Monitoring Living Modified Canola Using an Efficient Multiplex PCR Assay in Natural Environments in South Korea
Abstract
:1. Introduction
2. Materials and Methods
2.1. LMO Monitoring Methods and Plant Materials
2.2. DNA Extraction
2.3. Primer Design and Multiplex PCR Analysis
3. Results and Discussion
3.1. The Necessity of the Multiplex PCR Technique for the Environmental LMO Monitoring Project
3.2. LMO Monitoring in the Natural Environment for Canola
3.3. Establishment of a Novel Multiplex PCR Method
3.4. Detection of LM Canola Using the Newly Developed Multiplex PCR Method
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
References
- CBD. Convention on Biological Diversity. Available online: https://www.cbd.int (accessed on 10 October 2020).
- CPB. The Cartagena Protocol on Biosafety. Available online: https://bch.cbd.int/protocol/text/ (accessed on 10 October 2020).
- Jang, H.-M. Guideline for managing research facilities and LMOs for R&D by the Act on transboundary movement of LMOs, etc. J. Plant Biotechnol. 2008, 35, 5–12. [Google Scholar] [CrossRef] [Green Version]
- House, K.B.C. Biosafety White Paper 2017; Korea Biosafety Clearing House: Daejeon, Korea, 2017. [Google Scholar]
- Paulauskas, A.; Jodinskas, G.; Lygis, D.; Jodinskiene, M. GMO monitoring system in Lithuania. J. Verbrauch. Lebensm. 2009, 3, 32–35. [Google Scholar] [CrossRef]
- Kleppin, L.; Schmidt, G.; Schröder, W. Cultivation of GMO in Germany: Support of monitoring and coexistence issues by WebGIS technology. Environ. Sci. Eur. 2011, 23, 1–11. [Google Scholar] [CrossRef] [Green Version]
- Züghart, W.; Benzler, A.; Berhorn, F.; Sukopp, U.; Graef, F. Determining indicators, methods and sites for monitoring potential adverse effects of genetically modified plants to the environment: The legal and conceptual framework for implementation. Euphytica 2008, 164, 845–852. [Google Scholar] [CrossRef]
- Lee, J.R.; Lim, H.S.; Choi, W.; Park, J.H.; Jung, Y.J.; Kim, D.W.; Kim, I.R.; Yoo, S.H.; Seol, M.-A.; Han, S.M. Study on Environmental Monitoring and Post-Management of LMO; National Institute of Ecology: Seocheon-gun, Korea, 2019. [Google Scholar]
- Shin, S.Y.; Moon, J.C.; Choi, W.; Kim, I.R.; Jo, B.-H.; Lee, J.R. Detection and environmental unintentional release monitoring of living modified maize (Zea mays L.) in Gyeonggi-do of South Korea in 2014. J. Plant Biotechnol. 2018, 45, 77–82. [Google Scholar] [CrossRef] [Green Version]
- Myers, R. Growing Canola for Oilseed or Cover Crop Use; University of Missouri Extension: Columbia, MO, USA, 2018; pp. 1–7. [Google Scholar]
- US Department of Agriculture, Agricultural Research Service. Oilseeds: World Markets and Trade; Foreign Agricultural Service, USDA: Washington, DC, USA, 2019.
- Brookes, G.; Barfoot, P. Global income and production impacts of using GM crop technology 1996–2014. GM Crops Food 2016, 7, 38–77. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Briefs, I. Global Status of Commercialized Biotech/GM Crops in 2017: Biotech Crop Adoption Surges as Economic Benefits Accumulate in 22 Years. 2017; p. 53. Available online: http://www.agi.gov.vn/files/files/ISAAA/ISAAA%20Brief%20No_%2053%20-%202017_compressed.pdf (accessed on 31 October 2020).
- Meng, J.; Shi, S.; Gan, L.; Li, Z.; Qu, X. The production of yellow-seeded Brassica napus (AACC) through crossing interspecific hybrids of B. campestris (AA) and B. carinata (BBCC) with B. napus. Euphytica 1998, 103, 329–333. [Google Scholar] [CrossRef]
- Bing, D.; Downey, R.; Rakow, G. Hybridizations among Brassica napus, B. rapa and B. juncea and their two weedy relatives B. nigra and Sinapis arvensis under open pollination conditions in the field. Plant Breed. 1996, 115, 470–473. [Google Scholar] [CrossRef]
- Ford, C.S.; Allainguillaume, J.; Grilli-Chantler, P.; Cuccato, G.; Allender, C.J.; Wilkinson, M.J. Spontaneous gene flow from rapeseed (Brassica napus) to wild Brassica oleracea. Proc. R. Soc. B Biol. Sci. 2006, 273, 3111–3115. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Warwick, S.; Simard, M.-J.; Légère, A.; Beckie, H.; Braun, L.; Zhu, B.; Mason, P.; Séguin-Swartz, G.; Stewart, C. Hybridization between transgenic Brassica napus L. and its wild relatives: Brassica rapa L., Raphanus raphanistrum L., Sinapis arvensis L., and Erucastrum gallicum (Willd.) OE Schulz. Theor. Appl. Genet. 2003, 107, 528–539. [Google Scholar] [CrossRef] [PubMed]
- Lefol, E.; S´eguin-Swartz, G.; Downey, R.K. Sexual hybridisation in crosses of cultivated Brassica species with the crucifers Erucastrum gallicum and Raphanus raphanistrum: Potential for gene introgression. Euphytica 1997, 95, 127–139. [Google Scholar] [CrossRef]
- Snowdon, R.K.; Winter, H.; Diestel, A.; Sacristán, M.D. Development and characterisation of Brassica napus-Sinapis arvensis addition lines exhibiting resistance to Leptosphaeria maculans. Theor. Appl. Genet. 2000, 101, 1008–1014. [Google Scholar] [CrossRef]
- Kawata, M.; Murakami, K.; Ishikawa, T. Dispersal and persistence of genetically modified oilseed rape around Japanese harbors. Environ. Sci. Pollut. Res. 2009, 16, 120–126. [Google Scholar] [CrossRef] [PubMed]
- JRC. Joint Research Centre. Available online: http://gmo-crl.jrc.ec.europa.eu/gmomethods (accessed on 10 October 2020).
- ISAAA. International Service for the Acquisition of Agri-Biotech Applications. Available online: http://www.isaaa.org/gmapprovaldatabase/ (accessed on 10 October 2020).
- Mazzara, M.; Luque-Perez, E.; Bevilacqua, A.; Van den Eede, G. In-house validation of an Event-specific Method for the Quantification of Oliseed Rape Topas 19/2 using Real-time PCR. JCR Sci. Tech. Rep. 2011, 1–17. [Google Scholar] [CrossRef]
- Jacchia, S.; Bogni, A.; Mazzara, M.; Kreysa, J. Event-Specific Method for the Quantification of Oilseed Rape DP-073496-4 Using Real-Time PCR; European Union Reference Laboratory for GM Food and Feed: Ispra, Italy, 2014. [Google Scholar]
- Mazzara, M.; Bogni, A.; Savini, C.; Van Den Eede, G. Event-specific Method for the Quantification of Oilseed Rape Line Ms8 Using Real-Time PCR; European Union Reference Laboratory for GM Food and Feed: Ispra, Italy, 2007. [Google Scholar]
- Mazzara, M.; Grazioli, E.; Savini, C.; Van Den Eede, G. Event-Specific Method for the Quantification of Oilseed Rape Line RT73 Using Real-Time PCR; European Union Reference Laboratory for GM Food and Feed: Ispra, Italy, 2007; pp. 1–108. [Google Scholar]
- Mazzara, M.; Savini, C.; Bogni, A.; Van Den Eede, G. Event-Specific Method for the Quantification of Oilseed Rape Line Rf3 Using Real-Time PCR v. 1.01; European Union Reference Laboratory for GM Food and Feed: Ispra, Italy, 2013. [Google Scholar]
- Savini, C.; Bogni, A.; Mazzara, M.; Kreysa, J. Event-Specific Method for the Quantification of Oilseed Rape MON88302 by Real-Time PCR; European Union Reference Laboratory for GM Food and Feed: Ispra, Italy, 2013. [Google Scholar]
- Savini, C.; Sacco, M.G.; Mazzara, M.; Kreysa, J. Event-specific Method for the Quantification of Soybean DAS-68416-4 Using Real-Time PCR; European Union Reference Laboratory for GM Food and Feed: Ispra, Italy, 2014. [Google Scholar]
- Vos, P.; Hogers, R.; Bleeker, M.; Reijans, M.; Lee, T.V.d.; Hornes, M.; Friters, A.; Pot, J.; Paleman, J.; Kuiper, M.; et al. AFLP: A new technique for DNA fingerprinting. Nucleic Acids Res. 1995, 23, 4407–4414. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Event | Name | Sequence (5′–3′) | Product Size (bp) | Reference |
---|---|---|---|---|
Topas 19/2 | Topas 19/2-F | CGACCGGCGCTGATATATGA | 95 | [23] |
Topas 19/2-R | GTTGCGGTTCTGTCAGTTCC | |||
Rf3 | Rf3-F | AGCATTTAGCATGTACCATCAGACA | 139 | [27] |
Rf-R | CATAAAGGAAGATGGAGACTTGAG | |||
DP-073496-4 | DP-073496-4-F | CAAGAGAATCCATTTGTTCCTAAAC | 219 | This study |
DP-073496-4-R | CAAACCTCCATAGAGTTCAACATCTTAA | [24] | ||
Ms8 | Ms8-F | CCAAATAGCCTCCCACCCTATA | 249 | This study |
Ms8-R | GGAGGGTGTTTTTGGTTATC | [25] | ||
GT(RT)73 | GT73-F | CGACGGATCGTAATTTGTCG | 317 | This study |
GT73-R | CTAGCCGTCGATTTCCACATGTGGA | This study | ||
MON88032 | MON88032-F | CGCGTCTAGAAGTTGTGGATAAGATTGAATC | 407 | This study |
MON88032-R | TCAGATTGTCGTTTCCCGCCTTCA | [28] | ||
T45 | T45-F | CAAGCGTGTCGTGCTCCACCATGTT | 550 | This study |
T45-R | CGCGAAAGTGGTGTGAAATTAAG | This study |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kim, I.R.; Lim, H.S.; Choi, W.; Kang, D.I.; Lee, S.Y.; Lee, J.R. Monitoring Living Modified Canola Using an Efficient Multiplex PCR Assay in Natural Environments in South Korea. Appl. Sci. 2020, 10, 7721. https://doi.org/10.3390/app10217721
Kim IR, Lim HS, Choi W, Kang DI, Lee SY, Lee JR. Monitoring Living Modified Canola Using an Efficient Multiplex PCR Assay in Natural Environments in South Korea. Applied Sciences. 2020; 10(21):7721. https://doi.org/10.3390/app10217721
Chicago/Turabian StyleKim, Il Ryong, Hye Song Lim, Wonkyun Choi, Da In Kang, Sang Yeol Lee, and Jung Ro Lee. 2020. "Monitoring Living Modified Canola Using an Efficient Multiplex PCR Assay in Natural Environments in South Korea" Applied Sciences 10, no. 21: 7721. https://doi.org/10.3390/app10217721