCAAGTAGCCAGGT | GTAATCTGACTCTGTCCTTGTGGAT | NM_009820 |
OC | TTCATGTGGGGTGTCTCTGA | CTGGGCCTTGGTCTTGAGT | M23637.1 |
OPG | CTAATTCAGAAAGGAAATGC | GCTGAGTGTTCTGGTGGACA | NM_012870 |
β-actin | TCCGTCGCCGGTCCACACCC | TCACCAACTGGGACGATATG | NM_031144.3 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Saber, S.; Raafat, S.; Elashiry, M.; El-Banna, A.; Schäfer, E. Effect of Different Sealers on the Cytocompatibility and Osteogenic Potential of Human Periodontal Ligament Stem Cells: An In Vitro Study. J. Clin. Med. 2023, 12, 2344. https://doi.org/10.3390/jcm12062344
Saber S, Raafat S, Elashiry M, El-Banna A, Schäfer E. Effect of Different Sealers on the Cytocompatibility and Osteogenic Potential of Human Periodontal Ligament Stem Cells: An In Vitro Study. Journal of Clinical Medicine. 2023; 12(6):2344. https://doi.org/10.3390/jcm12062344
Chicago/Turabian StyleSaber, Shehabeldin, Shereen Raafat, Mohamed Elashiry, Ahmed El-Banna, and Edgar Schäfer. 2023. "Effect of Different Sealers on the Cytocompatibility and Osteogenic Potential of Human Periodontal Ligament Stem Cells: An In Vitro Study" Journal of Clinical Medicine 12, no. 6: 2344. https://doi.org/10.3390/jcm12062344