Chronological Expression of PITX2 and SIX1 Genes and the Association between Their Polymorphisms and Chicken Meat Quality Traits
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Experimental Animals
2.2. Data Collection of Meat Quality Traits
2.3. DNA Extraction, PCR Amplification and Sequencing
2.4. RNA Extraction, cDNA Synthesis and Quantitative Real-Time PCR (qPCR)
2.5. Statistical Analysis
3. Results
3.1. The Chronological Expression of PITX2 and SIX1 Genes and Their Correlation
3.2. Polymorphisms and Diversity Parameter of PITX2 and SIX1 Genes
3.3. Association of PITX2 and SIX1 Gene Polymorphisms with Meat Quality Traits
3.4. The Correlation among Meat Quality Traits
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Toomer, O.T.; Livingston, M.L.; Wall, B.; Sanders, E.; Vu, T.C.; Malheiros, R.D.; Livingston, K.A.; Carvalho, L.V.; Ferket, P.R. Meat quality and sensory attributes of meat produced from broiler chickens fed a high oleic peanut diet. Poult. Sci. 2019, 98, 5188–5197. [Google Scholar] [CrossRef] [Scilit]
- Glitsch, K. Consumer perceptions of fresh meat quality: Cross-national comparison. Br. Food J. 2000, 102, 177–194. [Google Scholar] [CrossRef] [Scilit]
- Le Bihan-Duval, E.; Debut, M.; Berri, C.M.; Sellier, N.; Sante-Lhoutellier, V.; Jego, Y.; Beaumont, C. Chicken meat quality: Genetic variability and relationship with growth and muscle characteristics. BMC Genet. 2008, 10. [Google Scholar] [CrossRef] [Scilit]
- Zhu, H.; Qin, N.; Tyasi, T.L.; Jing, Y.; Liu, D.; Yuan, S.; Xu, R. Genetic effects of the transcription factors-sal-like 1 and spalt-like transcription factor 3 on egg production-related traits in Chinese Dagu hens. J. Exp. Zool. Part A Ecol. Integr. Physiol. 2018, 329, 23–28. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, H.H.; Mao, H.G.; Dong, X.Y.; Cao, H.Y.; Liu, K.; Yin, Z.Z. Expression of MSTN gene and its correlation with pectoralis muscle fiber traits in the domestic pigeons (Columba livia). Poult. Sci. 2019, 98, 5265–5271. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Picard, B.; Gagaoua, M. Muscle Fiber Properties in Cattle and Their Relationships with Meat Qualities: An Overview. J. Agric. Food Chem. 2020, 68, 6021–6039. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sakakibara, I.; Santolini, M.; Ferry, A.; Hakim, V.; Maire, P. Six homeoproteins and a Iinc-RNA at the fast MYH locus lock fast myofiber terminal phenotype. PLoS Genet. 2014, 10, e1004386. [Google Scholar] [CrossRef] [Scilit]
- Hernandez-Torres, F.; Rodriguez-Outeirino, L.; Franco, D.; Aranega, A.E. Pitx2 in Embryonic and Adult Myogenesis. Front. Cell Dev. Biol. 2017, 5. [Google Scholar] [CrossRef] [Scilit]
- Bentzinger, C.F.; Wang, Y.X.; Rudnicki, M.A. Building muscle: Molecular regulation of myogenesis. Cold Spring Harb. Perspect. Biol. 2012, 4. [Google Scholar] [CrossRef] [Scilit]
- Animal GeneticsAbu-Elmagd, M.; Robson, L.; Sweetman, D.; Hadley, J.; Francis-West, P.; Münsterberg, A. Wnt/Lef1 signaling acts via Pitx2 to regulate somite myogenesis. Dev. Biol. 2010, 337, 211–219. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ma, M.; Cai, B.; Jiang, L.; Abdalla, B.A.; Li, Z.; Nie, Q.; Zhang, X. lncRNA-Six1 Is a Target of miR-1611 that Functions as a ceRNA to Regulate Six1 Protein Expression and Fiber Type Switching in Chicken Myogenesis. Cells 2018, 7, 243. [Google Scholar] [CrossRef] [Scilit]
- Chang, C.N.; Singh, A.J.; Gross, M.K.; Kioussi, C. Requirement of Pitx2 for skeletal muscle homeostasis. Dev Biol 2019, 445, 90–102. [Google Scholar] [CrossRef] [Scilit]
- Laclef, C.; Hamard, G.; Demignon, J.; Souil, E.; Houbron, C.; Maire, P. Altered myogenesis in Six1-deficient mice. Development 2003, 130, 2239–2252. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wu, W.; Zuo, B.; Ren, Z.; Hapsari, A.A.; Lei, M.; Xu, D.; Li, F.; Xiong, Y. Identification of four SNPs and association analysis with meat quality traits in the porcine Pitx2c gene. Sci China Life Sci 2011, 54, 426–433. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wu, W.; Ren, Z.; Wang, Y.; Chao, Z.; Xu, D.; Xiong, Y. Molecular characterization, expression patterns and polymorphism analysis of porcine Six1 gene. Mol. Biol. Rep. 2011, 38, 2619–2632. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cao, H.; Dong, X.; Mao, H.; Xu, N.; Yin, Z. Expression Analysis of the PITX2 Gene and Associations between Its Polymorphisms and Body Size and Carcass Traits in Chickens. Animals 2019, 9, 1001. [Google Scholar] [CrossRef] [Scilit]
- Cao, H.; Dong, X.; Mao, H.; Yang, P.; Zhang, Z.; Yu, S.; Xu, N.; Yin, Z. Polymorphisms of CEBPA and Six1 Genes and Its Association with Carcass and Body Size Traits in Chickens (Gallus gallus). J. Agric. Biotechnol. 2018, 26, 457–468. [Google Scholar] [CrossRef] [Scilit]
- Sharifzadeh, S.; Clemmensen, L.H.; Borggaard, C.; Stoier, S.; Ersboll, B.K. Supervised feature selection for linear and non-linear regression of L*a*b* color from multispectral images of meat. Eng. Appl. Artif. Intell. 2014, 27, 211–227. [Google Scholar] [CrossRef] [Scilit]
- Mao, H.; Xu, X.; Liu, H.; Cao, H.; Dong, X.; Xu, N.; Zou, X.; Yin, Z. The temporal-spatial patterns, polymorphisms and association analysis with meat quality traits of FABP1 gene in domestic pigeons (Columba livia). Br. Poult. Sci. 2020, 61, 232–241. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lv, C.; Niu, S.; Yan, S.; Bai, C.; Yu, X.; Hou, J.; Gao, W.; Zhang, J.; Zhao, Z.; Yang, C.; et al. Low-density lipoprotein receptor-related protein 1 regulates muscle fiber development in cooperation with related genes to affect meat quality. Poult. Sci. 2019, 98, 3418–3425. [Google Scholar] [CrossRef] [Scilit]
- Long, L.; Wu, S.G.; Yuan, F.; Zhang, H.J.; Wang, J.; Qi, G.H. Effects of dietary octacosanol supplementation on laying performance, egg quality, serum hormone levels, and expression of genes related to the reproductive axis in laying hens. Poult Sci 2017, 96, 894–903. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Botstein, D.; White, R.L.; Skolnick, M.; Davis, R.W. Construction of a genetic linkage map in man using restriction fragment length polymorphisms. Am. J. Hum. Genet. 1980, 32, 314–331. [Google Scholar] [PubMed]
- Elmasry, G.; Barbin, D.F.; Sun, D.-W.; Allen, P. Meat Quality Evaluation by Hyperspectral Imaging Technique: An Overview. Crit. Rev. Food Sci. Nutr. 2012, 52, 689–711. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Le Bihan-Duval, E.; Berri, C.; Baeza, E.; Millet, N.; Beaumont, C. Estimation of the genetic parameters of meat characteristics and of their genetic correlations with growth and body composition in an experimental broiler line. Poult. Sci. 2001, 80, 839–843. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Le Bihan-Duval, E.; Berri, C.; Baeza, E.; Sante, V.; Astruc, T.; Remignon, H.; Le Pottier, G.; Bentley, J.; Beaumont, C.; Fernandezb, X. Genetic parameters of meat technological quality traits in a grand-parental commercial line of turkey. Genet. Sel. Evol. 2003, 35, 623–635. [Google Scholar] [CrossRef] [Scilit]
- Le Bihan-Duval, E.; Millet, N.; Remignon, H. Broiler meat quality: Effect of selection for increased carcass quality and estimates of genetic parameters. Poult. Sci. 1999, 78, 822–826. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Alnahhas, N.; Berri, C.; Boulay, M.; Baéza, E.; Jégo, Y.; Baumard, Y.; Chabault, M.; Le Bihan-Duval, E. Selecting broiler chickens for ultimate pH of breast muscle: Analysis of divergent selection experiment and phenotypic consequences on meat quality, growth, and body composition traits. J. Anim. Sci. 2014, 92, 3816–3824. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, R.; Li, R.; Zhi, L.; Xu, Y.; Lin, Y.; Chen, L. Expression profiles and associations of muscle regulatory factor (MRF) genes with growth traits in Tibetan chickens. Br. Poult. Sci. 2018, 59, 63–67. [Google Scholar] [CrossRef] [Scilit]
- Knopp, P.; Figeac, N.; Fortier, M.; Moyle, L.; Zammit, P.S. Pitx genes are redeployed in adult myogenesis where they can act to promote myogenic differentiation in muscle satellite cells. Dev. Biol. 2013, 377, 293–304. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Le Grand, F.; Grifone, R.; Mourikis, P.; Houbron, C.; Gigaud, C.; Pujol, J.; Maillet, M.; Pagès, G.; Rudnicki, M.; Tajbakhsh, S.; et al. Six1 regulates stem cell repair potential and self-renewal during skeletal muscle regeneration. J. Cell Biol. 2012, 198, 815–832. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yajima, H.; Motohashi, N.; Ono, Y.; Sato, S.; Ikeda, K.; Masuda, S.; Yada, E.; Kanesaki, H.; Miyagoe-Suzuki, Y.; Takeda, S.; et al. Six family genes control the proliferation and differentiation of muscle satellite cells. Exp. Cell Res. 2010, 316, 2932–2944. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lozano-Velasco, E.; Contreras, A.; Crist, C.; Hernández-Torres, F.; Franco, D.; Aránega, A.E. Pitx2c modulates Pax3+/Pax7+ cell populations and regulates Pax3 expression by repressing miR27 expression during myogenesis. Dev. Biol. 2011, 357, 165–178. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ridgeway, A.G.; Skerjanc, I.S. Pax3 is essential for skeletal myogenesis and the expression of Six1 and Eya2. J. Biol. Chem. 2001, 276, 19033–19039. [Google Scholar] [CrossRef] [Scilit]
- Xue, Q.; Zhang, G.; Li, T.; Ling, J.; Zhang, X.; Wang, J. Transcriptomic profile of leg muscle during early growth in chicken. PLoS ONE 2017, 12. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Le Bihan-Duval, E.; Hennequet-Antier, C.; Berri, C.; Beauclercq, S.A.; Bourin, M.C.; Boulay, M.; Demeure, O.; Boitard, S. Identification of genomic regions and candidate genes for chicken meat ultimate pH by combined detection of selection signatures and QTL. BMC Genom. 2018, 19. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yang, X.; Zhu, X.; Yan, Z.; Li, C.; Zhao, H.; Ma, L.; Zhang, D.; Liu, J.; Liu, Z.; Du, N.; et al. miR-489-3p/SIX1 Axis Regulates Melanoma Proliferation and Glycolytic Potential. Mol. Ther. Oncolytics 2020, 16, 30–40. [Google Scholar] [CrossRef] [Scilit]

| Primer 1 | Sequence (5′~3′) | Product Length (bp) |
|---|---|---|
| PITX2-1 | F: GGGCACACGCGCTCCTT | 430 |
| R: CTCGCCCTCTACAACCGAT | ||
| PITX2-2 | F: AGCGGTAACGGACAGCAAC | 717 |
| R: GCCAATGGTTTCCGTAGC | ||
| PITX2-3 | F: CAGCGTTCTTCCCTGTGGT | 1538 |
| R: CCGAAAAAGTGCGGCGTT | ||
| SIX1-1 | F: CGCAGCCTCAGCCTCAGC | 1185 |
| R: AAGGCACCGAACAAAGGC | ||
| PITX2-m | F: CGTCCTCTCGCCGATGAGTTGC | 132 |
| R: GCGGGCTGCTGGTGATGG | ||
| SIX1-m | F: AGGGAGAACACGGAGAACAAC | 112 |
| R: GCGGGGGTGAAAATTCTTCCT | ||
| β-actin-m | F: ACGTCGCACTGGATTTCGAG | 282 |
| R: TGTCAGCAATGCCAGGGTAC |
| Gene | SNPs 1 | Genotypic Frequency | Allelic Frequency | p-Value 2 | PIC3 | He4 | Ne5 | |||
|---|---|---|---|---|---|---|---|---|---|---|
| PITX2 | CC | CT | TT | C | T | |||||
| g.9830C > T | 0.65 (265) | 0.31 (127) | 0.04 (16) | 0.81 (657) | 0.19 (159) | 0.872 | 0.265 | 0.314 | 1.457 | |
| g.10073C > T | 0.58 (237) | 0.38 (153) | 0.04 (18) | 0.77 (627) | 0.23 (189) | 0.279 | 0.293 | 0.356 | 1.553 | |
| g.12713C > T | 0.86 (352) | 0.13 (52) | 0.01 (4) | 0.93 (756) | 0.07 (60) | 0.192 | 0.127 | 0.136 | 1.158 | |
| g.12755C > T | 0.90 (366) | 0.09 (36) | 0.01 (6) | 0.94 (768) | 0.06 (48) | 0.000 | 0.105 | 0.111 | 1.125 | |
| GG | GA | AA | G | A | ||||||
| g.12938G > A | 0.94 (385) | 0.05 (22) | 0.00 (1) | 0.97 (792) | 0.03 (24) | 0.262 | 0.055 | 0.057 | 1.061 | |
| CC | CT | TT | C | T | ||||||
| g.12961C > T | 0.82 (336) | 0.16 (67) | 0.01 (5) | 0.91 (739) | 0.09 (77) | 0.428 | 0.156 | 0.171 | 1.206 | |
| GG | GA | AA | G | A | ||||||
| g.13019G > A | 0.88 (357) | 0.12 (47) | 0.01 (4) | 0.93 (761) | 0.07 (55) | 0.091 | 0.118 | 0.126 | 1.144 | |
| g.13079G > A | 0.96 (393) | 0.04 (15) | 0.00 (0) | 0.98 (801) | 0.02 (15) | 0.705 | 0.035 | 0.036 | 1.037 | |
| g.13285G > A | 0.84 (342) | 0.15 (61) | 0.01 (5) | 0.91 (745) | 0.09 (71) | 0.234 | 0.146 | 0.159 | 1.189 | |
| g.13335G > A | 0.50 (203) | 0.32 (129) | 0.19 (76) | 0.66 (535) | 0.34 (281) | 0.000 | 0.350 | 0.452 | 1.823 | |
| AA | AG | GG | A | G | ||||||
| g.13726A > G | 0.37 (151) | 0.47 (192) | 0.16 (65) | 0.61 (494) | 0.39 (322) | 0.761 | 0.364 | 0.478 | 1.915 | |
| CC | CT | TT | C | T | ||||||
| g.13856C > T | 0.99 (406) | 0.00 (2) | 0.00 (0) | 1.00 (814) | 0.00 (2) | 0.960 | 0.005 | 0.005 | 1.005 | |
| SIX1 | GG | GA | AA | G | A | |||||
| g.564G > A | 0.73 (299) | 0.23 (94) | 0.04 (15) | 0.85 (692) | 0.15 (124) | 0.032 | 0.225 | 0.258 | 1.347 | |
| Gene | SNPs | Genotypes | L* | a* | b* | SF (N) | EC (mS/cm) | pH | DL (%) |
|---|---|---|---|---|---|---|---|---|---|
| PITX2 | g.9830C > T | CC (265) | 44.95 ± 0.35 b | 5.28 ± 0.14 | 9.17 ± 0.21 | 29.20 ± 0.73 ab | 4.71 ± 0.27 A | 5.97 ± 0.07 B | 3.13 ± 0.12 A |
| CT (127) | 46.51 ± 0.50 a | 5.37 ± 0.16 | 9.55 ± 0.24 | 31.24 ± 1.04 a | 3.04 ± 0.23 B | 6.48 ± 0.05 A | 2.20 ± 0.16 B | ||
| TT (16) | 44.47 ± 1.70 ab | 4.38 ± 0.45 | 9.13 ± 0.89 | 22.82 ± 2.48 b | 4.57 ± 0.47 AB | 5.38 ± 0.38 B | 3.56 ± 0.44 A | ||
| g.10073C > T | CC (237) | 45.02 ± 0.37 B | 5.32 ± 0.15 | 9.23 ± 0.22 | 29.14 ± 0.78 | 4.59 ± 0.27 | 5.97 ± 0.07 B | 3.23 ± 0.13 A | |
| CT (153) | 45.70 ± 0.44 AB | 5.28 ± 0.15 | 9.35 ± 0.22 | 30.10 ± 0.89 | 3.79 ± 0.39 | 6.31 ± 0.07 A | 2.41 ± 0.14 B | ||
| TT (18) | 48.79 ± 1.23 A | 5.31 ± 0.32 | 9.82 ± 0.65 | 29.28 ± 2.83 | 4.65 ± 0.71 | 6.27 ± 0.20 AB | 2.44 ± 0.30 AB | ||
| g.13335G > A | GG (203) | 45.71 ± 0.39 | 5.37 ± 0.14 | 9.41 ± 0.21 | 30.66 ± 0.84 | 4.45 ± 0.35 | 6.17 ± 0.07 | 2.81 ± 0.13 B | |
| GA (129) | 44.64 ± 0.49 | 5.27 ± 0.20 | 9.37 ± 0.31 | 28.18 ± 1.01 | 3.98 ± 0.26 | 5.99 ± 0.09 | 3.27 ± 0.18 A | ||
| AA (76) | 45.91 ± 0.72 | 5.33 ± 0.25 | 9.22 ± 0.38 | 28.89 ± 1.42 | 5.40 ± 0.74 | 6.15 ± 0.12 | 2.47 ± 0.18 B | ||
| g.13726A > G | AA (151) | 45.78 ± 0.51 | 5.64 ± 0.21 a | 9.76 ± 0.29 | 29.43 ± 1.02 | 4.57 ± 0.43 AB | 6.15 ± 0.08 | 2.84 ± 0.17 | |
| AG (192) | 44.90 ± 0.39 | 5.02 ± 0.14 b | 9.01 ± 0.22 | 29.67 ± 0.86 | 3.70 ± 0.18 B | 6.11 ± 0.07 | 2.94 ± 0.14 | ||
| GG (65) | 46.02 ± 0.68 | 5.46 ± 0.26 ab | 9.54 ± 0.42 | 29.22 ± 1.38 | 5.70 ± 0.22 A | 5.92 ± 0.14 | 3.04 ± 0.23 | ||
| SIX1 | g.564G > A | GG (299) | 45.79 ± 0.33 | 5.44 ± 0.12 | 9.44 ± 0.18 | 29.85 ± 0.67 a | 4.31 ± 0.25 | 6.21 ± 0.05 a | 2.82 ± 0.11 |
| GA (94) | 45.28 ± 0.56 | 5.17 ± 0.20 | 9.45 ± 0.35 | 29.23 ± 1.15 ab | 4.59 ± 0.50 | 5.94 ± 0.11 b | 2.90 ± 0.18 | ||
| AA (15) | 43.05 ± 1.10 | 4.72 ± 0.63 | 7.89 ± 0.70 | 22.63 ± 2.31 b | 4.22 ± 0.72 | 5.59 ± 0.35 b | 3.28 ± 0.39 |
| Traits | L* | a* | b* | SF | EC | pH | DL |
|---|---|---|---|---|---|---|---|
| L* | 1 | ||||||
| a* | 0.43 ** | 1 | |||||
| b* | 0.54 ** | 0.76 ** | 1 | ||||
| SF | 0.03 | 0.13 ** | 0.05 | 1 | |||
| EC | 0.07 | 0.01 | −0.10 | −0.22 ** | 1 | ||
| pH | 0.22 ** | 0.16 ** | 0.13 ** | 0.39 ** | −0.38 ** | 1 | |
| DL | −0.24 ** | −0.02 | −0.03 | −0.10 * | 0.07 | −0.35 ** | 1 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Cao, H.; Zhou, W.; Tan, Y.; Xu, X.; Mao, H.; Dong, X.; Xu, N.; Yin, Z. Chronological Expression of PITX2 and SIX1 Genes and the Association between Their Polymorphisms and Chicken Meat Quality Traits. Animals 2021, 11, 445. https://doi.org/10.3390/ani11020445
Cao H, Zhou W, Tan Y, Xu X, Mao H, Dong X, Xu N, Yin Z. Chronological Expression of PITX2 and SIX1 Genes and the Association between Their Polymorphisms and Chicken Meat Quality Traits. Animals. 2021; 11(2):445. https://doi.org/10.3390/ani11020445
Chicago/Turabian StyleCao, Haiyue, Wei Zhou, Yuge Tan, Xiuli Xu, Haiguang Mao, Xinyang Dong, Ningying Xu, and Zhaozheng Yin. 2021. "Chronological Expression of PITX2 and SIX1 Genes and the Association between Their Polymorphisms and Chicken Meat Quality Traits" Animals 11, no. 2: 445. https://doi.org/10.3390/ani11020445
APA StyleCao, H., Zhou, W., Tan, Y., Xu, X., Mao, H., Dong, X., Xu, N., & Yin, Z. (2021). Chronological Expression of PITX2 and SIX1 Genes and the Association between Their Polymorphisms and Chicken Meat Quality Traits. Animals, 11(2), 445. https://doi.org/10.3390/ani11020445
