Effects of Dietary Zearalenone Exposure on the Growth Performance, Small Intestine Disaccharidase, and Antioxidant Activities of Weaned Gilts
Abstract
Simple Summary
Abstract
1. Background
2. Materials and Methods
2.1. ZEA-Contaminated Diet and Mycotoxin Determination
2.2. Experimental Design, Animals, and Management
2.3. Growth Performance Determination
2.4. Small Intestine Sample Collection
2.5. Disaccharidase Activity
2.6. Antioxidant Activity and Malondialdehyde Content
2.7. Immunohistochemistry
2.8. Integrated Optical Density Measurement
2.9. Total RNA Extraction, cDNA Preparation, and Quantitative Real-Time Reverse Transcription-Polymerase Chain Reaction (qRT-PCR)
2.10. Western Blotting
2.11. Statistical Analysis
3. Results
3.1. Growth Performance
3.2. Disaccharidase Activity
3.3. Antioxidant Activity and MDA Content
3.4. Localization of Hsp70
3.5. Expression of Hsp70 at the mRNA and Protein Level
3.6. Discussion
3.7. Growth Performance
3.8. Disaccharidase Activity
3.9. Anti-Stress Ability
3.10. Hsp70 Expression
4. Conclusions
Author Contributions
Funding
Conflicts of Interest
Availability of Data and Material
References
- Liu, J.; Sun, L.; Zhang, J.; Guo, J.; Chen, L.; Qi, D.; Zhang, N. Aflatoxin B1, zearalenone and deoxynivalenol in feed ingredients and complete feed from central China. Food Addit. Contam. Part B 2016, 9, 91–97. [Google Scholar] [CrossRef]
- Hussein, H.S.; Brasel, J.M. Toxicity, metabolism, and impact of mycotoxins on humans and animals. Toxicology 2001, 167, 101–134. [Google Scholar] [CrossRef]
- Jiang, S.Z.; Yang, Z.B.; Yang, W.R.; Gao, J.; Liu, F.X.; Broomhead, J.; Chi, F. Effects of purified zearalenone on growth performance, organ size, serum metabolites, and oxidative stress in postweaning gilts1. J. Anim. Sci. 2011, 89, 3008–3015. [Google Scholar] [CrossRef]
- Dai, M.; Jiang, S.; Yuan, X.; Yang, W.; Yang, Z.; Huang, L. Effects of zearalenone-diet on expression of ghrelin and PCNA genes in ovaries of post-weaning piglets. Anim. Reprod. Sci. 2016, 168, 126–137. [Google Scholar] [CrossRef]
- Jiang, S.Z.; Yang, Z.B.; Yang, W.R.; Wang, S.J.; Wang, Y.; Broomhead, J.; Johnston, S.L.; Chi, F. Effect on hepatonephric organs, serum metabolites and oxidative stress in post-weaning piglets fed purified zearalenone-contaminated diets with or without Calibrin-Z. J. Anim. Physiol. Anim. Nutr. 2011, 96, 1147–1156. [Google Scholar] [CrossRef]
- Merrill, A.H., Jr.; Schmelz, E.-M.; Dillehay, D.L.; Spiegel, S.; Shayman, J.A.; Schroeder, J.J.; Riley, R.T.; Voss, K.A.; Wang, E. Sphingolipids—The Enigmatic Lipid Class: Biochemistry, Physiology, and Pathophysiology. Toxicol. Appl. Pharmacol. 1997, 142, 208–225. [Google Scholar] [CrossRef]
- Marin, D.E.; Taranu, I.; Burlacu, R.; Manda, G.; Motiu, M.; Neagoe, I.; Dragomir, C.; Stancu, M.; Calin, L. Effects of zearalenone and its derivatives on porcine immune response. Toxicol. Vitr. 2011, 25, 1981–1988. [Google Scholar] [CrossRef]
- Lahjouji, T.; Bertaccini, A.; Neves, M.; Puel, S.; Oswald, I.; Soler, L. Acute Exposure to Zearalenone Disturbs Intestinal Homeostasis by Modulating the Wnt/β-Catenin Signaling Pathway. Toxins 2020, 12, 113. [Google Scholar] [CrossRef]
- Wan, L.Y.M.; Turner, P.C.; El-Nezami, H. Individual and combined cytotoxic effects of Fusarium toxins (deoxynivalenol, nivalenol, zearalenone and fumonisins B1) on swine jejunal epithelial cells. Food Chem. Toxicol. 2013, 57, 276–283. [Google Scholar] [CrossRef]
- Yao, X.; Jiang, H.; Gao, Q.; Li, Y.-H.; Xu, Y.N.; Kim, N.-H. Melatonin alleviates defects induced by zearalenone during porcine embryo development. Theriogenology 2020, 151, 66–73. [Google Scholar] [CrossRef]
- Kouadio, J.H.; Mobio, T.A.; Baudrimont, I.; Moukha, S.; Dano, S.D.; Creppy, E.E. Comparative study of cytotoxicity and oxidative stress induced by deoxynivalenol, zearalenone or fumonisin B1 in human intestinal cell line Caco-2. Toxicology 2005, 213, 56–65. [Google Scholar] [CrossRef] [PubMed]
- Lindquist, S.; Craig, E.A. The Heat-Shock Proteins. Annu. Rev. Genet. 1988, 22, 631–677. [Google Scholar] [CrossRef]
- Lee, H.; Kang, C.; Yoo, Y.-S.; Hah, D.-Y.; Kim, C.H.; Kim, E.; Kim, J.S. Cytotoxicity and the induction of the stress protein Hsp 70 in Chang liver cells in response to zearalenone-induced oxidative stress. Environ. Toxicol. Pharmacol. 2013, 36, 732–740. [Google Scholar] [CrossRef]
- McComb, M.A.; Spurlock, M.E. Expression of stress proteins in porcine tissues: Developmental changes and effect of immunological challenge. J. Anim. Sci. 1997, 75, 195–201. [Google Scholar] [CrossRef]
- European Commission. Commission recommendation of 17 August 2006: On the presence of deoxynivalenol, zearalenone, ochratoxin A, T-2 and HT-2 and fumonisin in products intended for animal feeding. Off. J. Eur. Union 2006, 229, 7–9. [Google Scholar]
- National Standards of the People’s Republic of China. Hygienic Standard of Feed; Chinese Standard Press: Beijing, China, 2017; p. 4. Available online: http://www.csres.com/detail/304795.html (accessed on 18 November 2020).
- Zhou, M.; Yang, L.J.; Yang, W.R.; Huang, L.B.; Zhou, X.M.; Jiang, S.; Bin Yang, Z. Effects of zearalenone on the localization and expression of the growth hormone receptor gene in the uteri of post-weaning piglets. Asian Australas. J. Anim. Sci. 2018, 31, 32–39. [Google Scholar] [CrossRef]
- Chen, X.X.; Yang, C.W.; Huang, L.B.; Niu, Q.S.; Jiang, S.Z.; Chi, F. Zearalenone Altered the Serum Hormones, Morphologic and Apoptotic Measurements of Genital Organs in Post-weaning Gilts. Asian Australas. J. Anim. Sci. 2015, 28, 171–179. [Google Scholar] [CrossRef]
- Cheng, Q.; Jiang, S.; Huang, L.; Ge, J.; Wang, Y.; Yang, W. Zearalenone induced oxidative stress in the jejunum in postweaning gilts through modulation of the Keap1–Nrf2 signaling pathway and relevant genes1. J. Anim. Sci. 2019, 97, 1722–1733. [Google Scholar] [CrossRef]
- Zhou, M.; Yang, L.; Chen, Y.; Sun, T.; Wang, N.; Chen, X.; Yang, Z.; Ge, J.; Jiang, S. Comparative study of stress response, growth and development of uteri in post-weaning gilts challenged with zearalenone and estradiol benzoate. J. Anim. Physiol. Anim. Nutr. 2019, 103, 1885–1894. [Google Scholar] [CrossRef]
- Góth, L. A simple method for determination of serum catalase activity and revision of reference range. Clin. Chim. Acta 1991, 196, 143–151. [Google Scholar] [CrossRef]
- Maral, J.; Puget, K.; Michelson, A. Comparative study of superoxide dismutase, catalase and glutathione peroxidase levels in erythrocytes of different animals. Biochem. Biophys. Res. Commun. 1977, 77, 1525–1535. [Google Scholar] [CrossRef]
- Ōyanagui, Y. Reevaluation of assay methods and establishment of kit for superoxide dismutase activity. Anal. Biochem. 1984, 142, 290–296. [Google Scholar] [CrossRef]
- Placer, Z.A.; Cushman, L.L.; Johnson, B. Estimation of product of lipid peroxidation (malonyl dialdehyde) in biochemical systems. Anal. Biochem. 1966, 16, 359–364. [Google Scholar] [CrossRef]
- Rivera, A.; Agnati, L.; Horvath, T.; Valderrama, J.; De La Calle, A.; Fuxe, K. Uncoupling protein 2/3 immunoreactivity and the ascending dopaminergic and noradrenergic neuronal systems: Relevance for volume transmission. Neuroscience 2006, 137, 1447–1461. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Tiemann, U.; Dänicke, S. In vivoandin vitroeffects of the mycotoxins zearalenone and deoxynivalenol on different non-reproductive and reproductive organs in female pigs: A review. Food Addit. Contam. 2007, 24, 306–314. [Google Scholar] [CrossRef]
- Placinta, C.; D’Mello, J.; Macdonald, A. A review of worldwide contamination of cereal grains and animal feed with Fusarium mycotoxins. Anim. Feed. Sci. Technol. 1999, 78, 21–37. [Google Scholar] [CrossRef]
- Döll, S.; Dänicke, S. The Fusarium toxins deoxynivalenol (DON) and zearalenone (ZON) in animal feeding. Prev. Vet. Med. 2011, 102, 132–145. [Google Scholar] [CrossRef]
- Weaver, A.C.; See, M.T.; Hansen, J.A.; Kim, Y.B.; De Souza, A.L.P.; Middleton, T.F.; Kim, S.W. The Use of Feed Additives to Reduce the Effects of Aflatoxin and Deoxynivalenol on Pig Growth, Organ Health and Immune Status during Chronic Exposure. Toxins 2013, 5, 1261–1281. [Google Scholar] [CrossRef]
- Young, L.G.; King, G.J.; McGirr, L.; Sutton, J.C. Moldy Corn in Diets of Gestating and Lactating Swine. J. Anim. Sci. 1982, 54, 976–982. [Google Scholar] [CrossRef]
- Powell-Jones, W.; Raeford, S.; Lucier, G.W. Binding properties of zearalenone mycotoxins to hepatic estrogen receptors. Mol. Pharmacol. 1981, 20, 35–42. [Google Scholar] [PubMed]
- Oliver, W.; Miles, J.; Diaz, D.; Dibner, J.; Rottinghaus, G.; Harrell, R. Zearalenone enhances reproductive tract development, but does not alter skeletal muscle signaling in prepubertal gilts. Anim. Feed. Sci. Technol. 2012, 174, 79–85. [Google Scholar] [CrossRef]
- Jia, Z.; Liu, M.; Qu, Z.; Zhang, Y.; Yin, S.; Shan, A. Toxic effects of zearalenone on oxidative stress, inflammatory cytokines, biochemical and pathological changes induced by this toxin in the kidney of pregnant rats. Environ. Toxicol. Pharmacol. 2014, 37, 580–591. [Google Scholar] [CrossRef] [PubMed]
- Swamy, H.V.L.N.; Smith, T.K.; Macdonald, E.J.; Boermans, H.J.; Squires, E.J. Effects of feeding a blend of grains naturally contaminated with Fusarium mycotoxins on swine performance, brain regional neurochemistry, and serum chemistry and the efficacy of a polymeric glucomannan mycotoxin adsorbent1. J. Anim. Sci. 2002, 80, 3257–3267. [Google Scholar] [CrossRef]
- Awad, W.A.; Aschenbach, J.R.; Zentek, J. Cytotoxicity and metabolic stress induced by deoxynivalenol in the porcine intestinal IPEC-J2 cell line. J. Anim. Physiol. Anim. Nutr. 2011, 96, 709–716. [Google Scholar] [CrossRef]
- Zhang, C.; Meng, R.; Deng, J.L.; Ren, Z.H.; Deng, H.D.; Deng, Y.T.; Zuo, Z.C.; Wang, Y.; Peng, X.; Cui, H.M.; et al. Individual and combined effects of zearalenone and deoxynivaleno on jejunum digestive enzymes in mice. Chin. J. Vet. Sci. 2015, 35, 112–115. [Google Scholar] [CrossRef]
- Karaman, E.F.; Zeybel, M.; Ozden, S. Evaluation of the epigenetic alterations and gene expression levels of HepG2 cells exposed to zearalenone and α-zearalenol. Toxicol. Lett. 2020, 326, 52–60. [Google Scholar] [CrossRef]
- Sies, H. Oxidative stress: From basic research to clinical application. Am. J. Med. 1991, 91, S31–S38. [Google Scholar] [CrossRef]
- Wang, Y.-L.; Zhou, X.-Q.; Jiang, W.-D.; Wu, P.; Liu, Y.; Jiang, J.; Wang, S.-W.; Kuang, S.-Y.; Tang, L.; Feng, L. Effects of Dietary Zearalenone on Oxidative Stress, Cell Apoptosis, and Tight Junction in the Intestine of Juvenile Grass Carp (Ctenopharyngodon idella). Toxins 2019, 11, 333. [Google Scholar] [CrossRef]
- Ieko, T.; Inoue, S.; Inomata, Y.; Inoue, H.; Fujiki, J.; Iwano, H. Glucuronidation as a metabolic barrier against zearalenone in rat everted intestine. J. Vet. Med. Sci. 2020, 82, 153–161. [Google Scholar] [CrossRef]
- Taranu, I.; Braicu, C.; Marin, D.E.; Pistol, G.C.; Motiu, M.; Balacescu, L.; Neagoe, I.B.; Burlacu, R. Exposure to zearalenone mycotoxin alters in vitro porcine intestinal epithelial cells by differential gene expression. Toxicol. Lett. 2015, 232, 310–325. [Google Scholar] [CrossRef] [PubMed]
- Tatay, E.; Font, G.; Ruiz, M.-J. Cytotoxic effects of zearalenone and its metabolites and antioxidant cell defense in CHO-K1 cells. Food Chem. Toxicol. 2016, 96, 43–49. [Google Scholar] [CrossRef] [PubMed]
- Shen, T.; Miao, Y.; Ding, C.; Fan, W.; Liu, S.; Lv, Y.; Gao, X.; De Boevre, M.; Yan, L.; Okoth, S.; et al. Activation of the p38/MAPK pathway regulates autophagy in response to the CYPOR-dependent oxidative stress induced by zearalenone in porcine intestinal epithelial cells. Food Chem. Toxicol. 2019, 131, 110527. [Google Scholar] [CrossRef] [PubMed]
- Soler, L.; Stella, A.; Seva, J.; Pallarés, F.J.; Lahjouji, T.; Burlet-Schiltz, O.; Oswald, I.P. Proteome changes induced by a short, non-cytotoxic exposure to the mycoestrogen zearalenone in the pig intestine. J. Proteom. 2020, 224, 103842. [Google Scholar] [CrossRef]
- Sabirzhanov, B.; Stoica, B.A.; Hanscom, M.; Piao, C.-S.; Faden, A.I. Over-expression of HSP70 attenuates caspase-dependent and caspase-independent pathways and inhibits neuronal apoptosis. J. Neurochem. 2012, 123, 542–554. [Google Scholar] [CrossRef]
- Zhu, L.; Yuan, H.; Guo, C.; Lu, Y.; Deng, S.; Yang, Y.; Wei, Q.; Wen, L.; He, Z. Zearalenone induces apoptosis and necrosis in porcine granulosa cells via a caspase-3- and caspase-9-dependent mitochondrial signaling pathway. J. Cell. Physiol. 2012, 227, 1814–1820. [Google Scholar] [CrossRef]
- Kukreja, R.C.; Kontos, M.C.; Loesser, K.E.; Batra, S.K.; Qian, Y.Z.; Gbur, C.J.; Naseem, S.A.; Jesse, R.L.; Hess, M.L. Oxidant stress increases heat shock protein 70 mRNA in isolated perfused rat heart. Am. J. Physiol. Circ. Physiol. 1994, 267, H2213–H2219. [Google Scholar] [CrossRef]
Ingredients (%) | Content | Nutrients (%) | Analyzed Values |
---|---|---|---|
Corn | 53.00 | Metabolizable energy, MJ/kg | 13.22 |
Sodium chloride | 0.20 | Tryptophan | 0.25 |
Limestone, Pulverized | 0.30 | Threonine | 0.90 |
Calcium phosphate | 0.80 | Sulfur amino acid | 0.79 |
L-threonine | 0.04 | Methionine | 0.46 |
DL-methionine | 0.10 | Lysine | 1.36 |
L-Lysine HCl | 0.30 | Total phosphorus | 0.73 |
Fish meal | 5.50 | Calcium | 0.84 |
Soybean meal | 24.76 | Crude protein | 19.40 |
Soybean oil | 2.50 | ||
Whey powder | 6.50 | ||
Wheat middling | 5.00 | ||
Premix 1 | 1.00 |
Target Gene | Primer Sequence (5′ to 3′) | Product Size | Accession No. |
---|---|---|---|
GADPH | F: ATGGTGAAGGTCGGAGTGAA | 154 | NM_001206359.1 |
R: CGTGGGTGGAATCATACTGG | |||
HSP70 | F: GAGGTGGAGAGGATGGTT | 292 | NM_001123127.1 |
R: AGAGCCTGGAGAAGATGG |
Items | Control | ZEA |
---|---|---|
ADFI (g/d) | 1070.39 ± 27.34 | 1007.07 ± 33.12 |
ADG (g/d) | 548.78 ± 13.09 | 514.89 ± 20.78 |
FE | 0.51 ± 0.02 | 0.51 ± 0.01 |
Items (U/mg Protein) | Control | ZEA |
---|---|---|
Lactase | ||
Ileum | 44.36 ± 1.55 a | 37.63 ± 1.90 b |
Jejunum | 104.15 ± 12.87 a | 87.63 ± 14.03 b |
Duodenum | 20.74 ± 0.897a | 14.68 ± 0.65 b |
Sucrase | ||
Ileum | 3.65 ± 5.55 a | 37.57 ± 4.09 b |
Jejunum | 65.33 ± 2.99 a | 54.81 ± 5.18 b |
Duodenum | 15.66 ± 1.43 a | 5.33 ± 0.51 b |
Maltase | ||
Ileum | 62.57 ± 3.17 a | 52.70 ± 2.98 b |
Jejunum | 159.88 ± 18.67 a | 116.20 ± 9.06 b |
Duodenum | 63.33 ± 1.21 a | 52.50 ± 5.2 b |
Item | Control | ZEA |
---|---|---|
CAT (U/mg protein) | ||
Ileum | 4.52 ± 0.14 a | 1.52 ± 0.13 b |
ejunum | 7.35 ± 0.90 a | 3.95 ± 0.11 b |
Duodenum | 28.68 ± 3.43 | 28.64 ± 2.19 |
SOD (U/mg protein) | ||
Ileum | 43.24 ± 6.11 a | 36.01 ± 2.04 b |
Jejunum | 76.57 ± 8.83 a | 42.95 ± 7.05 b |
Duodenum | 152.24 ± 13.78 a | 125.08 ± 14.76 b |
GSH-Px (U/mg protein) | ||
Ileum | 149.84 ± 15.44 a | 134.56 ± 13.70 b |
Jejunum | 57.76 ± 3.98 a | 28.88 ± 5.12 b |
Duodenum | 67.65 ± 9.02 a | 44.69 ± 8.45 b |
MDA (nmol/mg protein) | ||
Ileum | 0.85 ± 0.07 b | 1.57 ± 0.23 a |
Jejunum | 0.61 ± 0.02 b | 1.53 ± 0.11 a |
Duodenum | 1.06 ± 0.06 b | 2.11 ± 0.02 a |
Item | Control | ZEA |
---|---|---|
IOD in 10 × 10 visual field | ||
Duodenum | 75.83 ± 12.44 b | 82.35 ± 16.14 a |
Jejunum | 78.22 ± 9.78 b | 94.65 ± 10.23 a |
Ileum | 77.17 ± 15.61 b | 93.57 ± 11.09 a |
SIOD in 10 × 40 visual field | ||
Duodenum | 63.988 ± 5.11 b | 76.17 ± 7.93 a |
Jejunum | 68.908 ± 10.32 b | 78.56 ± 8.17 a |
Ileum | 65.929 ± 8.52 b | 74.44 ± 11.16 a |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Liu, X.; Xu, C.; Yang, Z.; Yang, W.; Huang, L.; Wang, S.; Liu, F.; Liu, M.; Wang, Y.; Jiang, S. Effects of Dietary Zearalenone Exposure on the Growth Performance, Small Intestine Disaccharidase, and Antioxidant Activities of Weaned Gilts. Animals 2020, 10, 2157. https://doi.org/10.3390/ani10112157
Liu X, Xu C, Yang Z, Yang W, Huang L, Wang S, Liu F, Liu M, Wang Y, Jiang S. Effects of Dietary Zearalenone Exposure on the Growth Performance, Small Intestine Disaccharidase, and Antioxidant Activities of Weaned Gilts. Animals. 2020; 10(11):2157. https://doi.org/10.3390/ani10112157
Chicago/Turabian StyleLiu, Xinglin, Chang Xu, Zaibin Yang, Weiren Yang, Libo Huang, Shujing Wang, Faxiao Liu, Mei Liu, Yuxi Wang, and Shuzhen Jiang. 2020. "Effects of Dietary Zearalenone Exposure on the Growth Performance, Small Intestine Disaccharidase, and Antioxidant Activities of Weaned Gilts" Animals 10, no. 11: 2157. https://doi.org/10.3390/ani10112157
APA StyleLiu, X., Xu, C., Yang, Z., Yang, W., Huang, L., Wang, S., Liu, F., Liu, M., Wang, Y., & Jiang, S. (2020). Effects of Dietary Zearalenone Exposure on the Growth Performance, Small Intestine Disaccharidase, and Antioxidant Activities of Weaned Gilts. Animals, 10(11), 2157. https://doi.org/10.3390/ani10112157