Dietary Supplementation with Puerarin Improves Intestinal Function in Piglets Challenged with Escherichia coli K88
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethics Statement
2.2. Animal Care and Diets
2.3. Experimental Design
2.4. Blood Sample Collection
2.5. Intestinal Sample Collection
2.6. Collection of Intestinal Contents
2.7. Intestinal Morphological Measurements
2.8. Plasma Biochemical Indices and Intestinal Antioxidant Indices
2.9. Measurement of Plasma Inflammatory Markers
2.10. Determination of Intestinal Microflora
2.11. Quantitative PCR Analysis of Gene Expression
2.12. Statistical Analysis
3. Results
3.1. Growth Performance
3.2. Fecal Score
3.3. Plasma Biochemical Indices and Blood Cell Counts
3.4. Concentrations of D-Xylose and Diamine Oxidase (DAO) Activity in Plasma
3.5. The Levels of Antioxidative Enzymes and Oxidation-Relevant Products in Intestinal Mucosae
3.6. Intestinal Morphology
3.7. Intestinal Microflora
3.8. The Concentrations of Cytokines in Plasma
3.9. Expression of the Related Genes
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Wijtten, P.J.; Van der Meulen, J.; Verstegen, M.W. Intestinal barrier function and absorption in pigs after weaning: A review. Br. J. Nutr. 2011, 105, 967–981. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Spreeuwenberg, M.A.; Verdonk, J.M.; Gaskins, H.R.; Verstegen, M.W. Small intestine epithelial barrier function is compromised in pigs with low feed intake at weaning. J. Nutr. 2001, 131, 1520–1527. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yin, J.; Wu, M.M.; Xiao, H.; Ren, W.K.; Duan, J.L.; Yang, G.; Li, T.J.; Yin, Y.L. Development of an antioxidant system after early weaning in piglets. J. Anim. Sci. 2014, 92, 612. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Moeser, A.J.; Ryan, K.A.; Nighot, P.K.; Blikslager, A.T. Gastrointestinal dysfunction induced by early weaning is attenuated by delayed weaning and mast cell blockade in pigs. Am. J. Physiol. Gastrointest. Liver Physiol. 2007, 293, G413–G421. [Google Scholar] [CrossRef] [Scilit]
- Etheridge, R.D.; Seerley, R.W.; Wyatt, R.D. The effect of diet on performance, digestibility, blood composition and intestinal microflflora of weaned pigs. J. Anim. Sci. 1984, 58, 1396–1402. [Google Scholar] [CrossRef] [Scilit]
- Pluske, J.R.; Hampson, D.J.; Williams, I.H. Factors influencing the structure and function of the small intestine in the weaned pigs: A review. Livest. Prod. Sci. 1997, 51, 215–236. [Google Scholar] [CrossRef] [Scilit]
- Kim, J.C.; Hansen, C.F.; Mullan, B.P.; Pluske, J.R. Nutrition and pathology of weaner pigs: Nutritional strategies to support barrier function in the gastrointestinal tract. Anim. Feed. Sci. Technol. 2012, 173, 3–16. [Google Scholar] [CrossRef] [Scilit]
- Heo, J.M.; Opapeju, F.O.; Pluske, J.R.; Kim, J.C.; Hampson, D.J.; Nyachoti, C.M. Gastrointestinal health and function in weaned pigs: A review of feeding strategies to control post-weaning diarrhoea without using in-feed antimicrobial compounds. J. Anim. Physiol. Anim. Nutr. 2013, 97, 207–237. [Google Scholar] [CrossRef] [Scilit]
- Cox, E.; Houvenaghel, A. Comparison of the in vitro adhesion of K88, K99, F41 and P987 positive Escherichia coli to intestinal villi of 4- to 5-week-old pigs. Vet. Microbiol. 1993, 34, 7–19. [Google Scholar] [CrossRef] [Scilit]
- Osek, J. Prevalence of virulence factors of Escherichia coli strains isolated from diarrheic and healthy piglets after weaning. Vet. Microbiol. 1999, 68, 209–217. [Google Scholar] [CrossRef] [Scilit]
- Zhang, W.; Zhao, M.; Ruesch, L.; Omot, A.; Francis, D. Prevalence of virulence genes in Escherichia coli strains recently isolated from young pigs with diarrhea in the US. Vet. Microbiol. 2007, 123, 145–152. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wu, T.; Shi, Y.; Zhang, Y.; Zhang, M.; Zhang, L.; Ma, Z.; Zhao, D.; Wang, L.; Yu, H.; Hou, Y.; et al. Lactobacillus rhamnosus LB1 Alleviates Enterotoxigenic Escherichia coli-Induced Adverse Effects in Piglets by Improving Host Immune Response and Anti-Oxidation Stress and Restoring Intestinal Integrity. Front. Cell. Infect. Microbiol. 2021, 11, 724401. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dubreuil, J.D. The whole shebang: The gastrointestinal tract, Escherichia coli enterotoxins and secretion. Curr. Issues Mol. Biol. 2012, 14, 71–82. [Google Scholar]
- Nabuurs, M.J.; Hoogendoorn, A.; van Zijderveld, F.G. Effects of weaning and enterotoxigenic Escherichia coli on net absorption in the small intestine of pigs. Res. Vet. Sci. 1994, 56, 379–385. [Google Scholar] [CrossRef] [Scilit]
- Kwon, C.H.; Lee, C.Y.; Han, S.J.; Kim, S.J.; Park, B.C.; Jang, I.; Han, J.H. Effects of dietary supplementation of lipid-encapsulated zinc oxide on colibacillosis, growth and intestinal morphology in weaned piglets challenged with enterotoxigenic Escherichia coli. Anim. Sci. J. 2014, 85, 805–813. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fossum, C. Cytokines as markers for infections and their effect on growth performance and well-being in the pig. Domest. Anim. Endocrinol. 1998, 15, 439–444. [Google Scholar] [CrossRef] [Scilit]
- Fairbrother, J.M.; Nadeau, E.; Gyles, C.L. Escherichia coli in post-weaning diarrhea in pigs: An update on bacterial types, pathogenesis, and prevention strategies. Anim. Health Res. Rev. 2005, 6, 17–39. [Google Scholar] [CrossRef] [Scilit]
- Xu, C.; Wang, Y.; Sun, R.; Qiao, X.; Shang, X.; Niu, W. Modulatory Effects of Vasoactive Intestinal Peptide on Intestinal Mucosal Immunity and Microbial Community of Weaned Piglets Challenged by an Enterotoxigenic Escherichia coli (K88). PLoS ONE 2014, 9, e104183. [Google Scholar] [CrossRef] [Scilit]
- Mohr, K.I. History of Antibiotics Research. Curr. Top. Microbiol. Immunol. 2016, 398, 237–272. [Google Scholar]
- Kantas, D.; Papatsiros, V.G.; Tassis, P.D.; Giavasis, I.; Bouki, P.; Tzika, E.D. A Feed Additive Containing Bacillus Toyonensis (Toyocerin®) Protects Against Enteric Pathogens in Postweaning Piglets. J. Appl. Microbiol. 2015, 118, 727–738. [Google Scholar] [CrossRef] [Scilit]
- Jing, Y.; Liu, H.; Xu, W.; Yang, Q. 4,4′-Diaponeurosporene-Producing Bacillus subtilis Promotes the Development of the Mucosal Immune System of the Piglet Gut. Anat. Rec. 2019, 302, 1800–1807. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xu, B.; Fu, J.; Zhu, L.; Li, Z.; Jin, M.; Wang, Y. Overall Assessment of Antibiotic Substitutes for Pigs: A Set of Meta-Analyses. J. Anim. Sci. Biotechnol. 2021, 12, 3. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Prasain, J.K.; Jones, K.; Kirk, M.; Wilson, L.; Smith-Johnson, M.; Weaver, C.; Barnes, S. Profiling and quantification of isoflavonoids in kudzu dietary supplements by high-performance liquid chromatography and electrospray ionization tandem mass spectrometry. Agric. Food Chem. 2003, 51, 4213–4218. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yang, X.; Hu, W.; Zhang, Q.; Wang, Y.; Sun, L. Puerarin inhibits c-reactive protein expression via suppression of nuclear factor κb activation in lipopolysaccharide-induced peripheral blood mononuclear cells of patients with stable angina pectoris. Basic Clin. Pharmacol. Toxicol. 2010, 107, 637–642. [Google Scholar] [CrossRef] [Scilit]
- Liu, X.J.; Mei, Z.G.; Qian, J.P.; Zeng, Y.B.; Wang, M.Z. Puerarin partly counteracts the infammatory response afer cerebral ischemia/reperfusion via activating the cholinergic anti-infammatory pathway. Neural Regen. Res. 2013, 34, 3203–3215. [Google Scholar]
- Shin, B.; Park, W. Zoonotic diseases and phytochemical medicines for microbial infections in veterinary science: Current state and future perspective. Front. Vet. Sci. 2018, 5, 166. [Google Scholar] [CrossRef] [Scilit]
- Liu, X.; Liu, F.; Ma, Y.; Li, H.; Ju, X.; Xu, J. Effect of Puerarin, Baicalin and Berberine Hydrochloride on the Regulation of IPEC-J2 Cells Infected with Enterotoxigenic Escherichia coli. Evid.-Based Complement. Altern. Med. 2019, 2019, 7438593. [Google Scholar] [CrossRef] [Scilit]
- Bhandari, S.K.; Xu, B.; Nyachoti, C.M.; Giesting, D.W.; Krause, D.O. Evaluation of alternatives to antibiotics using an Escherichia coli K88+ model of piglet diarrhea: Effects on gut microbial ecology. J. Anim. Sci. 2008, 86, 836–847. [Google Scholar] [CrossRef] [Scilit]
- Haeney, M.R.; Culank, L.S.; Montgomery, R.D.; Sammons, H.G. Evaluation of xylose absorption as measured in blood and urine: A one-hour blood xylose screening test in malabsorption. Gastroenterology 1978, 75, 393–400. [Google Scholar] [CrossRef] [Scilit]
- Hou, Y.Q.; Wang, L.; Ding, B.Y.; Liu, Y.L.; Zhu, H.L.; Liu, J.; Li, Y.T.; Kang, P.; Yin, Y.L.; Wu, G. Alpha-ketoglutarate and intestinal function. Front. Biosci. 2011, 16, 1186–1196. [Google Scholar] [CrossRef] [Scilit]
- Deng, D.; Yin, Y.L.; Chu, W.Y.; Yao, K.; Li, T.J.; Huang, R.L.; Liu, Z.Q.; Zhang, J.S.; Wu, G. Impaired translation initiation activation and reduced protein synthesis in weaned piglets fed a low-protein diet. J. Nutr. Biochem. 2009, 20, 544–552. [Google Scholar] [CrossRef] [Scilit]
- Hou, Y.Q.; Wang, L.; Ding, B.Y.; Liu, Y.L.; Zhu, H.L.; Liu, J.; Li, Y.T.; Wu, X.; Yin, Y.L.; Wu, G.Y. Dietary a-ketoglutarate supplementation ameliorates intestinal injury in lipopolysaccharide challenged piglets. Amino Acids 2010, 39, 555–564. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tan, B.E.; Li, X.G.; Kong, X.F.; Huang, R.L.; Ruan, Z.; Yao, K.; Deng, Z.Y.; Xie, M.Y.; Shinzato, I.; Yin, Y.L.; et al. Dietary L-arginine supplementation enhances the immune status in early-weaned piglets. Amino Acids 2009, 37, 323–331. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, P.; Kim, S.W.; Li, X.L.; Datta, S.; Pond, W.G.; Wu, G. Dietary supplementation with cholesterol and docosahexaenoic acid affects concentrations of amino acids in tissues of young pigs. Amino Acids 2009, 37, 709–716. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hou, Y.; Wang, L.; Zhang, W.; Yang, Z.; Ding, B.; Zhu, H.; Liu, Y.; Qiu, Y.; Yin, Y.; Wu, G. Protective effects of N-acetylcysteine on intestinal functions of piglets challenged with lipopolysaccharide. Amino Acids 2012, 43, 1233–1242. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Uni, Z.; Ganot, S.; Sklan, D. Posthatch development of mucosal function in the broiler small intestine. Poult. Sci. 1998, 77, 75–82. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lun, F.M.; Chiu, R.W.; Chan, K.C.; Leung, T.Y.; Lau, T.K.; Lo, Y.M. Microfluidics Digital PCR Reveals a Higher than Expected Fraction of Fetal DNA in Maternal Plasma. Clin. Chem. 2008, 54, 1664–1672. [Google Scholar] [CrossRef] [Scilit]
- Yi, D.; Hou, Y.; Wang, L.; Long, M.; Hu, S.; Mei, H.; Yan, L.; Hu, C.A.; Wu, G. N-acetylcysteine stimulates protein synthesis in enterocytes independently of glutathione synthesis. Amino Acids 2016, 48, 523–533. [Google Scholar] [CrossRef] [Scilit]
- Yi, D.; Fang, Q.; Hou, Y.; Wang, L.; Xu, H.; Wu, T.; Gong, J.; Wu, G. Dietary Supplementation with Oleum Cinnamomi Improves Intestinal Functions in Piglets. Int. J. Mol. Sci. 2018, 19, 1284. [Google Scholar] [CrossRef] [Scilit]
- Wong, K.H.; Li, G.Q.; Li, K.M.; Razmovski-Naumovski, V.; Chan, K. Kudzu root: Traditional uses and potential medicinal benefits in diabetes and cardiovascular diseases. J. Ethnopharmacol. 2011, 134, 584–607. [Google Scholar] [CrossRef] [Scilit]
- Owusuasiedu, A.; Nyachoti, C.M.; Marquardt, R.R. Response of early-weaned pigs to an enterotoxigenic Escherichia coli (K88) challenge when fed diets containing spray-dried porcine plasma or pea protein isolate plus egg yolk antibody. J. Anim. Sci. 2003, 81, 1790–1798. [Google Scholar] [CrossRef] [Scilit]
- Gustavo Hermes, R.; Molist, F.; Francisco Pérez, J.; Gómez de Segura, A.; Ywazaki, M.; Davin, R.; Nofrarías, M.; Korhonen, T.K.; Virkola, R.; Martín-Orúe, S.M. Casein glycomacropeptide in the diet may reduce Escherichia coli attachment to the intestinal mucosa and increase the intestinal lactobacilli of early weaned piglets after an enterotoxigenic E. coli K88 challenge. Br. J. Nutr. 2013, 109, 1001–1012. [Google Scholar] [CrossRef] [Scilit]
- Nyachoti, C.M.; Omogbenigun, F.O.; Rademacher, M.; Blank, G. Performance responses and indicators of gastrointestinal health in early-weaned pigs fed low-protein amino acid-supplemented diets. J. Anim. Sci. 2006, 84, 125–134. [Google Scholar] [CrossRef] [Scilit]
- Hooper, L.V.; Macpherson, A.J. Immune adaptations that maintain homeostasis with the intestinal microbiota. Nat. Rev. Immunol. 2010, 10, 159–169. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Konstantinov, S.R.; Favier, C.F.; Zhu, W.Y.; Williams, B.A.; Klub, J.; Wolfgang-Bernhard, S.; De VW, M.; Akkermans AD, L.; Hauke, S. Microbial diversity studies of the porcine gastrointestinal ecosystem during weaning transition. Anim. Res. 2004, 53, 317–324. [Google Scholar] [CrossRef] [Scilit]
- Zhang, L.; Xu, Y.Q.; Liu, H.Y.; Lai, T.; Ma, J.L.; Wang, J.F.; Zhu, Y.H. Evaluation of Lactobacillus rhamnosus GG using an Escherichia coli K88 model of piglet diarrhoea: Effects on diarrhoea incidence, faecal microflora and immune responses. Vet. Microbiol. 2010, 141, 142–148. [Google Scholar] [CrossRef] [Scilit]
- Liu, Y.; Zhao, P.; Cheng, M.; Yu, L.; Cheng, Z.; Fan, L.; Chen, C. AST to ALT ratio and arterial stiffness in non-fatty liver Japanese population:a secondary analysis based on a cross-sectional study. Lipids Health Dis. 2018, 17, 275. [Google Scholar] [CrossRef] [Scilit]
- Schlattner, U.; Tokarska-Schlattner, M.; Wallimann, T. Mitochondrial creatine kinase in human health and disease. Biochim. Biophys. Acta-Biomembr. 2006, 1762, 164–180. [Google Scholar] [CrossRef] [Scilit]
- Coma, J. Use of Plasma Urea Nitrogen as a Rapid Response Criterion to Estimate the Lysine Requirements of Growing and Lactating Pigs; Iowa State University: Ames, IA, USA, 1995. [Google Scholar]
- Torrallardona, D.; Conde, M.R.; Badiola, I.; Polo, J.; Brufau, J. Use of spray dried animal plasma as an alternative to antimicrobial medication in weanling pigs. Anim. Feed. Sci. Technol. 2002, 99, 119–129. [Google Scholar] [CrossRef] [Scilit]
- Erçin, C.N.; Doğru, T.; Çelebi, G.; Gürel, H.; Genç, H.; Sertoğlu, E.; Bağci, S. The relationship between blood urea nitrogen levels and metabolic, biochemical, and histopathologic findings of nondiabetic, nonhypertensive patients with nonalcoholic fatty liver disease. Turk. J. Med. Ences 2016, 46, 985–991. [Google Scholar] [CrossRef] [Scilit]
- Gong, Z.; Liu, Q.; Lin, L.; Deng, Y.; Cai, S.; Liu, Z.; Zhang, S.; Xiao, W.; Xiong, S.; Chen, D. L-Theanine prevents ETEC-induced liver damage by reducing intrinsic apoptotic response and inhibiting ERK1/2 and JNK1/2 signaling pathways. Eur. J. Pharmacol. 2018, 818, 184–190. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Han, J.; Liu, Y.L.; Fan, W.; Chao, J.; Hou, Y.Q.; Yin, Y.L.; Zhu, H.L.; Meng, G.Q.; Che, Z.Q. Dietary L-arginine supplementation alleviates immunosuppression induced by cyclophosphamide in weaned pigs. Amino Acids 2009, 37, 643–651. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Henrotin, Y.E.; De Groote, D.D.; Labasse, A.H.; Gaspar, S.E.; Zheng, S.; Geenen, V.G.; Reginster, J. Effects of exogenous IL-1β, TNF-α, IL-6, and IL-8 and LIF on cytokine production by human articular chondrocytes. Osteoarthr. Cartil. 1996, 4, 163–173. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mansell, A.; Jenkins, B.J. Dangerous liaisons between interleukin-6 cytokine and toll-like receptor families: A potent combination in inflammation and cancer. Cytokine Growth Factor Rev. 2013, 24, 249–256. [Google Scholar] [CrossRef] [Scilit]
- Vilcek, J.; Lee, T.H. Tumor necrosis factor. New insights into the molecular mechanisms of its multiple actions. J. Biol. Chem. 1991, 266, 7313–7316. [Google Scholar] [CrossRef] [Scilit]
- Aggarwal, B.B.; Vilček, J. Tumor necrosis factors. Structure, function, and mechanism of action. Immunol. Res. 1992, 56, 1–587. [Google Scholar]
- Hou, Y.; Wang, L.; Yi, D.; Ding, B.; Yang, Z.; Li, J.; Chen, X.; Qiu, Y.; Wu, G. N-acetylcysteine reduces inflammation in the small intestine by regulating redox, EGF and TLR4 signaling. Amino Acids 2013, 45, 513–522. [Google Scholar] [CrossRef] [Scilit]
- Lin, H.; Li, B.; Chen, L.; Ma, Z.; He, K.; Fan, H. Diferential protein analysis of IPEC-J2 cells infected with porcine epidemic diarrhea virus pandemic and classical strains elucidates the pathogenesis of infection. J. Proteome Res. 2017, 16, 2113–2120. [Google Scholar] [CrossRef] [Scilit]
- Wu, M.; Zhang, Q.; Yi, D.; Wu, T.; Chen, H.; Guo, S.; Li, S.; Ji, C.; Wang, L.; Zhao, D.; et al. Quantitative proteomic analysis reveals antiviral and anti-infammatory efects of puerarin in piglets infected with porcine epidemic diarrhea virus. Front. Immunol. 2020, 11, 169. [Google Scholar] [CrossRef] [Scilit]
- Kaplan, M.; Mutlu, E.A.; Benson, M.; Fields, J.Z.; Banan, A.; Keshavarzian, A. Use of herbal preparations in the treatment of oxidant-mediated inflammatory disorders. Complement. Ther. Med. 2007, 15, 207–216. [Google Scholar] [CrossRef] [Scilit]
- Sies, H. Role of metabolic H2O2 generation: Redox signaling and oxidative stress. J. Biol. Chem. 2014, 289, 8735–8741. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Buonocore, G.; Groenendaal, F. Anti-oxidant strategies. Semin. Fetal Neonatal Med. 2007, 12, 287–295. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mruk, D.D.; Silvestrini, B.; Mo, M.Y.; Cheng, C.Y. Antioxidant superoxide dismutase-a review: Its function, regulation in the testis, and role in male fertility. Contraception 2002, 65, 305–311. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fang, Y.Z.; Yang, S.; Wu, G. Free radicals, antioxidants, and nutrition. Nutrition 2002, 18, 872–879. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Barbul, A. Arginine: Biochemistry, phisiology, and therapeutic implication. J. Parentaral Enter. Nutr. 1986, 10, 227–238. [Google Scholar] [CrossRef] [Scilit]
- Witko-Sarsat, V.; Rieu, P.; Descamps-Latscha, B.; Lesavre, P.; Halbwachs-Mecarelli, L. Neutrophils: Olecules, functions and pathophysiological aspects. Lab. Investig. 2000, 80, 617–653. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, S.; Chen, H.; Du, Q.; Shen, J. Targeting Myeloperoxidase (MPO) Mediated Oxidative Stress and Inflammation for Reducing Brain Ischemia Injury: Potential Application of Natural Compounds. Front. Physiol. 2020, 19, 433. [Google Scholar] [CrossRef] [Scilit]
- Lopez-Castejon, G.; Brough, D. Understanding the mechanism of IL-1β secretion. Cytokine Growth Factor Rev. 2011, 22, 189–195. [Google Scholar] [CrossRef] [Scilit]
- Liu, M.; Kuo, F.; Capistrano, K.J.; Kang, D.; Nixon, B.G.; Shi, W.; Chou, C.; Do, M.H.; Stamatiades, E.G.; Gao, S.; et al. TGF-β suppresses type 2 immunity to cancer. Nature 2020, 587, 115–120. [Google Scholar] [CrossRef] [Scilit]
- Mosmann, T.R.; Sad, S. The expanding universe of T-cell subsets: Th1, Th2 and more. Immunol Today 1996, 17, 138–146. [Google Scholar] [CrossRef] [Scilit]
- Asano, A.; Jin, H.K.; Watanabe, T. Mouse Mx2 gene: Organization, mRNA expression and the role of the interferon-response promoter in its regulation. Gene 2003, 306, 105–113. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ren, Y.; Chen, M.; Wu, G.; Ji, D.; Zhou, G.G.; Ren, P.G.; Fu, W. High accumulation of Mx2 renders limited multiplication of oncolytic herpes simplex virus-1 in human tumor cells. Sci. Rep. 2021, 11, 21227. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gearing, A.J.; Hemingway, I.; Pigott, R.; Hughes, J.; Rees, A.J.; Cashman, S.J. Soluble Forms of Vascular Adhesion Molecules, E-Selectin, ICAM-1, and VCAM-1: Pathological Significance. Ann. N. Y. Acad. Sci. 2010, 667, 324–331. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cheng, L.; Gou, L.; Wei, T.; Zhang, J. GBP1 promotes erlotinib resistance via PGK1-activated EMT signaling in non-small cell lung cancer. Int. J. Oncol. 2020, 57, 858–870. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, B.; Huang, R.; Fu, T.; He, P.; Du, C.; Zhou, W.; Xu, K.; Ren, T. GBP2 as a potential prognostic biomarker in pancreatic adenocarcinoma. PeerJ 2021, 9, e11423. [Google Scholar] [CrossRef] [Scilit]









| Items | Content (%) |
|---|---|
| Carbohydrate | ≥46 |
| Crude protein | ≥38 |
| Lactobiose | ≥20 |
| Water | ≤9.0 |
| Ash | ≤8.0 |
| Lysine | ≥2.75 |
| Crude fat | ≥2.0 |
| Threonine | ≥1.7 |
| Methionine | ≥0.7 |
| Ca | 0.3–0.8 |
| Total phosphorus | 0.4–0.9 |
| Gene | Forward (5′-3′) | Reverse (5′-3′) |
|---|---|---|
| Enterobacteriaceae | CATGCCGCGTGTATGAAGAA | CGGGTAACGACAATGAGCAAA |
| Bifidobacterium | TCGCGTC(C/T)GGTGTGAAAG | CCACATCCAGC(A/G)TCCAC |
| Lactobacillus | AGCAGTAGGGAATCTTCCA | CACCGCTACACATGGAG |
| Clostridium | AATGACGGTACCTGACTAA | CTTTGAGTTTCATTCTTGCGAA |
| Total bacterium | CGGTCCAGACTCCTACGGG | TTACCGCGGCTGCTGGCAC |
| Gene | Forward (5′-3′) | Reverse (5′-3′) |
|---|---|---|
| RPL4 | GAGAAACCGTCGCCGAAT | GCCCACCAGGAGCAAGTT |
| MX1 | AGTGCGGCTGTTTACCAAG | TTCACAAACCCTGGCAACTC |
| MX2 | CGCATTCTTTCACTCGCATC | CCTCAACCCACCAACTCACA |
| IL-1β | CAACGTGCAGTCTATGGAGT | GAGGTGCTGATGTACCAGTTG |
| IL-4 | AGGAGCCACACGTGCTTGA | TTGCCAAGCTGTTGAGATTCC |
| ICAM1 | ACCCACCCACACCTTGCTAC | TCACATTCTTCTTTGTCACCACCT |
| VCAM1 | GGATGGTGTTTGCCGTTTCT | CTGGTCCCGTTAGTTTTCACTTTT |
| GBP1 | TGGACTTGGAAACAGATGGAGA | GGATACAGAGTCGAGGCAGGTT |
| GBP2 | ACCAGGAGGTTTTCGTCTCTCTATT | TCCTCTGCCTGTATCCCCTTT |
| Item | Control | ETEC | PR + ETEC |
|---|---|---|---|
| Average daily feed intake (g/d) | |||
| Day 4–7 | 498.5 ± 66.7 | 495.1 ± 67.0 | 496.8 ± 50.1 |
| Day 8–9 | 571.0 ± 34.5 b | 398.7 ± 88.8 a | 458.6 ± 66.5 ab |
| Average daily gain (g/d) | |||
| Day 4–10 | 26.96 ± 20.47 a | −10.18 ± 18.93 b | −6.61 ± 38.39 b |
| Groups | Fecal Scores | Weighted Mean | |||
|---|---|---|---|---|---|
| 0 | 1 | 2 | 3 | ||
| Control | 42 | 8 | 6 | 0 | 0.36 a |
| ETEC | 24 | 15 | 24 | 7 | 1.2 b |
| PR + ETEC | 29 | 5 | 16 | 6 | 0.98 b |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zeng, Y.; Li, R.; Dong, Y.; Yi, D.; Wu, T.; Wang, L.; Zhao, D.; Zhang, Y.; Hou, Y. Dietary Supplementation with Puerarin Improves Intestinal Function in Piglets Challenged with Escherichia coli K88. Animals 2023, 13, 1908. https://doi.org/10.3390/ani13121908
Zeng Y, Li R, Dong Y, Yi D, Wu T, Wang L, Zhao D, Zhang Y, Hou Y. Dietary Supplementation with Puerarin Improves Intestinal Function in Piglets Challenged with Escherichia coli K88. Animals. 2023; 13(12):1908. https://doi.org/10.3390/ani13121908
Chicago/Turabian StyleZeng, Yitong, Rui Li, Yi Dong, Dan Yi, Tao Wu, Lei Wang, Di Zhao, Yanyan Zhang, and Yongqing Hou. 2023. "Dietary Supplementation with Puerarin Improves Intestinal Function in Piglets Challenged with Escherichia coli K88" Animals 13, no. 12: 1908. https://doi.org/10.3390/ani13121908
APA StyleZeng, Y., Li, R., Dong, Y., Yi, D., Wu, T., Wang, L., Zhao, D., Zhang, Y., & Hou, Y. (2023). Dietary Supplementation with Puerarin Improves Intestinal Function in Piglets Challenged with Escherichia coli K88. Animals, 13(12), 1908. https://doi.org/10.3390/ani13121908

