Electroacupuncture at Fengchi(GB20) and Yanglingquan(GB34) Ameliorates Paralgesia through Microglia-Mediated Neuroinflammation in a Rat Model of Migraine
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals
2.2. Experimental Design
2.2.1. Experiment I
2.2.2. Experiment II
2.2.3. Experiment III
2.2.4. Implantation and Fixation of the Cannula
2.2.5. Group Assignment and Repeated Injections of Is or PBS into Dura
2.3. Electroacupuncture
2.4. Tactile Sensory Testing
2.5. Tissue Preparation
2.6. ELISA Analysis
2.7. RT-PCR Analysis
2.8. Immunohistochemistry (IHC) Staining
2.9. Western Blot Analysis
2.10. Statistical Analysis
3. Results
3.1. EA Inhibits the Reduction of Facial Mechanical Withdrawal Thresholds in the Repeated IS-Induced Recurrent Migraine-like Rat Model
3.2. EA Reduces the Concentrations of the CGRP and Inflammatory Cytokines in Plasma
3.3. EA Depressed the Releases of CGRP and Inflammatory Cytokines in the TNC
3.4. EA Attenuates Microglial Activation and Inflammatory Cytokines Release in the TNC
IHC Assay for Ibal-1 Labelled Microglia
3.5. IHC Assay for Inflammatory Cytokines
3.6. EA Decreases the Protein Expressions of Microglia, Microglial TLR4, and the Downstream Molecule NF-κB in the TNC
4. Discussion
4.1. EA Can Ameliorate Mechanical Paralgesia and CGRP Releases Following Repeated Dural Stimulation with IS
4.2. EA Can Improve Pain Hypersensitivity by Inhibiting Microglial Activation and Microglial-Mediated Inflammatory Responses Following Repeated Dural Stimulation with IS
4.3. EA Inhibits Microglial Activation, and Microglial-Mediated Inflammatory Responses Might Be Related to TLR4/NF-κB Following Repeated Dural Stimulation with IS
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Charles, A. The pathophysiology of migraine: Implications for clinical management. Lancet. Neurol. 2018, 17, 174–182. [Google Scholar] [CrossRef]
- Buse, D.C.; Greisman, J.D.; Baigi, K.; Lipton, R.B. Migraine Progression: A Systematic Review. Headache 2019, 59, 306–338. [Google Scholar] [CrossRef]
- Boyer, N.; Dallel, R.; Artola, A.; Monconduit, L. General trigeminospinal central sensitization and impaired descending pain inhibitory controls contribute to migraine progression. Pain 2014, 155, 1196–1205. [Google Scholar] [CrossRef]
- Malhotra, R. Understanding migraine: Potential role of neurogenic inflammation. Ann. Indian Acad. Neurol. 2016, 19, 175–182. [Google Scholar] [CrossRef]
- Noseda, R.; Burstein, R. Migraine pathophysiology: Anatomy of the trigeminovascular pathway and associated neurological symptoms, CSD, sensitization and modulation of pain. Pain 2013, 154 Suppl 1, S44–S53. [Google Scholar] [CrossRef]
- He, W.; Long, T.; Pan, Q.; Zhang, S.; Zhang, Y.; Zhang, D.; Qin, G.; Chen, L.; Zhou, J. Microglial NLRP3 inflammasome activation mediates IL-1β release and contributes to central sensitization in a recurrent nitroglycerin-induced migraine model. J. Neuroinflammation 2019, 16, 78. [Google Scholar] [CrossRef]
- Long, T.; He, W.; Pan, Q.; Zhang, S.; Zhang, Y.; Liu, C.; Liu, Q.; Qin, G.; Chen, L.; Zhou, J. Microglia P2X4 receptor contributes to central sensitization following recurrent nitroglycerin stimulation. J. Neuroinflammation 2018, 15, 245. [Google Scholar] [CrossRef]
- Ji, R.R.; Nackley, A.; Huh, Y.; Terrando, N.; Maixner, W. Neuroinflammation and Central Sensitization in Chronic and Widespread Pain. Anesthesiology 2018, 129, 343–366. [Google Scholar] [CrossRef] [PubMed]
- Edvinsson, L.; Haanes, K.A.; Warfvinge, K. Does inflammation have a role in migraine? Nat. Rev. Neurol. 2019, 15, 483–490. [Google Scholar] [CrossRef] [PubMed]
- Echeverry, S.; Shi, X.Q.; Yang, M.; Huang, H.; Wu, Y.; Lorenzo, L.E.; Perez-Sanchez, J.; Bonin, R.P.; De Koninck, Y.; Zhang, J. Spinal microglia are required for long-term maintenance of neuropathic pain. Pain 2017, 158, 1792–1801. [Google Scholar] [CrossRef] [PubMed]
- Latremoliere, A.; Woolf, C.J. Central sensitization: A generator of pain hypersensitivity by central neural plasticity. J. Pain 2009, 10, 895–926. [Google Scholar] [CrossRef] [PubMed]
- Fried, N.T.; Maxwell, C.R.; Elliott, M.B.; Oshinsky, M.L. Region-specific disruption of the blood-brain barrier following repeated inflammatory dural stimulation in a rat model of chronic trigeminal allodynia. Cephalalgia Int. J. Headache 2018, 38, 674–689. [Google Scholar] [CrossRef]
- Kawasaki, Y.; Zhang, L.; Cheng, J.K.; Ji, R.R. Cytokine mechanisms of central sensitization: Distinct and overlapping role of interleukin-1beta, interleukin-6, and tumor necrosis factor-alpha in regulating synaptic and neuronal activity in the superficial spinal cord. J. Neurosci. Off. J. Soc. Neurosci. 2008, 28, 5189–5194. [Google Scholar] [CrossRef] [PubMed]
- Bryant, C.E.; Spring, D.R.; Gangloff, M.; Gay, N.J. The molecular basis of the host response to lipopolysaccharide. Nat. Rev. Microbiol. 2010, 8, 8–14. [Google Scholar] [CrossRef]
- Su, M.; Ran, Y.; He, Z.; Zhang, M.; Hu, G.; Tang, W.; Zhao, D.; Yu, S. Inhibition of toll-like receptor 4 alleviates hyperalgesia induced by acute dural inflammation in experimental migraine. Mol. Pain 2018, 14, 1744806918754612. [Google Scholar] [CrossRef]
- Chen, Z.Y.; Zhang, X.W.; Yu, L.; Hua, R.; Zhao, X.P.; Qin, X.; Zhang, Y.M. Spinal toll-like receptor 4-mediated signalling pathway contributes to visceral hypersensitivity induced by neonatal colonic irritation in rats. Eur. J. Pain 2015, 19, 176–186. [Google Scholar] [CrossRef]
- Al-Hassany, L.; Goadsby, P.J.; Danser, A.H.J.; MaassenVanDenBrink, A. Calcitonin gene-related peptide-targeting drugs for migraine: How pharmacology might inform treatment decisions. Lancet. Neurol. 2022, 21, 284–294. [Google Scholar] [CrossRef]
- Russo, A.F. Calcitonin gene-related peptide (CGRP): A new target for migraine. Ann. Rev. Pharmacol. Toxicol. 2015, 55, 533–552. [Google Scholar] [CrossRef]
- Woolf, C.J.; Salter, M.W. Neuronal plasticity: Increasing the gain in pain. Science 2000, 288, 1765–1769. [Google Scholar] [CrossRef] [PubMed]
- Charles, A.; Pozo-Rosich, P. Targeting calcitonin gene-related peptide: A new era in migraine therapy. Lancet 2019, 394, 1765–1774. [Google Scholar] [CrossRef]
- Lai, H.C.; Lin, Y.W.; Hsieh, C.L. Acupuncture-Analgesia-Mediated Alleviation of Central Sensitization. Evid.-Based Complement. Altern. Med. 2019, 2019, 6173412. [Google Scholar] [CrossRef] [PubMed]
- McDonald, J.L.; Cripps, A.W.; Smith, P.K. Mediators, Receptors, and Signalling Pathways in the Anti-Inflammatory and Antihyperalgesic Effects of Acupuncture. Evid.-Based Complement. Altern. Med. 2015, 2015, 975632. [Google Scholar] [CrossRef]
- Zhang, N.; Houle, T.; Hindiyeh, N.; Aurora, S.K. Systematic Review: Acupuncture vs. Standard Pharmacological Therapy for Migraine Prevention. Headache 2020, 60, 309–317. [Google Scholar] [CrossRef] [PubMed]
- Zhao, L.; Chen, J.; Li, Y.; Sun, X.; Chang, X.; Zheng, H.; Gong, B.; Huang, Y.; Yang, M.; Wu, X.; et al. The Long-term Effect of Acupuncture for Migraine Prophylaxis: A Randomized Clinical Trial. JAMA Intern. Med. 2017, 177, 508–515. [Google Scholar] [CrossRef]
- Pei, P.; Liu, L.; Zhao, L.P.; Qu, Z.Y.; Tang, C.Y.; Wang, L.P.; Yang, W. Electroacupuncture exerts an anti-migraine effect via modulation of the 5-HT7 receptor in the conscious rat. Acupunct. Med. J. Br. Med. Acupunct. Soc. 2019, 37, 47–54. [Google Scholar] [CrossRef]
- Qu, Z.; Liu, L.; Zhao, L.; Xu, X.; Li, Z.; Zhu, Y.; Zhang, C.; Jing, X.; Wang, X.; Li, B.; et al. Prophylactic Electroacupuncture on the Upper Cervical Segments Decreases Neuronal Discharges of the Trigeminocervical Complex in Migraine-Affected Rats: An in vivo Extracellular Electrophysiological Experiment. J. Pain Res. 2020, 13, 25–37. [Google Scholar] [CrossRef]
- Liu, L.; Pei, P.; Zhao, L.P.; Qu, Z.Y.; Zhu, Y.P.; Wang, L.P. Electroacupuncture Pretreatment at GB20 Exerts Antinociceptive Effects via Peripheral and Central Serotonin Mechanism in Conscious Migraine Rats. Evid.-Based Complement. Altern. Med. 2016, 2016, 1846296. [Google Scholar] [CrossRef]
- Liu, L.; Xu, X.B.; Qu, Z.Y.; Zhao, L.P.; Zhang, C.S.; Li, Z.J.; Lyu, T.L.; Wang, X.F.; Jing, X.H.; Li, B. Determining 5HT(7)R’s Involvement in Modifying the Antihyperalgesic Effects of Electroacupuncture on Rats With Recurrent Migraine. Front. Neurosci. 2021, 15, 668616. [Google Scholar] [CrossRef]
- Xu, X.; Liu, L.; Zhao, L.; Li, B.; Jing, X.; Qu, Z.; Zhu, Y.; Zhang, Y.; Li, Z.; Fisher, M.; et al. Effect of Electroacupuncture on Hyperalgesia and Vasoactive Neurotransmitters in a Rat Model of Conscious Recurrent Migraine. Evid.-Based Complement. Altern. Med. 2019, 2019, 9512875. [Google Scholar] [CrossRef] [PubMed]
- Zhao, L.; Liu, L.; Xu, X.; Qu, Z.; Zhu, Y.; Li, Z.; Zhao, J.; Wang, L.; Jing, X.; Li, B. Electroacupuncture Inhibits Hyperalgesia by Alleviating Inflammatory Factors in a Rat Model of Migraine. J. Pain Res. 2020, 13, 75–86. [Google Scholar] [CrossRef]
- Melo-Carrillo, A.; Lopez-Avila, A. A chronic animal model of migraine, induced by repeated meningeal nociception, characterized by a behavioral and pharmacological approach. Cephalalgia Int. J. Headache 2013, 33, 1096–1105. [Google Scholar] [CrossRef]
- Zimmermann, M. Ethical guidelines for investigations of experimental pain in conscious animals. Pain 1983, 16, 109–110. [Google Scholar] [CrossRef] [PubMed]
- Boyer, N.; Signoret-Genest, J.; Artola, A.; Dallel, R.; Monconduit, L. Propranolol treatment prevents chronic central sensitization induced by repeated dural stimulation. Pain 2017, 158, 2025–2034. [Google Scholar] [CrossRef]
- Strassman, A.M.; Raymond, S.A.; Burstein, R. Sensitization of meningeal sensory neurons and the origin of headaches. Nature 1996, 384, 560–564. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Fu, X.; Huang, L.; Wang, X.; Lu, Z.; Zhu, F.; Xiao, Z. Increased Asics Expression via the Camkii-CREB Pathway in a Novel Mouse Model of Trigeminal Pain. Cell. Physiol. Biochem. Int. J. Exp. Cell. Physiol. Biochem. Pharmacol. 2018, 46, 568–578. [Google Scholar] [CrossRef]
- Han, X.; Ran, Y.; Su, M.; Liu, Y.; Tang, W.; Dong, Z.; Yu, S. Chronic changes in pituitary adenylate cyclase-activating polypeptide and related receptors in response to repeated chemical dural stimulation in rats. Mol. Pain 2017, 13, 1744806917720361. [Google Scholar] [CrossRef] [PubMed]
- Chaplan, S.R.; Bach, F.W.; Pogrel, J.W.; Chung, J.M.; Yaksh, T.L. Quantitative assessment of tactile allodynia in the rat paw. J. Neurosci. Methods 1994, 53, 55–63. [Google Scholar] [CrossRef] [PubMed]
- Vos, B.P.; Strassman, A.M.; Maciewicz, R.J. Behavioral evidence of trigeminal neuropathic pain following chronic constriction injury to the rat’s infraorbital nerve. J. Neurosci. Off. J. Soc. Neurosci. 1994, 14, 2708–2723. [Google Scholar] [CrossRef] [PubMed]
- Oshinsky, M.L.; Gomonchareonsiri, S. Episodic dural stimulation in awake rats: A model for recurrent headache. Headache 2007, 47, 1026–1036. [Google Scholar] [CrossRef]
- Liu, C.; Zhang, Y.; Liu, Q.; Jiang, L.; Li, M.; Wang, S.; Long, T.; He, W.; Kong, X.; Qin, G.; et al. P2X4-receptor participates in EAAT3 regulation via BDNF-TrkB signaling in a model of trigeminal allodynia. Mol. Pain 2018, 14, 1744806918795930. [Google Scholar] [CrossRef]
- Wu, B.; Wang, S.; Qin, G.; Xie, J.; Tan, G.; Zhou, J.; Chen, L. Protein Kinase C γ Contributes to Central Sensitization in a Rat Model of Chronic Migraine. J. Mol. Neurosci. MN 2017, 63, 131–141. [Google Scholar] [CrossRef] [PubMed]
- Bishop, J.; Becerra, L.; Barmettler, G.; Chang, P.C.; Kainz, V.; Burstein, R.; Borsook, D. Modulation of brain networks by sumatriptan-naproxen in the inflammatory soup migraine model. Pain 2019, 160, 2161–2171. [Google Scholar] [CrossRef] [PubMed]
- Zusso, M.; Lunardi, V.; Franceschini, D.; Pagetta, A.; Lo, R.; Stifani, S.; Frigo, A.C.; Giusti, P.; Moro, S. Ciprofloxacin and levofloxacin attenuate microglia inflammatory response via TLR4/NF-kB pathway. J. Neuroinflammation 2019, 16, 148. [Google Scholar] [CrossRef] [PubMed]
- Burstein, R.; Yamamura, H.; Malick, A.; Strassman, A.M. Chemical stimulation of the intracranial dura induces enhanced responses to facial stimulation in brain stem trigeminal neurons. J. Neurophysiol. 1998, 79, 964–982. [Google Scholar] [CrossRef] [PubMed]
- Su, M.; Ran, Y.; Han, X.; Liu, Y.; Zhang, X.; Tan, Q.; Li, R.; Yu, S. Rizatriptan overuse promotes hyperalgesia induced by dural inflammatory stimulation in rats by modulation of the serotonin system. Eur. J. Neurosci. 2016, 44, 2129–2138. [Google Scholar] [CrossRef] [PubMed]
- Bernstein, C.; Burstein, R. Sensitization of the trigeminovascular pathway: Perspective and implications to migraine pathophysiology. J. Clin. Neurol. 2012, 8, 89–99. [Google Scholar] [CrossRef] [PubMed]
- Louter, M.A.; Bosker, J.E.; van Oosterhout, W.P.; van Zwet, E.W.; Zitman, F.G.; Ferrari, M.D.; Terwindt, G.M. Cutaneous allodynia as a predictor of migraine chronification. Brain A J. Neurol. 2013, 136, 3489–3496. [Google Scholar] [CrossRef]
- Pei, P.; Liu, L.; Zhao, L.; Cui, Y.; Qu, Z.; Wang, L. Effect of electroacupuncture pretreatment at GB20 on behaviour and the descending pain modulatory system in a rat model of migraine. Acupunct. Med. J. Br. Med. Acupunct. Soc. 2016, 34, 127–135. [Google Scholar] [CrossRef]
- Riesco, N.; Cernuda-Morollón, E.; Pascual, J. Neuropeptides as a Marker for Chronic Headache. Curr. Pain Headache Rep. 2017, 21, 18. [Google Scholar] [CrossRef]
- Koyuncu Irmak, D.; Kilinc, E.; Tore, F. Shared Fate of Meningeal Mast Cells and Sensory Neurons in Migraine. Front. Cell. Neurosci. 2019, 13, 136. [Google Scholar] [CrossRef]
- Long, T.; He, W.; Pan, Q.; Zhang, S.; Zhang, D.; Qin, G.; Chen, L.; Zhou, J. Microglia P2X4R-BDNF signalling contributes to central sensitization in a recurrent nitroglycerin-induced chronic migraine model. J. Headache Pain 2020, 21, 4. [Google Scholar] [CrossRef] [PubMed]
- MaassenVanDenBrink, A.; Terwindt, G.M.; van den Maagdenberg, A. Calcitonin gene-related peptide (receptor) antibodies: An exciting avenue for migraine treatment. Genome Med. 2018, 10, 10. [Google Scholar] [CrossRef]
- Gilmore, S.A. Proliferation of non-neuronal cells in spinal cords of irradiated, immature rats following transection of the sciatic nerve. Anat. Rec. 1975, 181, 799–811. [Google Scholar] [CrossRef]
- Chen, G.; Zhang, Y.Q.; Qadri, Y.J.; Serhan, C.N.; Ji, R.R. Microglia in Pain: Detrimental and Protective Roles in Pathogenesis and Resolution of Pain. Neuron 2018, 100, 1292–1311. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.; Zheng, Y.; Luo, Y.; Du, Y.; Zhang, X.; Fu, J. Curcumin inhibits LPS-induced neuroinflammation by promoting microglial M2 polarization via TREM2/ TLR4/ NF-κB pathways in BV2 cells. Mol. Immunol. 2019, 116, 29–37. [Google Scholar] [CrossRef] [PubMed]
- Wieseler, J.; Ellis, A.; McFadden, A.; Stone, K.; Brown, K.; Cady, S.; Bastos, L.F.; Sprunger, D.; Rezvani, N.; Johnson, K.; et al. Supradural inflammatory soup in awake and freely moving rats induces facial allodynia that is blocked by putative immune modulators. Brain Res. 2017, 1664, 87–94. [Google Scholar] [CrossRef]
- Rua, R.; McGavern, D.B. Advances in Meningeal Immunity. Trends Mol. Med. 2018, 24, 542–559. [Google Scholar] [CrossRef]
- Oliveira, A.B.; Bachi, A.L.L.; Ribeiro, R.T.; Mello, M.T.; Tufik, S.; Peres, M.F.P. Unbalanced plasma TNF-α and IL-12/IL-10 profile in women with migraine is associated with psychological and physiological outcomes. J. Neuroimmunol. 2017, 313, 138–144. [Google Scholar] [CrossRef]
- Wang, F.; He, Q.; Ren, Z.; Li, F.; Chen, W.; Lin, X.; Zhang, H.; Tai, G. Association of serum levels of intercellular adhesion molecule-1 and interleukin-6 with migraine. Neurol. Sci. Off. J. Ital. Neurol. Soc. Ital. Soc. Clin. Neurophysiol. 2015, 36, 535–540. [Google Scholar] [CrossRef]
- Martami, F.; Razeghi Jahromi, S.; Togha, M.; Ghorbani, Z.; Seifishahpar, M.; Saidpour, A. The serum level of inflammatory markers in chronic and episodic migraine: A case-control study. Neurol. Sci. Off. J. Ital. Neurol. Soc. Ital. Soc. Clin. Neurophysiol. 2018, 39, 1741–1749. [Google Scholar] [CrossRef]
- Xie, L.; Zhang, N.; Zhang, Q.; Li, C.; Sandhu, A.F.; Iii, G.W.; Lin, S.; Lv, P.; Liu, Y.; Wu, Q.; et al. Inflammatory factors and amyloid β-induced microglial polarization promote inflammatory crosstalk with astrocytes. Aging 2020, 12, 22538–22549. [Google Scholar] [CrossRef]
- Xie, L.; Liu, Y.; Zhang, N.; Li, C.; Sandhu, A.F.; Williams, G., 3rd; Shen, Y.; Li, H.; Wu, Q.; Yu, S. Electroacupuncture Improves M2 Microglia Polarization and Glia Anti-inflammation of Hippocampus in Alzheimer’s Disease. Front. Neurosci. 2021, 15, 689629. [Google Scholar] [CrossRef] [PubMed]
- Rahimifard, M.; Maqbool, F.; Moeini-Nodeh, S.; Niaz, K.; Abdollahi, M.; Braidy, N.; Nabavi, S.M.; Nabavi, S.F. Targeting the TLR4 signaling pathway by polyphenols: A novel therapeutic strategy for neuroinflammation. Ageing Res. Rev. 2017, 36, 11–19. [Google Scholar] [CrossRef]
- Erdener, Ş.E.; Kaya, Z.; Dalkara, T. Parenchymal neuroinflammatory signaling and dural neurogenic inflammation in migraine. J. Headache Pain 2021, 22, 138. [Google Scholar] [CrossRef]
- Jack, C.S.; Arbour, N.; Manusow, J.; Montgrain, V.; Blain, M.; McCrea, E.; Shapiro, A.; Antel, J.P. TLR signaling tailors innate immune responses in human microglia and astrocytes. J. Immunol. 2005, 175, 4320–4330. [Google Scholar] [CrossRef] [PubMed]
- Zhu, H.T.; Bian, C.; Yuan, J.C.; Chu, W.H.; Xiang, X.; Chen, F.; Wang, C.S.; Feng, H.; Lin, J.K. Curcumin attenuates acute inflammatory injury by inhibiting the TLR4/MyD88/NF-κB signaling pathway in experimental traumatic brain injury. J. Neuroinflammation 2014, 11, 59. [Google Scholar] [CrossRef] [PubMed]
- Agalave, N.M.; Larsson, M.; Abdelmoaty, S.; Su, J.; Baharpoor, A.; Lundbäck, P.; Palmblad, K.; Andersson, U.; Harris, H.; Svensson, C.I. Spinal HMGB1 induces TLR4-mediated long-lasting hypersensitivity and glial activation and regulates pain-like behavior in experimental arthritis. Pain 2014, 155, 1802–1813. [Google Scholar] [CrossRef]
- Lin, J.J.; Du, Y.; Cai, W.K.; Kuang, R.; Chang, T.; Zhang, Z.; Yang, Y.X.; Sun, C.; Li, Z.Y.; Kuang, F. Toll-like receptor 4 signaling in neurons of trigeminal ganglion contributes to nociception induced by acute pulpitis in rats. Sci. Rep. 2015, 5, 12549. [Google Scholar] [CrossRef]
- Gong, Q.; Lin, Y.; Lu, Z.; Xiao, Z. Microglia-Astrocyte Cross Talk through IL-18/IL-18R Signaling Modulates Migraine-like Behavior in Experimental Models of Migraine. Neuroscience 2020, 451, 207–215. [Google Scholar] [CrossRef]
- Wang, L.; Yang, J.W.; Lin, L.T.; Huang, J.; Wang, X.R.; Su, X.T.; Cao, Y.; Fisher, M.; Liu, C.Z. Acupuncture Attenuates Inflammation in Microglia of Vascular Dementia Rats by Inhibiting miR-93-Mediated TLR4/MyD88/NF-κB Signaling Pathway. Oxidative Med. Cell. Longev. 2020, 2020, 8253904. [Google Scholar] [CrossRef]
- Rinne, M.; Mätlik, K.; Ahonen, T.; Vedovi, F.; Zappia, G.; Moreira, V.M.; Yli-Kauhaluoma, J.; Leino, S.; Salminen, O.; Kalso, E.; et al. Mitoxantrone, pixantrone and mitoxantrone (2-hydroxyethyl)piperazine are toll-like receptor 4 antagonists, inhibit NF-κB activation, and decrease TNF-alpha secretion in primary microglia. Eur. J. Pharm. Sci. Off. J. Eur. Fed. Pharm. Sci. 2020, 154, 105493. [Google Scholar] [CrossRef] [PubMed]
- Liu, S.; Wang, Z.F.; Su, Y.S.; Ray, R.S.; Jing, X.H.; Wang, Y.Q.; Ma, Q. Somatotopic Organization and Intensity Dependence in Driving Distinct NPY-Expressing Sympathetic Pathways by Electroacupuncture. Neuron 2020, 108, 436–450, e437. [Google Scholar] [CrossRef] [PubMed]
- Liu, S.; Wang, Z.; Su, Y.; Qi, L.; Yang, W.; Fu, M.; Jing, X.; Wang, Y.; Ma, Q. A neuroanatomical basis for electroacupuncture to drive the vagal-adrenal axis. Nature 2021, 598, 641–645. [Google Scholar] [CrossRef] [PubMed]








| Gene | Primer Sequences (5′-3′) | Product (bp) |
|---|---|---|
| CGRP | Forward TTCCTGGTTGTCAGCATCTTG | 121 |
| Reverse GTAGGCGAGCTTCTTCTTCACT | ||
| IL-1β | Forward TCCCAAACAATACCCAAAGAAG | 171 |
| Reverse ACTATGTCCCGACCATTGCTG | ||
| TNF-α | Forward CTTCTCATTCCTGCTCGTGG | 200 |
| Reverse CCGCTTGGTGGTTTGCTAC | ||
| IL-6 | Forward GACAAAGCCAGAGTCATTCAGAG | 163 |
| Reverse GGATGGTCTTGGTCCTTAGCC | ||
| β-actin | Forward ACGGTCAGGTCATCACTATCG | 155 |
| Reverse GGCATAGAGGTCTTTACGGATG |
| Antibody | Manufacturer | Catalogue Number | Host | Dilution |
|---|---|---|---|---|
| For immunohistochemistry | ||||
| Ibal-1 | Abcam, Cambridge, UK | ab178847 | Rabbit | 1:200 |
| IL-1β | Abcam, Cambridge, UK | ab254360 | Rabbit | 1:50 |
| TNF-α | Bioss, Beijing, China | bs-2081R | Rabbit | 1:100 |
| IL-6 | Bioss, Beijing, China | bs-6309R | Rabbit | 1:100 |
| Anti-Rabbit IgG (HRP) | AiFang, Changsha, China | AFIHC003 | Goat | 1:200 |
| For Western blot analysis | ||||
| Ibal-1 | Abcam, Cambridge, UK | ab178847 | Rabbit | 1:1000 |
| TLR4 | Novus, St Charles, MO, USA | NB100-56566 | Mouse | 1:1000 |
| NF-κB | CST, Danvers, MA, USA | 6956T | Mouse | 1:1000 |
| β-actin | Zenbio, Chengdu, China | 200068-8F10 | Mouse | 1:10,000 |
| Anti-Rabbit IgG (HRP) | Zenbio, Chengdu, China | 511203 | Goat | 1:10,000 |
| Anti-Mouse IgG (HRP) | Zenbio, Chengdu, China | 511103 | Goat | 1:10,000 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhou, M.; Pang, F.; Liao, D.; He, X.; Yang, Y.; Tang, C. Electroacupuncture at Fengchi(GB20) and Yanglingquan(GB34) Ameliorates Paralgesia through Microglia-Mediated Neuroinflammation in a Rat Model of Migraine. Brain Sci. 2023, 13, 541. https://doi.org/10.3390/brainsci13040541
Zhou M, Pang F, Liao D, He X, Yang Y, Tang C. Electroacupuncture at Fengchi(GB20) and Yanglingquan(GB34) Ameliorates Paralgesia through Microglia-Mediated Neuroinflammation in a Rat Model of Migraine. Brain Sciences. 2023; 13(4):541. https://doi.org/10.3390/brainsci13040541
Chicago/Turabian StyleZhou, Min, Fang Pang, Dongmei Liao, Xinlu He, Yunhao Yang, and Chenglin Tang. 2023. "Electroacupuncture at Fengchi(GB20) and Yanglingquan(GB34) Ameliorates Paralgesia through Microglia-Mediated Neuroinflammation in a Rat Model of Migraine" Brain Sciences 13, no. 4: 541. https://doi.org/10.3390/brainsci13040541
APA StyleZhou, M., Pang, F., Liao, D., He, X., Yang, Y., & Tang, C. (2023). Electroacupuncture at Fengchi(GB20) and Yanglingquan(GB34) Ameliorates Paralgesia through Microglia-Mediated Neuroinflammation in a Rat Model of Migraine. Brain Sciences, 13(4), 541. https://doi.org/10.3390/brainsci13040541

