Bovines Harbor a Diverse Array of Vector-Borne Pathogens in Northeast Algeria
Abstract
1. Introduction
2. Results
2.1. Molecular Detection of Anaplasma, Theileria/Babesia, and Hemotropic Mycoplasma Species
2.2. Variability of Vector-Borne Pathogens Infection Associated to Different Intrinsic and Environmental Factors
3. Discussion
4. Materials and Methods
4.1. Ethical Statement
4.2. Sampling and DNA Extraction
4.3. Molecular Detection of Ehrlichia/Anaplasma, Theileria/Babesia, and Hemotropic Mycoplasma species
4.4. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Bursakov, S.A.; Kovalchuk, S.N. Co-infection with tick-borne disease agents in cattle in Russia. Ticks Tick Borne Dis. 2019, 10, 709–713. [Google Scholar] [CrossRef] [Scilit]
- Ghafar, A.; Cabezas-Cruz, A.; Galon, C.; Obregon, D.; Gasser, R.B.; Moutailler, S.; Jabbar, A. Bovine ticks harbour a diverse array of microorganisms in Pakistan. Parasit. Vectors 2020, 13, 1. [Google Scholar] [CrossRef] [Scilit]
- Bouchard, C.; Dibernardo, A.; Koffi, J.; Wood, H.; Leighton, P.; Lindsay, L. Augmentation du risque de maladies transmises par les tiques dans le contexte des changements climatiques et environnementaux. Relev. Mal. Transm. Canada. 2019, 45, 89–98. [Google Scholar] [CrossRef] [Scilit]
- Battilani, M.; de Arcangeli, S.; Balboni, A.; Dondi, F. Genetic diversity and molecular epidemiology of Anaplasma. Infect. Genet. Evolut. 2017, 49, 195–211. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yan, Y.; Jiang, Y.; Tao, D.; Zhao, A.; Qi, M.; Ning, C. Molecular detection of Anaplasma spp. in dairy cattle in southern Xinjiang, China. Vet. Parasitol. Reg. Stud. Reports. 2020, 20, 10040. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dumler, J.S.; Barbet, A.F.; Cornelis, P.J.; Bekker, C.P.J.; Dasch, G.A.; Palmer, G.H.; Ray, S.C.; Rikihisa, Y.; Rurangirwa, F.R. Reorganization of genera in the families Rickettsiaceae and Anaplasmataceae in the order Rickettsiales: Unification of some species of Ehrlichia with Anaplasma, Cowdria with Ehrlichia and Ehrlichia with Neorickettsia, descriptions of six new species. Combi. Int. J. Syst. Evolut. Microbiol. 2001, 51, 2145–2165. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ochirkhuu, N.; Konnai, S.; Odbileg, R.; Murata, S.; Ohashi, K. Molecular epidemiological survey and genetic characterization of Anaplasma species in Mongolian Livestock. Vector Borne Zoonotic Dis. 2017, 17, 539–549. [Google Scholar] [CrossRef] [Scilit]
- Kocan, K.M.; de la Fuente, J.; Blouin, E.F.; Coetzee, J.F.; Ewing, S.A. The natural history of Anaplasma marginale. Vet. Parasitol. 2010, 167, 95–107. [Google Scholar] [CrossRef] [Scilit]
- Byaruhanga, C.; Collins, N.E.; Knobel, D.L.; Khumalo, Z.T.H.; Chaisi, M.E.; Oosthuizen, M.C. Molecular detection and phylogenetic analysis of Anaplasma marginale and Anaplasma centrale amongst transhumant cattle in north-eastern Uganda. Ticks Tick Borne Dis. 2018, 9, 580–588. [Google Scholar] [CrossRef] [Scilit]
- Noaman, V. Molecular detection of Anaplasma bovis in Cattle from central part of Iran. Vet. Res. Forum 2010, 1, 117–122. [Google Scholar]
- Abarca, K.; López, J.; Perret, C.; Guerrero, J.; Godoy, P.; Echeverría, A.V.F.; León, U.; Gutjahr, C.; Azócar, T. Anaplasma platys in Dogs, Chile. Emerg. Infect. Dis. 1990, 13, 1392–1395. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dimosthenis, C.; Ioannis, I.; Tselentis, Y.; Psaroulaki, A. Human anaplasmosis and Anaplasma ovis variant. Emerg. Infect. Dis. 2010, 16, 1031–1032. [Google Scholar] [CrossRef] [Scilit]
- Li, H.; Zheng, Y.C.; Ma, L.; Jia, N.; Jiang, B.G.; Jiang, R.R.; Huo, Q.B.; Wang, Y.W.; Liu, H.B.; Chu, Y.L.; et al. Human infection with a novel tick-borne Anaplasma species in China: A surveillance study. Lancet Infect. Dis. 2015, 15, 663–670. [Google Scholar] [CrossRef] [Scilit]
- Chauvin, A.; Moreau, E.; Bonnet, S.; Plantard, O.; Malandrin, L. Babesia and its hosts: Adaptation to long-lasting interactions as a way achieve efficient transmission. Vet. Res. 2009, 40, 37–40. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nene, V.; Morrison, W.I. Approaches to vaccination against Theileria parva and Theileria annulata. Parasite Immunol. 2016, 38, 724–734. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lorusso, V.; Wijnveld, M.; Majekodunmi, A.O.; Dongkum, C.; Fajinmi, A.; Dogo, A.G.; Thrusfield, M.; Mugenyi, A.; Vaumourin, E.; Igweh, A.C.; et al. Tick-borne pathogens of zoonotic and veterinary importance in Nigerian cattle. Parasites Vectors 2016, 9, 1–13. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bogema, D.R.; Micallef, M.L.; Liu, M.; Padula, M.P.; Djordjevic, S.P.; Darling, A.E.; Jenkins, C. Analysis of Theileria orientalis draft genome sequences reveals potential species-level divergence of the ikeda, chitose and buffeli genotypes. BMC Genom. 2018, 19, 298. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Aktas, M.; Ozubek, S. Molecular and parasitological survey of bovine piroplasms in the black sea region, including the first report of babesiosis associated with Babesia divergens in Turkey. J. Med. Entomol. 2015, 52, 1344–1350. [Google Scholar] [CrossRef] [Scilit]
- Neimark, H.; Johansson, K.E.; Rikihisa, Y.; Tully, J.G. Proposal to transfer some members of the genera Haemobartonella and Eperythrozoon to the genus Mycoplasma with descriptions of ‘Candidatus Mycoplasma haemofelis’, ‘Candidatus Mycoplasma haemomuris’, ‘Candidatus Mycoplasma haemosuis’ and ’Candidatus Mycoplasma wenyonii’. Int. J. Syst. Evolut. Microbiol. 2001, 51, 891–899. [Google Scholar] [CrossRef] [Scilit]
- Tagawa, M.; Yamakawa, K.; Aoki, T.; Matsumoto, K.; Ishi, M.; Inokuma, H. Effect of chronic Hemoplasma infection on cattle productivity. J. Vet. Med. Sci. 2013, 75, 1271–1275. [Google Scholar] [CrossRef] [Scilit]
- Aubry, P.; Geale, D.W. A review of bovine anaplasmosis. Transbound. Emerg. Dis. 2011, 58, 1–30. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ayling, R.D.; Bisgaard-Frantzen, S.; Adler, A.; Blowey, R.W.; Barlow, A.M.; Millar, M.F.; van der Burgt, G.M. Detection of “Candidatus Mycoplasma haemobos”, Mycoplasma wenyonii and Anaplasma phagocytophilum from Cattle in England. Vet. Rec. 2012, 170, 21. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hornok, S.; Micsutka, A.; Meli, M.L.; Lutz, H.; Hofmann-Lehmann, R. molecular investigation of transplacental and vector-borne transmission of bovine Haemoplasmas. Vet. Microbiol. 2011, 152, 411–414. [Google Scholar] [CrossRef] [Scilit]
- Dahmani, M.; Davoust, B.; Benterki, M.S.; Fenollar, F.; Raoult, D.; Mediannikov, O. Development of a new PCR-based assay to detect Anaplasmataceae and the first report of Anaplasma phagocytophilum and Anaplasma platys in cattle from algeria. Comp. Immunol. Microbiol. Infect. Dis. 2015, 39, 39–45. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rjeibi, M.R.; Ayadi, O.; Rekik, M.; Gharbi, M. Molecular survey and genetic characterization of Anaplasma centrale, A. marginale and A. bovis in cattle from algeria. Trans Bound. Emerg. Dis. 2018, 65, 456–464. [Google Scholar] [CrossRef] [Scilit]
- Ziam, H.; Kelanamer, R.; Aissi, M.; Ababou, A.; Berkvens, D.; Geysen, D. Prevalence of bovine theileriosis in north central region of Algeria by real-time polymerase chain reaction with a note on its distribution. Trop. Anim. Health Prod. 2015, 47, 787–796. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hailemariam, Z.; Krucken, J.; Baumann, M.; Ahmed, J.S.; Peter-Henning Clausen, J.P.; Ard, M.; Nijhof, A.M. Molecular detection of tick-borne pathogens in cattle from Southwestern Ethiopia. PLoS ONE 2017, 17, 1–16. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhou, Z.; Li, K.; Sun, Y.; Shi, J.; Li, H.; Chen, Y.; Yang, H.; Li, X.; Wu, B.; Li, Z.; et al. Molecular epidemiology and risk factors of Anaplasma Spp., Babesia Spp. and Theileria Spp. infection in Cattle in Chongqing, China. PLoS ONE 2019, 14, e0215585. [Google Scholar] [CrossRef] [Scilit]
- Belkahia, H.; Ben Said, M.; El Mabrouk, N.; Saidani, M.; Cherni, C.; Ben Hassen, M.; Bouattour, A.; Messadi, L. Spatio-temporal variations and genetic diversity of Anaplasma Spp. in Cattle from the North of Tunisia. Vet. Microbiol. 2017, 208, 223–230. [Google Scholar] [CrossRef] [Scilit]
- Zobba, R.; Anfossi, A.G.; Parpaglia, M.L.P.; Dore, G.M.; Chessa, B.; Spezzigu, A.; Rocca, S.; Visco, S.; Pittau, M.; Alberti, A. Molecular investigation and phylogeny of Anaplasma spp. in Mediterranean ruminants reveal the presence of neutrophil-tropic strains closely related to A. platys. Appl. Environ. Microbiol. 2014, 80, 271–280. [Google Scholar] [CrossRef] [Scilit]
- Ben Said, M.; Belkahia, H.; El Mabrouk, N.; Saidani, M.; Alberti, A.; Zobba, R.; Cherifa, A.; Mahjoub, T.; Bouattour, A.; Messadi, L. Anaplasma platys-like strains in ruminants from Tunisia. Infect. Genet. Evolut. 2017, 49, 226–233. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Walker, A.R.; Bouattour, A.; Camicas, J.; Estrada-Peña, A.; Horak, I.; Latif, A.; Pegram, R.; Preston, P. Ticks of domestic animals in Africa: A guide to identification of species. In Bioscience Reports; The University of Edinburgh: Edinburgh, UK, 2003; pp. 1–221. [Google Scholar]
- Seo, M.G.; Ouha, I.O.; Lee, H.; Geraldino, P.J.L.; Rhee, M.H.; Kwon, O.D.; Kwak, D. Differential Identification of Anaplasma in cattle and potential of cattle to serve as reservoirs of Anaplasma capra, an emerging tick-borne zoonotic pathogen. Vet. Microbiol. 2018, 226, 15–22. [Google Scholar] [CrossRef] [Scilit]
- M’ghirbi, Y.; Hurtado, A.; Brandika, J.; Khlif, K.; Ketata, Z.; Bouattour, A. A molecular survey of Theileria and Babesia Parasites in Cattle, with a note on the distribution of ticks in Tunisia. Parasitol. Res. 2008, 103, 435–442. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Calleja-Bueno, L.; Sainz, Á.; García-Sancho, M.; Rodríguez-Franco, F.; González-Martín, J.V.; Villaescusa, A. Ticks and tick-borne diseases molecular, epidemiological, haematological and biochemical evaluation in asymptomatic Theileria annulata infected cattle from an endemic region in Spain. Ticks Tick Borne Dis. 2017, 8, 936–941. [Google Scholar] [CrossRef] [Scilit]
- Gomes, J.; Salgueiro, P.; Inácio, J.; Amaro, A.; Pinto, J.; Tait, A.; Shiels, B.; da Fonseca, I.P.; Santos-Gomes, G.; Weir, W. Population diversity of Theileria annulata in Portugal. Infect. Genet. Evolut. 2016, 42, 14–19. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dumanli, N.; Aktas, M.; Cetinkaya, B.; Cakmak, A.; Koroglu, E.; Saki, C.E.; Erdogmus, Z.; Nalbantoglu, S.; Ongor, H.; Simsek, S.; et al. Prevalence and distribution of tropical theileriosis in Eastern Turkey. Vet. Parasitol. 2005, 127, 9–15. [Google Scholar] [CrossRef] [Scilit]
- Aktaş, M.; Kısadere, İ.; Özübek, S.; Cihan, H.; Salıkov, R.; Cirak, Y.V. First molecular survey of Piroplasm species in Cattle from Kyrgyzstan. Parasitol. Res. 2019, 118, 2431–2435. [Google Scholar] [CrossRef] [Scilit]
- Benchikh Elfegoun, M.C.; Gharbi, M.; Djebir, S.; Kohil, K. Dynamique d’activité saisonnière des tiques ixodidés parasites des bovins dans deux étages bioclimatiques du nord-est algérien. Rev. D’élev. Méd. Vétér. Pays Trop. 2013, 66, 117–122. [Google Scholar] [CrossRef] [Scilit]
- Nouvel, L.X.; Hygonenq, M.C.; Catays, G.; Martinelli, E.; le Page, P.; Collin, É.; Inokuma, H.; Schelcher, F.; Citti, C.; Maillard, R. First detection of Mycoplasma wenyonii in France: Identification, evaluation of the clinical impact and development of a new specific detection assay. Comp. Immunol. Microbiol. Infect. Dis. 2019, 63, 148–153. [Google Scholar] [CrossRef] [Scilit]
- Ybañez, A.P.; Ybañez, R.H.D.; Armonia, R.K.M.; Chico, J.K.E.; Ferraren, K.J.V.; Tapdasan, E.P.; Salces, C.B.; Maurillo, B.C.A.; Galon, E.M.S.; Macalanda, A.M.C.; et al. First molecular detection of Mycoplasma wenyonii and the ectoparasites biodiversity in dairy water buffalo and cattle in Bohol, Philippines. Parasitol. Int. 2019, 70, 77–81. [Google Scholar] [CrossRef] [Scilit]
- Girotto, A.; Zangirólamo, A.F.; Bogado, A.L.G.; Souza, A.S.L.; da Silva, G.C.F.; Garcia, J.L.; Boas, L.A.V.; Biondo, A.W.; Vidotto, O. Molecular detection and occurrence of ‘Candidatus Mycoplasma haemobos’ in Dairy Cattle of Southern Brazil. Rev. Bras. Parasitol. Vet. 2012, 21, 342–344. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Brown, W.C.; Norimine, J.; Knowles, D.P.; Goff, W.L. Immune control of Babesia bovis infection. Vet. Parasitol. 2006, 138, 75–87. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tagawa, M.; Ybanez, A.P.; Matsumotoa, K.; Yokoyama, N.; Inokuma, H. Interference between Theileria orientalis and hemotropic Mycoplasma spp. (Hemoplasmas) in grazing cattle. Vet. Parasitol. 2013, 195, 165–168. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Parola, P.; Cornet, J.; Ose, Y.; Miller, R.S.; Thien, H.V.; Gonzalez, J.P. Detection of Ehrlichia spp., Anaplasma spp., Rickettsia spp., and other eubacteria in ticks from the Thai-Myanmar border and Vietnam. J. Clin. Microbiol. 2003, 41, 1600–1608. [Google Scholar] [CrossRef] [Scilit]
- Gubbels, J.M.; de Vos, A.P.; van der Weide, M.; Viseras, J.; Schouls, L.M.; de Vries, E.; Jongejan, F. Simultaneous detection of bovine Theileria and Babesia species by reverse line blot hybridization. J. Clin. Microbiol. 1999, 37, 1782–1789. [Google Scholar] [CrossRef] [Scilit]
- Van Kuppeveld, F.J.M.; van der Logt, J.T.M.; Angulo, A.F.; van Zoest, M.J.; Quint, W.G.V.; Niesters, H.G.M.; Galama, J.M.D.; Melchers, W.J.G. Genus- and species-specific identification of Mycoplasmas by 16S rRNA amplification. Appl. Environ. Microbiol. 1992, 58, 2606–2615. [Google Scholar] [CrossRef] [Scilit]
- Rar, V.A.; Fomenko, N.V.; Dobrotvorsky, A.K.; Livanova, N.H.; Rudakova, S.A.; Fedorov, E.G.; Astanin, V.B.; Morozova, O.V. Tick borne pathogen detection, Western Siberia, Russia. Emerg. Infect. Dis. 2005, 11, 1708–1715. [Google Scholar] [CrossRef] [Scilit]
- Courtney, J.W.; Kostelnik, L.M.; Zeidner, N.S.; Massung, R.F. Multiplex real-time PCR for detection of Anaplasma phagocytophilum and Borrelia burgdorferi. J. Clin. Microbiol. 2004, 42, 3164–3168. [Google Scholar] [CrossRef] [Scilit]
- Lew, A.E.; Bock, R.E.; Minchin, C.M.; Masaka, S. A Msp1α polymerase chain reaction assay for specific detection and differentiation of Anaplasma marginale isolates. Vet. Microbiol. 2002, 86, 325–335. [Google Scholar] [CrossRef] [Scilit]
- Kawahara, M.; Rikihisa, Y.; Lin, Q.; Isogai, E.; Tahara, K.; Itagaki, A.; Hiramitsu, Y.; Tajima, T. Novel genetic variants of Anaplasma phagocytophilum, Anaplasma bovis, Anaplasma centrale, and a Novel Ehrlichia sp. in wild deer and ticks on two major islands in Japan. Appl. Environ. Microbiol. 2006, 72, 1102–1109. [Google Scholar] [CrossRef] [Scilit]
- Yang, J.; Liu, Z.; Niu, Q.; Liu, J.; Han, R.; Liu, G.; Shi, Y.; Luo, J.; Yin, H. Molecular survey and characterization of a novel Anaplasma species closely related to Anaplasma capra in Ticks, Northwestern China. Parasites Vectors 2016, 9, 9–13. [Google Scholar] [CrossRef] [Scilit] [PubMed]


| Species | Number of Cases | Total | Frequency (%) | |
|---|---|---|---|---|
| Singleinfection | A. centrale | 14 | ||
| A. marginale | 2 | |||
| A.bovis | 1 | |||
| A.platys | 6 | 57/205 | 27.8 | |
| Anaplasma sp. | 3 | |||
| M. wenyonii | 1 | |||
| ‘Candidatus M. haemobos’ | 1 | |||
| Mycoplasma sp. | 1 | |||
| Anaplasma/Ehrlichia spp. | 7 | |||
| Theileria/Babesia spp. | 21 | |||
| Dual infection | A. centrale, B. occultans | 1 | ||
| A. centrale, T. orientalis | 2 | |||
| A. centrale, Theileria/Babesia spp. | 4 | |||
| A.centrale, M. wenyonii | 1 | |||
| A. centrale, ‘Candidatus M. haemobos’ | 1 | 27/205 | 13.2 | |
| A. centrale, A. marginale | 11 | |||
| Uncultured Anaplasma sp., Theileria sp. | 1 | |||
| Uncultured Anaplasma sp., T. orientalis | 1 | |||
| Uncultured Anaplasma sp., Theileria/Babesia spp. | 1 | |||
| Anaplasma/Ehrlichia spp., Theileria/Babesia spp. | 4 | |||
| Triple infection | A. centrale, A. marginale, T. annulata | 1 | ||
| A. centrale, A. marginale, T. orientalis | 1 | 3/205 | 1.4 | |
| A. centrale, T. annulata, M. wenyonii | 1 | |||
| Overall | 87 | 87/205 | 42.4 | |
| Cattle Group | Category | Number of Cattle | PCR Results | |||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Overall Infection | p (χ2) Value | Ehrlichia/ Anaplasma | p (χ2) Value | Theileria/ Babesia | p (χ2) Value | Hemotropic Mycoplasma | p (χ2) Value | |||
| Gender | Male | 24 | 12 (50%) | 0.4 | 7 (29.1%) | 0.8 | 8 (33.3%) | 0.04 | 2 (8.3%) | 0.09 |
| Female | 181 | 75 (41.4%) | 56 (31%) | 30 (16.5%) | 4 (2.2%) | |||||
| Age (year) | <3 years | 75 | 41 (54.6%) | 0.007 | 31 (41%) | 0.02 | 20 (26.6%) | 0.02 | 3 (4%) | 0.49 |
| ≥3 years | 130 | 46 (35.3%) | 32 (24.6%) | 18 (13.8%) | 3 (2.3%) | |||||
| Farming system | Intensive | 36 | 8 (22.2%) | 0.007 | 4 (11.1%) | 0.005 | 5 (13.8%) | 0.42 | 0 | 0.24 |
| Semi/extensive | 169 | 79 (46.7%) | 59 (34.9%) | 33 (19.5%) | 6 (3.5%) | |||||
| Ticks | Present | 105 | 50 (47.6%) | 0.14 | 42 (40%) | 0.004 | 20 (19%) | 0.82 | 4 (3.8%) | 0.43 |
| Absent | 100 | 37 (37%) | 21 (21%) | 18 (18%) | 2 (2%) | |||||
| Ticks load | <10 | 80 | 36 (45%) | 0.37 | 30 (37.8%) | 0.82 | 14 (17.5%) | 0.80 | 3 (3.7%) | 0.80 |
| 10–20 | 18 | 9 (50%) | 8 (42.4%) | 4 (31.5%) | 1 (5.5%) | |||||
| >20 | 7 | 5 (71.4%) | 4 (57.1%) | 2 (28.5%) | 0 | |||||
| Pathogen | Target Gene | Primer Name | Sequence (5’-3’) | Hybridization (T °C) | Length (pb) | Reference |
|---|---|---|---|---|---|---|
| Ehrlichia/ Anaplasma | RNA 16S | EHR1 16S F | GGTACCYACAGAAGAAGTCC | 52 | 346 | [45] |
| EHR1 16S R | TAGCACTCATCGTTTACAGC | |||||
| Nested PCR Ehrlichia/ Anaplasma | RNA 16S | EHR1 F | GAACGAACGCTGGCGGCAAGC | 60 | 693 | [48] |
| EHR2 R | AGTA(T/C)CG(A/G)ACCAGATAGCCGC | |||||
| EHR3 F | TGCATAGGAATCTACCTAGTAG | 55 | 592 | |||
| EHR2 R | AGTA(T/C)CG(A/G)ACCAGATAGCCGC | |||||
| qPCR A. phagocytophilum | msp2 | APH F | ATG GAA GGT AGT GTT GGT TAT GGT ATT | 60 | 77 | [49] |
| APH R | TTG GTC TTG AAG CGC TCG TA | |||||
| APH P | TGG TGC CAG GGT TGA GCT TGA GAT TG | |||||
| A. marginale | msp1 | Msp1 a F | TGTGCTTATGGCAGACATTTCC | 55 | 1224 | [50] |
| Msp1 a R | AAACCTTGTAGCCCAACTTATCC | |||||
| A. centrale | RNA 16S | AC1f | CTGCTTTTAATACTGCAGGACTA | 55 | 426 | [51] |
| AC1r | ATGCAGCACCTGTGAGGT | |||||
| A. bovis | RNA 16S | AB1 F | CTCGTAGCTTGCTATGAGAAC | 55 | 551 | |
| AB1 R | TCTCCCGGCTCCAGTCTG | |||||
| A. capra | RNA 16S | A. capra F | GCAAGTCGAACGGACCAAATCTGT | 58 | 1261 | [52] |
| A. capra R | CCACGATTACTAGCGATTCCGACTTC | |||||
| Mycoplasma | RNA 16S | GP03 F | GGGAGCAAACA GGATTAGATA | 55 | 280 | [47] |
| MGSO R | TGCACCATCTGTCACTCTGTTAACCTC | |||||
| Theileria/Babesia | RNA 16S | RLB-F | GAGGTAGTGACAAGAAATAACAATA | 50 | 502 | [46] |
| RLB-R | TCTTCGATCCCCTAACTTTC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Boularias, G.; Azzag, N.; Gandoin, C.; Bouillin, C.; Chomel, B.; Haddad, N.; Boulouis, H.-J. Bovines Harbor a Diverse Array of Vector-Borne Pathogens in Northeast Algeria. Pathogens 2020, 9, 883. https://doi.org/10.3390/pathogens9110883
Boularias G, Azzag N, Gandoin C, Bouillin C, Chomel B, Haddad N, Boulouis H-J. Bovines Harbor a Diverse Array of Vector-Borne Pathogens in Northeast Algeria. Pathogens. 2020; 9(11):883. https://doi.org/10.3390/pathogens9110883
Chicago/Turabian StyleBoularias, Ghania, Naouelle Azzag, Christelle Gandoin, Corinne Bouillin, Bruno Chomel, Nadia Haddad, and Henri-Jean Boulouis. 2020. "Bovines Harbor a Diverse Array of Vector-Borne Pathogens in Northeast Algeria" Pathogens 9, no. 11: 883. https://doi.org/10.3390/pathogens9110883
APA StyleBoularias, G., Azzag, N., Gandoin, C., Bouillin, C., Chomel, B., Haddad, N., & Boulouis, H.-J. (2020). Bovines Harbor a Diverse Array of Vector-Borne Pathogens in Northeast Algeria. Pathogens, 9(11), 883. https://doi.org/10.3390/pathogens9110883
