Effect of Heat Stress on Dairy Cow Performance and on Expression of Protein Metabolism Genes in Mammary Cells
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals, Treatments and Sampling
2.2. Milk Composition and Protein Fractions
2.3. Milk Somatic Cell Isolation
2.4. RNA Analysis
2.5. Immunodetection of Bcl2 and Hsp70 in Somatic Cells
2.6. Statistical Analysis
3. Results and Discussion
4. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Hempel, S.; Menz, C.; Pinto, S.; Galán, E.; Janke, D.; Estellés, F.; Müschner-Siemens, T.; Wang, X.; Heinicke, J.; Zhang, G.; et al. Heat stress risk in European dairy cattle husbandry under different climate change scenarios—Uncertainties and potential impacts. Earth Syst. Dynam. 2019, 10, 859–884. [Google Scholar] [CrossRef] [Scilit]
- European Environmental Agency. Global and European Temperature. Available online: https://www.eea.europa.eu/data-and-maps/indicators/global-and-european-temperature-9/assessment (accessed on 26 August 2020).
- Yousef, M.K.; Johnson, H.D. Endocrine system and thermal environment. In Stress Physiology in Livestock; Yousef, M.K., Ed.; CRC Press: Boca Raton, FL, USA, 1985; pp. 133–142. [Google Scholar]
- Armstrong, D.V. Heat stress interaction with shade and cooling. J. Dairy Sci. 1994, 77, 2044–2050. [Google Scholar] [CrossRef] [Scilit]
- Collier, R.J.; Laun, W.H.; Rungruang, S.; Zimbleman, R.B. Quantifying Heat Stress and Its Impact on Metabolism and Performance, Proceedings of the Florida Ruminant Nutrition Symposium, Gainesville, FL, USA, 31 January–1 February 2012; University of Florida: Gainesville, FL, USA, 2012; pp. 74–83. [Google Scholar]
- Wedholm, A.; Larsen, L.B.; Lindmark-Månsson, H.; Karlsson, A.H.; Andrén, A. Effect of protein composition on the cheese-making properties of milk from individual dairy cows. J. Dairy Sci. 2006, 89, 3296–3305. [Google Scholar] [CrossRef] [Scilit]
- Bernabucci, U.; Barisicò, L.; Morera, P.; Dipasquale, D.; Vitali, A.; Piccioli Cappelli, F.; Calamari, L. Effect of summer season on milk protein fractions in Holstein cows. J. Dairy Sci. 2015, 98, 1815–1827. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cowley, F.C.; Barber, D.G.; Houlihan, A.V.; Poppi, D.P. Immediate and residual effects of heat stress and restricted intake on milk protein and casein composition and energy metabolism. J. Dairy Sci. 2015, 98, 2356–2368. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bernabucci, U.; Biffani, S.; Buggioni, L.; Vitali, A.; Lacetera, N.; Nardone, A. The effects of heat stress in Italian Holstein dairy cattle. J. Dairy Sci. 2014, 97, 471–786. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Das, R.; Sailo, L.; Verma, N.; Bharti, P.; Saikia, J.; Imtiwati, I.; Kumar, R. Impact of heat stress on health and performance of dairy animals: A review. Vet. World 2016, 9, 260–268. [Google Scholar] [CrossRef] [Scilit]
- West, J.W. Effects of heat-stress on production in dairy cattle. J. Dairy Sci. 2003, 86, 2131–2144. [Google Scholar] [CrossRef] [Scilit]
- Dado-Senn, B.; Skibiel, A.L.; Fabris, T.F.; Zhang, Y.; Dahl, G.E.; Peñagaricano, F.; Laporta, J. RNA-Seq reveals novel genes and pathways involved in bovine mammary involution during the dry period and under environmental heat stress. Sci. Rep. 2018, 8, 11096. [Google Scholar] [CrossRef] [Scilit]
- Gao, S.T.; Ma, L.; Zhou, Z.; Zhou, Z.K.; Baumgard, L.H.; Jiang, D.; Bionaz, M.; Bu, D.P. Heat stress negatively affects the transcriptome related to overall metabolism and milk protein synthesis in mammary tissue of mid-lactating dairy cows. Physiol. Genom. 2019, 51, 400–409. [Google Scholar] [CrossRef] [Scilit]
- Hu, H.; Zhang, Y.; Zheng, N.; Cheng, J.; Wang, J. The effect of heat stress on gene expression and synthesis of heat-shock and milk proteins in bovine mammary epithelial cells. Anim. Sci. J. 2016, 87, 84–91. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kapila, N.; Sharma, A.; Kishore, A.; Sodhi, M.; Tripathi, P.K.; Mohanty, A.K.; Mukesh, M. Impact of heat stress on cellular and transcriptional adaptation of mammary epithelial cells in riverine buffalo (Bubalus Bubalis). PLoS ONE 2016, 11, e0157237. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cánovas, A.; Rincón, G.; Bevilacqua, C.; Islas-Trejo, A.; Brenaut, P.; Hovey, R.C.; Boutinaud, M.; Morgenthaler, C.; Van Klompenberg, M.K.; Martin, P.; et al. Comparison of five different RNA sources to examine the lactating bovine mammary gland transcriptome using RNA-Sequencing. Sci. Rep. 2015, 4, 5297. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Salama, A.A.K.; Caja, G.; Hamzaoui, S.; Badaoui, B.; Castro-Costa, A.; Façanha, D.E.; Guilhermino, M.M.; Bozzi, R. Different levels of response to heat stress in dairy goats. Small Rumin. Res. 2014, 121, 73–79. [Google Scholar] [CrossRef] [Scilit]
- Bradley, A.; Green, M. Use and interpretation of somatic cell count data in dairy cows. Practice 2005, 27, 310–315. [Google Scholar] [CrossRef] [Scilit]
- Dohoo, I.R.; Leslie, K.E. Evaluation of changes in somatic cell counts as indicators of new intramammary infections. Prev. Vet. Med. 1991, 10, 225–238. [Google Scholar] [CrossRef] [Scilit]
- Agabriel, J. Alimentation de Bovins, Ovins et Caprins; Quae: Versailles, France, 2010. [Google Scholar]
- AOAC International. Official Methods of Analysis; AOAC International: Arlington, VA, USA, 2016.
- Goering, H.K.; Van Soest, P.J. Forage Fiber Analyses (Apparatus, Reagents, Procedures, and Some Applications). In Agricultural Handbook No.379; USDA Agricultural Research Service: Washington, DC, USA, 1970; pp. 387–598. [Google Scholar]
- Gaines, W.L. The Energy Basis of Measuring Milk Yield in Dairy Cows. Bulletin No. 308; Univeristy of Illinois: Urbana, IL, USA, 1928. [Google Scholar]
- ISO. Milk and Liquid Milk Products. Guidelines for the Application of Mid-Infrared Spectroscopy (ISO 9622:2013); International Organization for Standardization: Geneve, Switzerland, 2013. [Google Scholar]
- ISO. Milk- Enumeration of Somatic Cells—Part 2. Guidance on the Operation of Fluoro-Opto-Electronic Counters (ISO 1366-2:2008); International Organization for Standardization: Geneve, Switzerland, 2008. [Google Scholar]
- Laemmli, U.K. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 1970, 227, 680–685. [Google Scholar] [CrossRef] [Scilit]
- Giacinti, G.; Basiricò, L.; Ronchi, B.; Bernabucci, U. Lactoferrin concentration in buffalo milk. Ital. J. Anim. Sci. 2013, 12, e23. [Google Scholar] [CrossRef] [Scilit]
- Tudisco, R.; Grossi, M.; Calabrò, S.; Cutrignelli, M.I.; Musco, N.; Addi, L.; Infascelli, F. Influence of pasture on goat milk fatty acids and Stearoyl-CoAdesaturase expression in milk somatic cells. Small Rumin. Res. 2014, 122, 38–43. [Google Scholar] [CrossRef] [Scilit]
- Pfaffl, M.W. A new mathematical model for relative quantification in realtime RT-PCR. Nucleic Acids Res. 2001, 29, 2002–2007. [Google Scholar] [CrossRef] [Scilit]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Boutinaud, M.; Ben Chedly, M.H.; Delamaire, E.; Guinard-Flament, J. Milking and feed restriction regulate transcripts of mammary epithelial cells purified from milk. J. Dairy Sci. 2008, 91, 988–998. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, C.; Cai, W.; Zhou, C.; Yin, H.; Zhang, Z.; Loor, J.J.; Sun, D.; Zhang, Q.; Liu, J.; Zhang, S. RNA-Seq reveals 10 novel promising candidate genes affecting milk protein concentration in the Chinese Holstein population. Sci. Rep. 2016, 6, 26813. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yang, J.X.; Wang, C.H.; Xu, Q.B.; Zhao, F.Q.; Liu, J.X.; Liu, H.Y. Methionyl-methionine promoted milk protein synthesis in bovine mammary gland explants by enhancing intracellular substrate availability and activating JAK2-STAT5 and mTOR-mediated signaling pathways. J. Nutr. 2015, 145, 1748–1753. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, S.S.; Loor, J.J.; Liu, H.Y.; Liu, L.; Hosseini, A.; Zhao, W.S.; Liu, J.X. Optimal ratios of essential amino acids stimulate β-casein synthesis via activation of the mammalian target of rapamycin signaling pathway in MAC-T cells and bovine mammary tissue explants. J. Dairy Sci. 2017, 100, 6676–6688. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Duckett, S.K.; Pratt, S.L.; Pavan, E. Corn oil or corn grain supplementation to steers grazing endophyte-free tall fescue. II. Effects on subcutaneous fatty acid content and lipogenic gene expression. J. Anim. Sci 2009, 87, 1120–1128. [Google Scholar] [CrossRef] [Scilit]
- Bernabucci, U.; Basiricò, L.; Lacetera, N.; Morera, P.; Ronchi, B.; Accorsi, P.A.; Seren, E.; Nardone, A. Photoperiod affects gene expression of leptin and leptin receptors in adipose tissue from lactating dairy cows. J. Dairy Sci. 2006, 89, 4678–4686. [Google Scholar] [CrossRef] [Scilit]
- Wang, Y.H.; Bower, N.I.; Reverter, A.; Tan, S.H.; De Jager, N.; Wang, R.; McWilliam, S.M.; Café, L.M.; Greenwood, P.L.; Lehnert, S.A. Gene expression patterns during intramuscular fat development in cattle. J. Anim. Sci. 2009, 87, 119–130. [Google Scholar] [CrossRef] [Scilit]
- R Core Team. R: A Language and Environment for Statistical Computing; R Foundation for Statistical Computing: Vienna, Austria, 2015; Available online: https://www.R-project.org (accessed on 24 May 2017).
- Karimi, M.T.; Ghorbani, G.R.; Kargar, S.; Drackley, J.K. Late-gestation heat stress abatement on performance and behaviour of Holstein dairy cows. J. Dairy Sci. 2015, 98, 6865–6875. [Google Scholar] [CrossRef] [Scilit]
- Bouraoui, R.; Lahmar, M.; Majdoub, A.; Djemali, M.; Belyea, R. The relationship of temperature-humidity index with milk production of dairy cows in a mediterranean climate. Anim. Res. 2002, 51, 479–491. [Google Scholar] [CrossRef] [Scilit]
- Ting, H.; Zheng, N.; Wang, W.; Cheng, J.; Li, S.; Zhang, Y.; Wang, J. Integrated metabolomics study of the milk of heat-stressed lactating dairy cows. Sci. Rep. 2016, 6, 24208. [Google Scholar]
- Johnson, H.D.; Ragsdale, A.C.; Berry, I.L.; Shanklin, M.D. Temperature-Humidity Effects Including Influence of Acclimation in Fed and Water Consumption of Holstein Cattle, Research Bulletin, No. 846; University of Missouri: Columbia, NY, USA, 1963. [Google Scholar]
- Liu, J.; Li, L.; Chen, X.; Lu, Y.; Wang, D. Effects of heat stress on body temperature, milk production, and reproduction in dairy cows: A novel idea for monitoring and evaluation of heat stress—A review. Asian Australas. J. Anim. Sci. 2019, 32, 1332–1339. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Garner, J.B.; Douglas, M.L.; Williams, S.R.O.; Wales, W.J.; Marett, L.C.; Nguyen, T.T.T.; Reich, C.M.; Hayes, B.J. Genomic selection improves heat tolerance in dairy cattle. Sci. Rep. 2016, 6, 34114. [Google Scholar] [CrossRef] [Scilit]
- Coppock, C.E.; West, J.W. Nutritional adjustment to reduce heat stress in lactating dairy cows. In Proceedings of the Georgia Nutrition Conference for the Feed Industry, Atlanta, GA, USA, 19–21 February 1986; pp. 19–62. [Google Scholar]
- Polsky, L.; Marina, A.G.; von Keyserlingk, G. Effects of heat stress on dairy cattle welfare. J. Dairy Sci. 2017, 100, 8645–8657. [Google Scholar] [CrossRef] [Scilit]
- Pragna, P.; Archana, P.R.; Aleena, J.; Sejian, V.; Krishnan, G.; Bagath, M.; Manimaran, A.; Beena, V.; Kurien, E.K.; Varma, G.; et al. Heat stress and dairy cow: Impact on both milk yield and composition. Int. J. Dairy Sci. 2016, 12, 1–11. [Google Scholar] [CrossRef] [Scilit]
- Kanca, H. Milk production and composition in ruminants under heat stress. In Nutrients in Dairy and Their Implication on Health and Disease; Watson, R.R., Collier, R.J., Preedy, V.R., Eds.; Academic Press: Cambridge, MS, USA, 2017. [Google Scholar]
- Tao, S.; Orellana, R.M.; Weng, X.; Marins, T.N.; Dahl, G.E.; Bernard, J.K. The influences of heat stress on bovine mammary gland function. J. Dairy Sci. 2018, 101, 1–13. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Barlowska, J.; Szwajkowska, M.; Litwińczuk, Z.; Krol, J. Nutritional value and technological suitability of milk from various animal species used for dairy production. Compr. Rev. Food Sci. Food Saf. 2011, 10, 291–302. [Google Scholar] [CrossRef] [Scilit]
- Islam, M.A.; Alam, M.K.; Islam, M.N.; Khan, M.A.S.; Ekeberg, D.; Rukke, E.O.; Vegarud, G.E. Principal milk components in buffalo, holstein cross, indigenous cattle and red chittagong cattle from Bangladesh. Asian Australas. J. Anim. 2014, 27, 886–897. [Google Scholar] [CrossRef] [Scilit]
- Ma, L.; Yang, Y.; Zhao, X.; Wang, F.; Gao, S.; Bu, D. Heat stress induces proteomic changes in the liver and mammary tissue of dairy cows independent of feed intake: An iTRAQ study. PLoS ONE 2019, 14, e0209182. [Google Scholar] [CrossRef] [Scilit]
- Daugaard, M.; Rohde, M.; Jäättelä, M. The heat shock protein 70 family: Highly homologous proteins with overlapping and distinct functions. FEBS Lett. 2007, 581, 3702–3710. [Google Scholar] [CrossRef] [Scilit]
- Quintanilla, R.A.; Opazo, F.C.; Pallo, S.P.; Chesser, A.S.; Johnson, G.V.W. Stimulation of tau degradation. In Developing Therapeutics for Alzheimer’s Disease: Progress and Challenges; Wolfe, M., Ed.; Academic Press: Cambridge, MA, USA, 2016. [Google Scholar]
- Hassan, F.; Nawaz, A.; Rehman, M.S.; Ali, M.A.; Dilshad, S.M.R.; Yang, C. Prospects of HSP70 as a genetic marker for thermo-tolerance and immuno-modulation in animals under climate change scenario. Anim. Nutr. 2019, 5, 340–350. [Google Scholar] [CrossRef] [Scilit]
- Salama, A.A.K.; Duque, M.; Wang, L.; Shahzed, K.; Olivera, M.; Loor, J.J. Enhanced supply of methionine or arginine alters mechanistic target of rapamycin signaling proteins, messenger RNA, and microRNA abundance in heat-stressed bovine mammary epithelial cells in vitro. J. Dairy Sci. 2019, 102, 2469–2480. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hu, H.; Wang, J.; Gao, H.; Li, S.; Zhang, Y.; Zheng, N. Heat-induced apoptosis and gene expression in bovine mammary epithelial cells. Anim. Prod. Sci. 2016, 56, 918–926. [Google Scholar] [CrossRef] [Scilit]
- Kaufman, J.D.; Kassube, K.R.; Almeida, R.A.; Ríus, A.G. High incubation temperature in bovine mammary epithelial cells reduced the activity of the mTOR signaling pathway. J. Dairy Sci. 2018, 101, 7478–7486. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chou, S.-D.; Prince, T.; Gong, J.; Calderwood, S.K. mTOR Is Essential for the proteotoxic stress response, HSF1 activation and Heat Shock Protein synthesis. PLoS ONE 2012, 7, e39679. [Google Scholar] [CrossRef] [Scilit]
- Bionaz, M.; Hurley, W.; Loor, J.J. Milk protein synthesis in the lactating mammary gland: Insight from transcriptomics analysis. Milk Protein 2012, 11, 285–324. [Google Scholar]

| Item | Hay | Sorghum Silage | Concentrate |
|---|---|---|---|
| Ingredient offered (kg DM/d) | Ad libitum | 6 | 9.2 |
| Chemical composition | |||
| DM (%) | 90.4 | 27.5 | 87.6 |
| Ash (% DM) | 7.4 | 6.10 | 8.5 |
| EE (% DM) | 1.6 | 2.4 | 4.8 |
| CP (% DM) | 7.6 | 6.9 | 20.5 |
| NDF (% DM) | 71.2 | 58.8 | 23.8 |
| NEL (MJ/kg DM) | 4.7 | 5.8 | 7.6 |
| Gene | Primers Sequence, 5′ to 3′ | Amplicon Length (bp) | Accession Number (NCBI; GenBank) | Efficiency (%) | R2 |
|---|---|---|---|---|---|
| CSN2 1 | F: CCCTAACAGCCTCCCACA R: AGCCATAGCCTCCTTCAC | 112 | KC993858.1 | 101.1 | 0.996 |
| CSN3 2 | F: TGCAATGATGAAGAGTTTTTTCCTAG R: GATTGGGATATATTTGGCTATTTTGT | 150 | NM_174294.2 | 97.1 | 0.999 |
| HSPA1A 3 | F: AACATGAAGAGCGCCGTGGAGG R: GTTACACACCTGCTCCAGCTCC | 171 | NM_203322.3 | 101.0 | 0.988 |
| HSPA8 4 | F: CGAATCATCAATGAGCCAACTG R: TGCCACCCCCTAAATCAAAG | 100 | NM_174345.4 | 102.0 | 0.999 |
| BCL2 5 | F: TGTGGATGACCGAGTACCTGAA R: GACAGCCAGGAGAAATCAAACAG | 124 | NM_001166486.1 | 100.6 | 0.997 |
| MTOR 6 | F: CGTTCCTCTCAACATGGACACA R: AGCTTCTCCGCGTCTTTACAA | 102 | XM_002694043.5 | 96.3 | 0.988 |
| STAT5B 7 | F: GCCAACAATGGTACTTCTCCG R: TGTGTGACCAGTCGCAGCTC | 101 | NM_174617.4 | 98.5 | 0.997 |
| ACTB 8 | F: CTCTTCCAGCCTTCCTTCCT R: GGGCAGTGATCTCTTTCTGC | 177 | NM_173979.3 | 100.4 | 0.999 |
| GAPDH 9 | F: TCATCCCTGCTTCTACTGGC R: CCTGCTTCACCACCTTCTTG | 176 | NM_001034034 | 100.7 | 0.998 |
| RPLP0 10 | F: CAACCCCGAAGTGCTTGACAT R: AGGCAGATGGATCAGCCA | 226 | NM_001012682.1 | 100.2 | 0.999 |
| Item | Treatment Group | SE | p-Value | |
|---|---|---|---|---|
| CON | HS | |||
| Rectal temperature (°C) | 38.6 | 39.1 | 0.116 | 0.002 |
| Milk yield (kg/d) | 14.6 | 12.0 | 0.75 | 0.009 |
| FCM (kg/d) | 14.4 | 12.6 | 0.607 | 0.020 |
| Milk composition | ||||
| Protein (%) | 3.27 | 3.37 | 0.043 | 0.057 |
| Fat (%) | 3.83 | 4.33 | 0.262 | 0.097 |
| Lactose (%) | 4.44 | 4.50 | 0.099 | 0.529 |
| SCC × 1000 (cells/mL) | 128 | 197 | 35.4 | 0.091 |
| Milk total casein (%) | 2.20 | 2.14 | 0.610 | 0.416 |
| αs-casein (% total casein) | 60.77 | 59.53 | 0.572 | 0.066 |
| β-casein (% total casein) | 32.92 | 34.17 | 0.669 | 0.105 |
| κ-casein (% total casein) | 6.30 | 6.30 | 0.448 | 0.998 |
| Milk whey protein (%) | 0.97 | 0.98 | 0.021 | 0.734 |
| Protein yield (g/d) | 481 | 400 | 23.9 | 0.012 |
| Fat yield (g/d) | 568 | 518 | 27.0 | 0.111 |
| Item | Treatment Group | SE | p-Value | |
|---|---|---|---|---|
| CON | HS | |||
| Concentrate (kg DM) | 8.61 | 8.30 | 0.238 | 0.641 |
| Forage (kg DM) | 7.66 | 5.67 | 0.613 | 0.014 |
| Sorghum silage (kg DM) | 4.39 | 3.37 | 0.270 | 0.007 |
| Hay (kg DM) | 3.27 | 2.29 | 0.397 | 0.044 |
| Total (kg DM) | 16.26 | 13.97 | 0.771 | 0.021 |
| Gene | Treatment Group | SE | p-Value | |
|---|---|---|---|---|
| CON | HS | |||
| CSN2 | 1 | 2.35 | 0.495 | 0.215 |
| CSN3 | 1 | 4.68 | 0.904 | 0.164 |
| HSPA8 | 1 | 1.11 | 0.278 | 0.461 |
| HSPA1A | 1 | 1.28 | 0.362 | 0.020 |
| BCL2 | 1 | 1.66 | 0.403 | 0.016 |
| MTOR | 1 | 3.00 | 0.542 | 0.059 |
| STAT5B | 1 | 2.43 | 0.507 | 0.129 |
| Gene | Treatment Group | SE | p-Value | |
|---|---|---|---|---|
| CON | HS | |||
| BCL2 | 0.100 | 0.133 | 0.0050 | 0.007 |
| HSPA1A | 0.170 | 0.304 | 0.0482 | 0.049 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Corazzin, M.; Saccà, E.; Lippe, G.; Romanzin, A.; Foletto, V.; Da Borso, F.; Piasentier, E. Effect of Heat Stress on Dairy Cow Performance and on Expression of Protein Metabolism Genes in Mammary Cells. Animals 2020, 10, 2124. https://doi.org/10.3390/ani10112124
Corazzin M, Saccà E, Lippe G, Romanzin A, Foletto V, Da Borso F, Piasentier E. Effect of Heat Stress on Dairy Cow Performance and on Expression of Protein Metabolism Genes in Mammary Cells. Animals. 2020; 10(11):2124. https://doi.org/10.3390/ani10112124
Chicago/Turabian StyleCorazzin, Mirco, Elena Saccà, Giovanna Lippe, Alberto Romanzin, Vinicius Foletto, Francesco Da Borso, and Edi Piasentier. 2020. "Effect of Heat Stress on Dairy Cow Performance and on Expression of Protein Metabolism Genes in Mammary Cells" Animals 10, no. 11: 2124. https://doi.org/10.3390/ani10112124
APA StyleCorazzin, M., Saccà, E., Lippe, G., Romanzin, A., Foletto, V., Da Borso, F., & Piasentier, E. (2020). Effect of Heat Stress on Dairy Cow Performance and on Expression of Protein Metabolism Genes in Mammary Cells. Animals, 10(11), 2124. https://doi.org/10.3390/ani10112124

