Dietary Triple-Strain Bacillus-Based Probiotic Supplementation Improves Performance, Immune Function, Intestinal Morphology, and Microbial Community in Weaned Pigs
Abstract
:1. Introduction
2. Materials and Methods
2.1. Source of Probiotics
2.2. Animals, Diets, and Experimental Design
2.3. Experimental Procedures and Sample Collection
2.4. Chemical Analysis of Nutrient Levels of Diets
2.5. Blood Analysis
2.6. Fecal Indicators and Microbial Community Analysis
2.7. Intestinal Morphology
2.8. Quantitative Real-Time PCR
2.9. DNA Extraction and 16S rRNA Sequencing
2.10. Statistical Analysis
3. Results
3.1. Growth Performance and Fecal Score
3.2. Fecal Biomarkers and Microorganisms
3.3. Serum Biochemical Indicators
3.4. Intestinal Morphology and Immunity Parameters
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- St-Pierre, B.; Perez Palencia, J.Y.; Samuel, R.S. Impact of early weaning on development of the swine gut microbiome. Microorganisms 2023, 11, 1753. [Google Scholar] [CrossRef] [PubMed]
- Heo, J.M.; Opapeju, F.O.; Pluske, J.R.; Kim, J.C.; Hampson, D.J.; Nyachoti, C.M. Gastrointestinal health and function in weaned pigs: A review of feeding strategies to control post-weaning diarrhoea without using in-feed antimicrobial compounds. J. Anim. Physiol. Anim. Nutr. 2013, 97, 207–237. [Google Scholar] [CrossRef]
- Lallès, J.P.; Bosi, P.; Smidt, H.; Stokes, C.R. Nutritional management of gut health in pigs around weaning. Proc. Nutr. Soc. 2007, 66, 260–268. [Google Scholar] [CrossRef] [PubMed]
- Wang, S.; Zeng, X.; Yang, Q.; Qiao, S. Antimicrobial peptides as potential alternatives to antibiotics in food animal industry. Int. J. Mol. Sci. 2016, 17, 603. [Google Scholar] [CrossRef] [PubMed]
- Ghazisaeedi, F.; Ciesinski, L.; Bednorz, C.; Johanns, V.; Pieper, L.; Tedin, K.; Wieler, L.H.; Günther, S. Phenotypic zinc resistance does not correlate with antimicrobial multi-resistance in fecal E. coli isolates of piglets. Gut. Pathog. 2020, 12, 4. [Google Scholar] [CrossRef]
- Do, K.-H.; Byun, J.-W.; Lee, W.-K. Antimicrobial resistance profiles of Escherichia coli from diarrheic weaned piglets after the ban on antibiotic growth promoters in feed. Antibiotics 2020, 9, 755. [Google Scholar] [CrossRef]
- Hou, G.; Peng, W.; Wei, L.; Li, R.; Huang, X.; Yin, Y. Probiotics and Achyranthes bidentata polysaccharides improve growth performance via promoting intestinal nutrient utilization and enhancing immune function of weaned pigs. Animals 2021, 11, 2617. [Google Scholar] [CrossRef] [PubMed]
- World Health Organization & Food and Agriculture Organization. Guidelines for evaluation of probiotics in food. In Joint FAO/WHO Working Group Report on Drafting Guidelines for the Evaluation of Probiotics in Food; FAO/WHO: London, ON, Canada, 2002. [Google Scholar]
- Hu, Y.; Dun, Y.; Li, S.; Zhao, S.; Peng, N.; Liang, Y. Effects of Bacillus subtilis KN-42 on growth performance, diarrhea and faecal bacterial flora of weaned piglets. Asian-Australas. J. Anim. Sci. 2014, 27, 1131–1140. [Google Scholar] [CrossRef]
- Sun, W.; Chen, W.; Meng, K.; Cai, L.; Li, G.; Li, X.; Jiang, X. Dietary supplementation with probiotic Bacillus licheniformis S6 improves intestinal integrity via modulating intestinal barrier function and microbial diversity in weaned piglets. Biology 2023, 12, 238. [Google Scholar] [CrossRef]
- Yu, X.; Cui, Z.; Qin, S.; Zhang, R.; Wu, Y.; Liu, J.; Yang, C. Effects of Bacillus licheniformis on growth performance, diarrhea incidence, antioxidant capacity, immune function, and fecal microflora in weaned piglets. Animals 2022, 12, 1609. [Google Scholar] [CrossRef]
- Tian, Z.; Wang, X.; Duan, Y.; Zhao, Y.; Zhang, W.; Azad, M.A.K.; Wang, Z.; Blachier, F.; Kong, X. Dietary supplementation with Bacillus subtilis promotes growth and gut health of weaned piglets. Front. Vet. Sci. 2020, 7, 600772. [Google Scholar] [CrossRef] [PubMed]
- Chapman, C.M.; Gibson, G.R.; Rowland, I. Health benefits of probiotics: Are mixtures more effective than single strains? Eur. J. Nutr. 2011, 50, 1–17. [Google Scholar] [CrossRef]
- NRC. Nutrient Requirements of Swine, 11th ed.; National Academies Press: Washington, DC, USA, 2012. [Google Scholar]
- Marquardt, R.R.; Jin, L.Z.; Kim, J.W.; Fang, L.; Frohlich, A.A.; Baidoo, S.K. Passive protective effect of egg-yolk antibodies against enterotoxigenic Escherichia coli K88+ infection in neonatal and early-weaned piglets. FEMS Immunol. Med. Microbiol. 1999, 23, 283–288. [Google Scholar] [CrossRef] [PubMed]
- AOAC. Official Methods of Analysis, 19th ed.; AOAC International: Gaithersburg, MD, USA, 2012. [Google Scholar]
- Bosi, P.; Trevisi, P. New topics and limits related to the use of beneficial microbes in pig feeding. Benef. Microbes 2010, 1, 447–454. [Google Scholar] [CrossRef] [PubMed]
- Cao, G.; Tao, F.; Hu, Y.; Li, Z.; Zhang, Y.; Deng, B.; Zhan, X. Positive effects of a Clostridium butyricum-based compound probiotic on growth performance, immune responses, intestinal morphology, hypothalamic neurotransmitters, and colonic microbiota in weaned piglets. Food. Funct. 2019, 10, 2926–2934. [Google Scholar] [CrossRef] [PubMed]
- Wang, S.; Yao, B.; Gao, H.; Zang, J.; Tao, S.; Zhang, S.; Huang, S.; He, B.; Wang, J. Combined supplementation of Lactobacillus fermentum and Pediococcus acidilactici promoted growth performance, alleviated inflammation, and modulated intestinal microbiota in weaned pigs. BMC Vet. Res. 2019, 15, 239. [Google Scholar] [CrossRef] [PubMed]
- Rychen, G.; Aquilina, G.; Azimonti, G.; Bampidis, V.; Bastos, M.L.; Bories, G.; Chesson, A.; Cocconcelli, P.S.; Flachowsky, G.; Gropp, J.; et al. Safety and efficacy of Bacillus subtilis DSM 28343 as a feed additive for piglets. EFSA J. 2018, 16, e05221. [Google Scholar] [CrossRef] [PubMed]
- Carcelén, F.; López, M.; Martín, F.S.; Ara, M.; Bezada, S.; Ruiz-García, L.; Sandoval-Monzón, R.; López, S.; Guevara, J. Effect of probiotics administration at different levels on the productive parameters of guinea pigs for fattening (Cavia porcellus). Open Vet. J. 2021, 11, 222–227. [Google Scholar] [CrossRef]
- Suo, C.; Yin, Y.; Wang, X.; Lou, X.; Song, D.; Wang, X.; Gu, Q. Effects of Lactobacillus plantarum ZJ316 on pig growth and pork quality. BMC Vet. Res. 2012, 8, 89. [Google Scholar] [CrossRef]
- Zhu, Y.H.; Li, X.Q.; Zhang, W.; Zhou, D.; Liu, H.Y.; Wang, J.F. Dose-dependent effects of Lactobacillus rhamnosus on serum interleukin-17 production and intestinal T-cell responses in pigs challenged with Escherichia coli. Appl. Environ. Microbiol. 2014, 80, 1787–1798. [Google Scholar] [CrossRef]
- Wijburg, O.L.; Uren, T.K.; Simpfendorfer, K.; Johansen, F.E.; Brandtzaeg, P.; Strugnell, R.A. Innate secretory antibodies protect against natural Salmonella typhimurium infection. J. Exp. Med. 2006, 203, 21–26. [Google Scholar] [CrossRef] [PubMed]
- Mirpuri, J.; Raetz, M.; Sturge, C.R.; Wilhelm, C.L.; Benson, A.; Savani, R.C.; Hooper, L.V.; Yarovinsky, F. Proteobacteria-specific IgA regulates maturation of the intestinal microbiota. Gut Microbes 2014, 5, 28–39. [Google Scholar] [CrossRef] [PubMed]
- Yang, Y.; Palm, N.W. Immunoglobulin A and the microbiome. Curr. Opin. Microbiol. 2020, 56, 89–96. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.; Sparks, J.B.; Karyala, S.V.; Settlage, R.; Luo, X.M. Host adaptive immunity alters gut microbiota. ISME J. 2015, 9, 770–781. [Google Scholar] [CrossRef]
- Scholtens, P.A.; Alliet, P.; Raes, M.; Alles, M.S.; Kroes, H.; Boehm, G.; Knippels, L.M.; Knol, J.; Vandenplas, Y. Fecal secretory immunoglobulin a is increased in healthy infants who receive a formula with short-chain galacto-oligosaccharides and long-chain fructo-oligosaccharides. J. Nutr. 2008, 138, 1141–1147. [Google Scholar] [CrossRef] [PubMed]
- Chen, X.; Chen, W.W.; Ci, W.J.; Zheng, Y.Y.; Han, X.Y.; Huang, J.P.; Zhu, J.J. Effects of dietary supplementation with Lactobacillus acidophilus and Bacillus subtilis on mucosal immunity and intestinal barrier are associated with its modulation of gut metabolites and microbiota in late-phase laying hens. Probiotics Antimicrob. Proteins 2023, 15, 912–924. [Google Scholar] [CrossRef] [PubMed]
- Hansberry, D.R.; Shah, K.; Agarwal, P.; Agarwal, N. Fecal myeloperoxidase as a biomarker for inflammatory bowel disease. Cureus 2017, 9, e1004. [Google Scholar] [CrossRef]
- Siraki, A.G. The many roles of myeloperoxidase: From inflammation and immunity to biomarkers, drug metabolism and drug discovery. Redox Biol. 2021, 46, 102109. [Google Scholar] [CrossRef]
- He, X.; Ye, G.; Xu, S.; Chen, X.; He, X.; Gong, Z. Effects of three different probiotics of tibetan sheep origin and their complex probiotics on intestinal damage, immunity, and immune signaling pathways of mice infected with Clostridium perfringens type C. Front. Microbiol. 2023, 14, 1177232. [Google Scholar] [CrossRef]
- Erdogan, F.S.; Ozarslan, S.; Guzel-Seydim, Z.B.; Kök Taş, T. The effect of kefir produced from natural kefir grains on the intestinal microbial populations and antioxidant capacities of balb/c mice. Food Res. Int. 2019, 115, 408–413. [Google Scholar] [CrossRef]
- Yang, F.; Hou, C.; Zeng, X.; Qiao, S. The use of lactic acid bacteria as a probiotic in swine diets. Pathogens 2015, 4, 34–45. [Google Scholar] [CrossRef] [PubMed]
- Fu, J.; Wang, T.; Xiao, X.; Cheng, Y.; Wang, F.; Jin, M.; Wang, Y.; Zong, X. Clostridium butyricum ZJU-F1 benefits the intestinal barrier function and immune response associated with its modulation of gut microbiota in weaned piglets. Cells 2021, 10, 527. [Google Scholar] [CrossRef] [PubMed]
- Liu, X.; Xia, B.; He, T.; Li, D.; Su, J.H.; Guo, L.; Wang, J.F.; Zhu, Y.H. Oral administration of a select mixture of Lactobacillus and Bacillus alleviates inflammation and maintains mucosal barrier integrity in the ileum of pigs challenged with Salmonella infantis. Microorganisms 2019, 7, 135. [Google Scholar] [CrossRef] [PubMed]
- Xie, Z.; Li, M.; Qian, M.; Yang, Z.; Han, X. Co-cultures of Lactobacillus acidophilus and Bacillus subtilis enhance mucosal barrier by modulating gut microbiota-derived short-chain fatty acids. Nutrients 2022, 14, 4475. [Google Scholar] [CrossRef] [PubMed]
- Mahmud, M.R.; Jian, C.; Uddin, M.K.; Huhtinen, M.; Salonen, A.; Peltoniemi, O.; Venhoranta, H.; Oliviero, C. Impact of intestinal microbiota on growth performance of suckling and weaned piglets. Microbiol. Spectr. 2023, 11, e0374422. [Google Scholar] [CrossRef]
- Gresse, R.; Chaucheyras-Durand, F.; Fleury, M.A.; Van de Wiele, T.; Forano, E.; Blanquet-Diot, S. Gut microbiota dysbiosis in postweaning piglets: Understanding the keys to health. Trends Microbiol. 2017, 25, 851–873. [Google Scholar] [CrossRef] [PubMed]
- Vieira, A.M.; Sessin, A.P.; Soratto, T.A.T.; Pires, P.; Cardinal, K.M.; Wagner, G.; Hauptli, L.; Lima, A.L.F.; Dahlke, F.; Netto, D.P.; et al. Effect of functional oils or probiotics on performance and microbiota profile of newly weaned piglets. Sci. Rep. 2021, 11, 19457. [Google Scholar] [CrossRef]
- Shetty, S.A.; Kostopoulos, I.; Geerlings, S.Y.; Smidt, H.; de Vos, W.M.; Belzer, C. Dynamic metabolic interactions and trophic roles of human gut microbes identified using a minimal microbiome exhibiting ecological properties. ISME J. 2022, 16, 2144–2159. [Google Scholar] [CrossRef]
- Won, K.; Kim, D.; Shin, D.; Hur, J.; Lee, H.K.; Heo, J.; Oh, J.D. High-throughput sequencing-based metagenomic and transcriptomic analysis of intestine in piglets infected with salmonella. J. Anim. Sci. Technol. 2022, 64, 1144–1172. [Google Scholar] [CrossRef] [PubMed]
- Matsumoto, M.L. Molecular mechanisms of multimeric assembly of IgM and IgA. Annu. Rev. Immunol. 2022, 40, 221–247. [Google Scholar] [CrossRef]
- Konieczka, P.; Ferenc, K.; Jørgensen, J.N.; Hansen, L.H.B.; Zabielski, R.; Olszewski, J.; Gajewski, Z.; Mazur-Kuśnirek, M.; Szkopek, D.; Szyryńska, N.; et al. Feeding Bacillus-based probiotics to gestating and lactating sows is an efficient method for improving immunity, gut functional status and biofilm formation by probiotic bacteria in piglets at weaning. Anim. Nutr. 2023, 13, 361–372. [Google Scholar] [CrossRef] [PubMed]
- Hiss-Pesch, S.; Daniel, F.; Dunkelberg-Denk, S.; Mielenz, M.; Sauerwein, H. Transfer of maternal haptoglobin to suckling piglets. Vet. Immunol. Immunopathol. 2011, 144, 104–110. [Google Scholar] [CrossRef] [PubMed]
- Inatsu, A.; Kinoshita, M.; Nakashima, H.; Shimizu, J.; Saitoh, D.; Tamai, S.; Seki, S. Novel mechanism of C-reactive protein for enhancing mouse liver innate immunity. Hepatology 2009, 49, 2044–2054. [Google Scholar] [CrossRef] [PubMed]
- Trevisi, P.; Latorre, R.; Priori, D.; Luise, D.; Archetti, I.; Mazzoni, M.; D’Inca, R.; Bosi, P. Effect of feed supplementation with live yeast on the intestinal transcriptome profile of weaning pigs orally challenged with Escherichia coli F4. Animal 2017, 11, 33–44. [Google Scholar] [CrossRef] [PubMed]
- Puthucheary, Z.; Tadié, J.M.; Patel, J.J. C-reactive protein in immunometabolism: Spared from ‘paying the piper’. Intensive Care Med. 2022, 48, 103–105. [Google Scholar] [CrossRef] [PubMed]
- Andersen, C.B.F.; Stødkilde, K.; Sæderup, K.L.; Kuhlee, A.; Raunser, S.; Graversen, J.H.; Moestrup, S.K. Haptoglobin. Antioxid. Redox Signal. 2017, 26, 814–831. [Google Scholar] [CrossRef] [PubMed]
- Bürger, W.; Fennert, E.M.; Pohle, M.; Wesemeier, H. C-reactive protein—A characteristic feature of health control in swine. Zentralbl. Veterinarmed. A 1992, 39, 635–638. [Google Scholar] [CrossRef]
- Fraile, L.; Saco, Y.; Grau-Roma, L.; Nofrarías, M.; López-Soria, S.; Sibila, M.; Callén, A.; Bassols, A.; Segalés, J. Serum haptoglobin dynamics in pigs vaccinated or not vaccinated against porcine circovirus type 2. Porcine Health Manag. 2015, 1, 3. [Google Scholar] [CrossRef]
- Vente-Spreeuwenberg, M.A.; Verdonk, J.M.; Verstegen, M.W.; Beynen, A.C. Villus height and gut development in weaned piglets receiving diets containing either glucose, lactose or starch. Br. J. Nutr. 2003, 90, 907–913. [Google Scholar] [CrossRef]
- Zhang, Q.; Li, J.; Yi, X.; Li, Z.; Liang, S.; Fang, Z.; Lin, Y.; Xu, S.; Feng, B.; Zhuo, Y.; et al. Rhodotorula benthica culture as an alternative to antibiotics improves growth performance by improving nutrients digestibility and intestinal morphology, and modulating gut microbiota of weaned piglets. Front. Microbiol. 2022, 13, 964531. [Google Scholar] [CrossRef]
- Gustafsson, J.K.; Johansson, M.E.V. The role of goblet cells and mucus in intestinal homeostasis. Nat. Rev. Gastroenterol. Hepatol. 2022, 19, 785–803. [Google Scholar] [CrossRef]
- Aliakbarpour, H.R.; Chamani, M.; Rahimi, G.; Sadeghi, A.A.; Qujeq, D. The Bacillus subtilis and Lactic acid bacteria probiotics influences intestinal mucin gene expression, histomorphology and growth performance in broilers. Asian-Australas. J. Anim. Sci. 2012, 25, 1285–1293. [Google Scholar] [CrossRef] [PubMed]
- Zhang, W.; Zhu, Y.H.; Zhou, D.; Wu, Q.; Song, D.; Dicksved, J.; Wang, J.F. Oral administration of a select mixture of Bacillus probiotics affects the gut microbiota and goblet cell function following Escherichia coli challenge in newly weaned pigs of genotype MUC4 that are supposed to be Enterotoxigenic E. coli F4ab/ac receptor negative. Appl. Environ. Microbiol. 2017, 83, e02747-16. [Google Scholar] [CrossRef]
- Desantis, S.; Mastrodonato, M.; Accogli, G.; Rossi, G.; Crovace, A.M. Effects of a probiotic on the morphology and mucin composition of pig intestine. Histol. Histopathol. 2019, 34, 1037–1050. [Google Scholar] [CrossRef] [PubMed]
- Franza, L.; Carusi, V.; Altamura, S.; Caraffa, A.; Gallenga, C.E.; Kritas, S.K.; Ronconi, G.; Conti, P.; Pandolfi, F. Interrelationship between inflammatory cytokines (IL-1, IL-6, IL-33, IL-37) and acquired immunity. J. Biol. Regul. Homeost. Agents 2019, 33, 1321–1326. [Google Scholar] [CrossRef] [PubMed]
- Hessle, C.; Hanson, L.A.; Wold, A.E. Interleukin-10 produced by the innate immune system masks in vitro evidence of acquired T-cell immunity to E. coli. Scand. J. Immunol. 2000, 52, 13–20. [Google Scholar] [CrossRef] [PubMed]
- Jiao, Y.; Zhang, T.; Zhang, C.; Ji, H.; Tong, X.; Xia, R.; Wang, W.; Ma, Z.; Shi, X. Exosomal mir-30d-5p of neutrophils induces M1 macrophage polarization and primes macrophage pyroptosis in sepsis-related acute lung injury. Crit. Care 2021, 25, 356. [Google Scholar] [CrossRef] [PubMed]
- Du, W.; Xu, H.; Mei, X.; Cao, X.; Gong, L.; Wu, Y.; Li, Y.; Yu, D.; Liu, S.; Wang, Y.; et al. Probiotic Bacillus enhance the intestinal epithelial cell barrier and immune function of piglets. Benef. Microbes 2018, 9, 743–754. [Google Scholar] [CrossRef]
- Junttila, I.S. Tuning the cytokine responses: An update on interleukin (IL)-4 and IL-13 receptor complexes. Front. Immunol. 2018, 9, 888. [Google Scholar] [CrossRef]
- Liu, Y.; Yu, X.; Zhao, J.; Zhang, H.; Zhai, Q.; Chen, W. The role of MUC2 mucin in intestinal homeostasis and the impact of dietary components on expression. Int. J. Biol. Macromol. 2020, 164, 884–891. [Google Scholar] [CrossRef]
- Bäsler, K.; Brandner, J.M. Tight junctions in skin inflammation. Pflügers Archiv 2017, 469, 3–14. [Google Scholar] [CrossRef] [PubMed]
- Kuo, W.T.; Odenwald, M.A.; Turner, J.R.; Zuo, L. Tight junction proteins occludin and ZO-1 as regulators of epithelial proliferation and survival. Ann. N. Y. Acad. Sci. 2022, 1514, 21–33. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.; Merzdorf, C.; Paul, D.L.; Goodenough, D.A. COOH terminus of occludin is required for tight junction barrier function in early Xenopus embryos. J. Cell Biol. 1997, 138, 891–899. [Google Scholar] [CrossRef] [PubMed]
- McCarthy, K.M.; Skare, I.B.; Stankewich, M.C.; Furuse, M.; Tsukita, S.; Rogers, R.A.; Lynch, R.D.; Schneeberger, E.E. Occludin is a functional component of the tight junction. J. Cell Sci. 1996, 109 Pt 9, 2287–2298. [Google Scholar] [CrossRef] [PubMed]
Ingredients, % | Phase 1 (1–14 d) 1 | Phase 2 (15–31 d) |
---|---|---|
Corn | 41.66 | 61.73 |
Extruded corn | 15.00 | 0.00 |
Soybean meal | 14.00 | 19.00 |
Extruded full-fat soybean | 12.00 | 7.10 |
Fish meal | 6.00 | 2.00 |
Whey power | 5.00 | 4.00 |
Soy oil | 2.94 | 2.62 |
Dicalcium phosphate | 0.80 | 0.80 |
Limestone | 0.75 | 0.92 |
Salt | 0.20 | 0.30 |
L-Lysine | 0.44 | 0.48 |
Methionine | 0.07 | 0.10 |
Threonine | 0.15 | 0.16 |
Tryptophan | 0.04 | 0.04 |
Zinc oxide | 0.20 | 0.00 |
Chromic oxide (Cr2O3) | 0.25 | 0.25 |
Vitamin–mineral premix 2 | 0.50 | 0.50 |
Total | 100.00 | 100.00 |
Calculated composition 3, % | ||
Digestible energy, kcal/kg | 3542 | 3490 |
Crude protein | 19.64 | 18.00 |
Calcium | 0.80 | 0.70 |
STTD Phosphorus | 0.40 | 0.33 |
SID Lysine | 1.35 | 1.23 |
SID Methionine | 0.39 | 0.36 |
SID Threonine | 0.79 | 0.73 |
SID Tryptophan | 0.22 | 0.20 |
Analyzed composition % | ||
Gross energy, kcal/kg | 4190 | 4018 |
Dry matter | 90.48 | 89.31 |
Crude protein | 20.28 | 18.08 |
Ether extract | 6.93 | 5.96 |
Ash | 5.94 | 5.99 |
Lysine | 1.36 | 1.35 |
Methionine | 0.37 | 0.37 |
Threonine | 0.87 | 0.70 |
Tryptophan | 0.26 | 0.25 |
Genes | Primer | Size (bp) | Accession Number | |
---|---|---|---|---|
D 1 | Sequence (5′-3′) | |||
β-actin | F | TACGCCAACACGGTGCTGTC | 207 | NM_214055 |
R | GTACTCTGCTTGCTGATCCACAT | |||
IL-1β | F | CATCAGCACCTCTCAAGCAGAACA | 189 | NM_214123 |
R | CAGGCAGCAACCATGTACCAACT | |||
IL-4 | F | GCCTCCTGAGCGGACTTG | 122 | NM_214399 |
R | CTCCTTCATAATOGTCTTTAGCCT | |||
IL-6 | F | CAGTCCAGTCGCCTTCTCCC | 93 | NM_214041 |
R | GCATCACCTTTGGCATCTTCTT | |||
IL-10 | F | ACCTCATTCCCCAAACACTTCA | 134 | NM_214022 |
R | ACAAACAATGTAACATTCCCAGAG | |||
TNF-α | F | GCATCGCCGTCTCCTACC | 201 | XM_021082584 |
R | GCCCAGATTCAGCAAAGTCC | |||
MUC2 | F | CGGCTCTCCAGTCTACTCGTCTAA | 204 | XM_021098827 |
R | TGGTTGTCGGGCAAGTTGATGA | |||
ZO-1 | F | GAGGATGGTCACACCGTGGT | 169 | NM_001244539 |
R | GGAGGATGCTGTTGTCTCGG | |||
CLDN1 | F | CAAAACCTTCGCCTTCCAG | 293 | NM_001163647 |
R | TCCCCACATTCGAGATGATTAC | |||
OCLN | F | ATGCTTTCTCAGCCAGCGTA | 176 | XM_003124280 |
R | AAGGTTCCATAGCCTCGGTC |
Parameter | Treatment | SEM | p-Value | ||
---|---|---|---|---|---|
P0 | P200 | P400 | |||
N | 160 | 160 | 160 | ||
BWd 0, kg | 8.13 | 8.13 | 8.13 | 0.08 | 1.00 |
BWd 14, kg | 12.46 | 12.40 | 12.44 | 0.11 | 0.93 |
BWd 31, kg | 19.99 | 20.28 | 20.53 | 0.22 | 0.22 |
Phase 1 (d 0 to 14) | |||||
ADG, g/d | 308 | 305 | 308 | 5.05 | 0.83 |
ADFI, g/d | 474 x | 455 y | 453 y | 6.69 | 0.06 |
FCR, g/g | 1.55 | 1.52 | 1.49 | 0.02 | 0.19 |
Phase 2 (d 15 to 31) | |||||
ADG, g/d | 442 b | 463 ab | 475 a | 9.71 | 0.05 |
ADFI, g/d | 770 b | 774 b | 814 a | 12.79 | 0.04 |
FCR, g/g | 1.76 | 1.69 | 1.73 | 0.03 | 0.24 |
Overall phase (d 0 to 31) | |||||
ADG, g/d | 382 y | 392 xy | 400 x | 5.68 | 0.10 |
ADFI, g/d | 636 | 630 | 651 | 7.88 | 0.16 |
FCR, g/g | 1.67 x | 1.62 y | 1.64 y | 0.02 | 0.10 |
Fecal score | |||||
Fecal score week 1 | 0.25 | 0.31 | 0.30 | 0.05 | 0.67 |
Fecal score week 2 | 0.33 | 0.35 | 0.32 | 0.04 | 0.82 |
Fecal score week 3 | 0.42 | 0.46 | 0.40 | 0.03 | 0.24 |
Fecal score week 4 | 0.45 a | 0.38 b | 0.37 b | 0.02 | 0.03 |
Diarrhea rate, % | |||||
Diarrhea rate week 1 | 1.38 | 1.75 | 1.63 | 0.59 | 0.90 |
Diarrhea rate week 2 | 1.40 | 0.69 | 1.00 | 0.41 | 0.48 |
Diarrhea rate week 3 | 1.07 | 0.54 | 0.63 | 0.27 | 0.34 |
Diarrhea rate week 4 | 0.52 | 0.47 | 0.16 | 0.24 | 0.51 |
Parameter | Treatment | SEM | p-Value | ||
---|---|---|---|---|---|
P0 | P200 | P400 | |||
DM of feces, % | |||||
d 0 | 77.66 | 77.49 | 77.16 | 0.23 | 0.32 |
d 14 | 78.42 y | 78.35 y | 78.96 x | 0.20 | 0.09 |
d 31 | 79.44 | 80.02 | 80.04 | 0.22 | 0.12 |
sIgA in feces (ug/g) | |||||
d 0 | 26.72 y | 35.32 x | 35.25 x | 3.04 | 0.10 |
d 14 | 46.16 | 37.95 | 55.12 | 7.68 | 0.31 |
d 31 | 64.89 a | 44.81 b | 56.98 ab | 5.20 | 0.04 |
MPO in feces (U/g) | |||||
d 0 | 15.01 | 15.05 | 13.90 | 0.53 | 0.25 |
d 14 | 17.53 b | 21.14 a | 16.49 b | 0.80 | <0.01 |
d 31 | 22.52 | 24.80 | 21.78 | 1.14 | 0.17 |
E. coli (107 CFU/g) | |||||
d 0 | 3.62 | 4.08 | 3.26 | 0.47 | 0.47 |
d 14 | 3.07 | 3.07 | 4.11 | 0.52 | 0.29 |
d 31 | 3.52 | 3.06 | 2.94 | 0.76 | 0.85 |
LAB (107 CFU/g) | |||||
d 0 | 8.24 | 9.81 | 7.74 | 2.15 | 0.78 |
d 14 | 6.84 | 6.70 | 8.25 | 0.98 | 0.48 |
d 31 | 5.68 | 5.02 | 10.67 | 2.59 | 0.27 |
C. perfringens (107 CFU/g) | |||||
d 0 | 2.30 | 2.45 | 2.10 | 0.40 | 0.82 |
d 14 | 2.65 | 2.61 | 3.02 | 0.58 | 0.86 |
d 31 | 1.40 | 3.11 | 1.52 | 0.70 | 0.19 |
Parameter | Treatment | SEM | p-Value | ||
---|---|---|---|---|---|
P0 | P200 | P400 | |||
d 0 | |||||
Clostridium_sensu_stricto_1 | 24.18 | 13.12 | 18.48 | 4.10 | 0.21 |
Muribaculaceae | 8.72 | 8.79 | 7.13 | 1.79 | 0.76 |
Prevotella | 5.53 | 5.30 | 7.15 | 1.84 | 0.75 |
Lactobacillus | 2.63 | 3.76 | 0.66 | 1.57 | 0.40 |
Treponema | 0.41 | 1.36 | 1.97 | 1.04 | 0.58 |
Methanobrevibacter | 1.86 | 0.63 | 0.43 | 0.71 | 0.35 |
UCG-005 | 1.16 | 2.07 | 2.65 | 0.59 | 0.25 |
Parabacteroides | 0.16 | 0.48 | 1.80 | 0.62 | 0.19 |
Streptococcus | 4.15 a | 0.92 b | 0.91 b | 0.59 | <0.01 |
Subdoligranulum | 0.67 | 1.17 | 2.14 | 0.51 | 0.17 |
d 14 | |||||
Lactobacillus | 11.95 x | 11.09 x | 22.56 y | 3.27 | 0.06 |
Muribaculaceae | 6.14 | 11.45 | 5.37 | 2.10 | 0.13 |
Clostridium_sensu_stricto_1 | 8.52 | 4.54 | 2.10 | 1.95 | 0.11 |
Blautia | 6.49 | 10.97 | 6.46 | 1.82 | 0.18 |
Prevotella | 1.70 | 0.96 | 4.55 | 1.65 | 0.31 |
Clostridia_UCG-014 | 5.80 | 4.25 | 4.04 | 1.11 | 0.50 |
Streptococcus | 1.93 | 2.75 | 3.48 | 1.15 | 0.65 |
Subdoligranulum | 2.42 | 4.20 | 2.41 | 0.58 | 0.09 |
d 31 | |||||
Lactobacillus | 32.99 | 28.17 | 37.01 | 4.00 | 0.33 |
Streptococcus | 10.54 | 12.52 | 8.02 | 1.88 | 0.28 |
Blautia | 7.78 | 8.40 | 7.62 | 0.89 | 0.81 |
Subdoligranulum | 5.35 | 4.76 | 7.22 | 1.07 | 0.28 |
Faecalibacterium | 4.98 | 3.46 | 5.08 | 0.82 | 0.33 |
Clostridium_sensu_stricto_6 | 0.30 | 2.75 | 0.71 | 0.94 | 0.19 |
Prevotellaceae_NK3B31_group | 0.67 | 2.06 | 0.38 | 0.93 | 0.43 |
Prevotella | 3.77 | 3.95 | 1.84 | 0.93 | 0.26 |
Muribaculaceae | 3.59 | 3.07 | 2.39 | 1.12 | 0.76 |
Dialister | 2.35 | 0.62 | 1.68 | 0.70 | 0.26 |
Bacteroides | 1.99 a | 0.47 b | 1.29 ab | 0.37 | 0.05 |
Eubacterium_coprostanoligenes_group | 0.67 | 1.11 | 0.74 | 0.27 | 0.47 |
Eubacterium_hallii_group | 0.24 | 0.86 | 0.19 | 0.26 | 0.17 |
Clostridia_UCG-014 | 0.96 | 1.20 | 1.08 | 0.26 | 0.81 |
Escherichia-Shigella | 0.11 | 0.27 | 0.10 | 0.10 | 0.44 |
Parameter | Treatment | SEM | p-Value | ||
---|---|---|---|---|---|
P0 | P200 | P400 | |||
IgA (ug/mL) | |||||
d 0 | 802 | 908 | 852 | 50.53 | 0.35 |
d 14 | 726 b | 967 a | 926 a | 54.40 | 0.01 |
d 31 | 971 | 1058 | 1177 | 67.51 | 0.13 |
IgG (ug/mL) | |||||
d 0 | 7947 | 7766 | 7286 | 229.95 | 0.14 |
d 14 | 7203 b | 8401 a | 8707 a | 335.08 | 0.01 |
d 31 | 8076 | 7736 | 8780 | 401.23 | 0.20 |
IgM (ug/mL) | |||||
d 0 | 913 | 962 | 934 | 45.80 | 0.76 |
d 14 | 771 y | 986 x | 1007 x | 75.23 | 0.07 |
d 31 | 936 b | 980 b | 1194 a | 70.20 | 0.04 |
CRP (pg/mL) | |||||
d 0 | 278 | 271 | 244 | 21.17 | 0.51 |
d 14 | 343 | 246 | 291 | 31.21 | 0.12 |
d 31 | 213 b | 353 a | 315 a | 34.00 | 0.02 |
Hp (ng/mL) | |||||
d 0 | 482 | 527 | 509 | 31.22 | 0.61 |
d 14 | 546 b | 683 a | 654 a | 24.21 | <0.01 |
d 31 | 695 | 712 | 707 | 18.47 | 0.80 |
Parameter | Treatment | SEM | p-Value | ||
---|---|---|---|---|---|
P0 | P200 | P400 | |||
Duodenum | |||||
Villus height (μm) | 510 | 504 | 495 | 31.48 | 0.94 |
Crypt depth (μm) | 278 | 279 | 296 | 20.43 | 0.78 |
V/C | 1.90 | 1.84 | 1.73 | 0.16 | 0.77 |
Goblet cells (number/μm2) | 93.7 b | 136.3 a | 145.3 a | 8.41 | 0.04 |
Jejunum | |||||
Villus height(μm) | 465 b | 596 a | 464 b | 30.36 | <0.01 |
Crypt depth (μm) | 372 | 330 | 303 | 33.18 | 0.35 |
V/C | 1.37 y | 1.97 x | 1.62 xy | 0.18 | 0.09 |
Goblet cells (number/μm2) | 96.0 b | 112.3 b | 133.1 a | 6.18 | <0.01 |
Ileum | |||||
Villus height (μm) | 474 | 496 | 490 | 29.70 | 0.86 |
Crypt depth (μm) | 462 a | 317 b | 367 ab | 36.06 | 0.03 |
V/C | 1.17 | 1.63 | 1.40 | 0.17 | 0.18 |
Goblet cells (number/μm2) | 81.6 b | 128.5 a | 139.6 a | 6.95 | <0.01 |
Gene expression in ileum | |||||
IL-1β | 0.91 x | 0.46 y | 0.65 xy | 0.13 | 0.09 |
IL-4 | 1.31 a | 0.88 ab | 0.41 b | 0.17 | <0.01 |
IL-6 | 0.93 | 1.62 | 0.22 | 0.59 | 0.27 |
IL-10 | 0.95 | 1.12 | 0.56 | 0.25 | 0.30 |
TNF-α | 1.08 a | 0.90 a | 0.20 b | 0.22 | 0.03 |
MUC2 | 1.18 | 0.97 | 1.05 | 0.19 | 0.75 |
ZO-1 | 0.88 | 0.81 | 0.80 | 0.09 | 0.78 |
CLDN-1 | 0.71 | 1.23 | 0.82 | 0.20 | 0.17 |
OCLN | 0.88 b | 1.11 b | 2.17 a | 0.24 | <0.01 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Xue, L.; Long, S.; Cheng, B.; Song, Q.; Zhang, C.; Hansen, L.H.B.; Sheng, Y.; Zang, J.; Piao, X. Dietary Triple-Strain Bacillus-Based Probiotic Supplementation Improves Performance, Immune Function, Intestinal Morphology, and Microbial Community in Weaned Pigs. Microorganisms 2024, 12, 1536. https://doi.org/10.3390/microorganisms12081536
Xue L, Long S, Cheng B, Song Q, Zhang C, Hansen LHB, Sheng Y, Zang J, Piao X. Dietary Triple-Strain Bacillus-Based Probiotic Supplementation Improves Performance, Immune Function, Intestinal Morphology, and Microbial Community in Weaned Pigs. Microorganisms. 2024; 12(8):1536. https://doi.org/10.3390/microorganisms12081536
Chicago/Turabian StyleXue, Lei, Shenfei Long, Bo Cheng, Qian Song, Can Zhang, Lea Hübertz Birch Hansen, Yongshuai Sheng, Jianjun Zang, and Xiangshu Piao. 2024. "Dietary Triple-Strain Bacillus-Based Probiotic Supplementation Improves Performance, Immune Function, Intestinal Morphology, and Microbial Community in Weaned Pigs" Microorganisms 12, no. 8: 1536. https://doi.org/10.3390/microorganisms12081536
APA StyleXue, L., Long, S., Cheng, B., Song, Q., Zhang, C., Hansen, L. H. B., Sheng, Y., Zang, J., & Piao, X. (2024). Dietary Triple-Strain Bacillus-Based Probiotic Supplementation Improves Performance, Immune Function, Intestinal Morphology, and Microbial Community in Weaned Pigs. Microorganisms, 12(8), 1536. https://doi.org/10.3390/microorganisms12081536