Contrasting Effect of Curcumin on Hepatitis B Virus Replication According to the Hepatoma Cell Line
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Culture and Treatment
2.2. Transfection
2.3. Cell Viability Assay
2.4. Analysis of Capsid-Associated HBV DNA
2.5. Analysis of HBV RNA
2.6. Antigen Quantification
2.7. Cell Cycle Analysis
2.8. Cellular mRNA Quantification
2.9. Statistical Analysis
3. Results
3.1. HepG22.15 and Huh7 Cells Exhibit Different Susceptibility to Curcumin
3.2. Curcumin Induces Contrasting Effects on HBV Replicative Capacity in HepG22.15 and Huh-7 Cell Lines
3.3. Curcumin Unevenly Modulates Cell Cycle Progression in HepG22.15 and Huh-7 Cell Lines
3.4. Curcumin Induces Differential Gene Expression in HepG22.15 and Huh-7 Cell Lines
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- World Health Organization WHO|Hepatitis B. Available online: https://www.who.int/news-room/fact-sheets/detail/hepatitis-b (accessed on 1 September 2024).
- Matsumoto, A.; Nishiguchi, S.; Enomoto, H.; Tanaka, Y.; Shinkai, N.; Okuse, C.; Kang, J.H.; Matsui, T.; Miyase, S.; Yatsuhashi, H.; et al. Pilot Study of Tenofovir Disoproxil Fumarate and Pegylated Interferon-Alpha 2a Add-on Therapy in Japanese Patients with Chronic Hepatitis B. J. Gastroenterol. 2020, 55, 977–989. [Google Scholar] [CrossRef] [PubMed]
- Lee, H.W.; Lee, J.S.; Ahn, S.H. Hepatitis B Virus Cure: Targets and Future Therapies. Int. J. Mol. Sci. 2021, 22, 213. [Google Scholar] [CrossRef] [PubMed]
- Jose-Abrego, A.; Rivera-Iñiguez, I.; Torres-Reyes, L.A.; Roman, S. Anti-Hepatitis B Virus Activity of Food Nutrients and Potential Mechanisms of Action. Ann. Hepatol. 2023, 28, 100766. [Google Scholar] [CrossRef] [PubMed]
- Kim, H.J.; Yoo, H.S.; Kim, J.C.; Park, C.S.; Choi, M.S.; Kim, M.; Choi, H.; Min, J.S.; Kim, Y.S.; Yoon, S.W.; et al. Antiviral Effect of Curcuma Longa Linn Extract against Hepatitis B Virus Replication. J. Ethnopharmacol. 2009, 124, 189–196. [Google Scholar] [CrossRef]
- Wei, Z.Q.; Zhang, Y.H.; Ke, C.Z.; Chen, H.X.; Ren, P.; He, Y.L.; Hu, P.; Ma, D.Q.; Luo, J.; Meng, Z.J. Curcumin Inhibits Hepatitis B Virus Infection by Down-Regulating CccDNA-Bound Histone Acetylation. World J. Gastroenterol. 2017, 23, 6252–6260. [Google Scholar] [CrossRef]
- Thongsri, P.; Pewkliang, Y.; Borwornpinyo, S.; Wongkajornsilp, A.; Hongeng, S.; Sa-ngiamsuntorn, K. Curcumin Inhibited Hepatitis B Viral Entry through NTCP Binding. Sci. Rep. 2021, 11, 19125. [Google Scholar] [CrossRef]
- Mouler Rechtman, M.; Har-Noy, O.; Bar-Yishay, I.; Fishman, S.; Adamovich, Y.; Shaul, Y.; Halpern, Z.; Shlomai, A. Curcumin Inhibits Hepatitis B Virus via Down-Regulation of the Metabolic Coactivator PGC-1α. FEBS Lett. 2010, 584, 2485–2490. [Google Scholar] [CrossRef]
- Valentine, C.; Ohnishi, K.; Irie, K.; Murakami, A. Curcumin May Induce Lipolysis via Proteo-Stress in Huh7 Human Hepatoma Cells. J. Clin. Biochem. Nutr. 2019, 65, 91–98. [Google Scholar] [CrossRef]
- Ali, M.; Asghar, E.; Ali, W.; Mustafa, G.; Ansari, I.A.; Zia, S.; Ansari, S.A.; Khan, S. Screening of Multitarget Compounds against Acetaminophen Hepatic Toxicity Using In Silico, In Vitro, and In Vivo Approaches. Molecules 2024, 29, 428. [Google Scholar] [CrossRef]
- Suwannasom, N.; Sriaksorn, N.; Thepmalee, C.; Khoothiam, K.; Prapan, A.; Bäumler, H.; Thephinlap, C. Curcumin-Loaded Albumin Submicron Particles with Potential as a Cancer Therapy: An in Vitro Study. Beilstein J. Nanotechnol. 2023, 14, 1127–1140. [Google Scholar] [CrossRef]
- Kinge, C.N.W.; Bhoola, N.H.; Kramvis, A. In Vitro Systems for Studying Different Genotypes/Sub-Genotypes of Hepatitis B Virus: Strengths and Limitations. Viruses 2020, 12, 353. [Google Scholar] [CrossRef] [PubMed]
- Arzumanian, V.; Pyatnitskiy, M.; Poverennaya, E. Comparative Transcriptomic Analysis of Three Common Liver Cell Lines. Int. J. Mol. Sci. 2023, 24, 8791. [Google Scholar] [CrossRef] [PubMed]
- Guo, H.; Urban, S.; Wang, W. In Vitro Cell Culture Models to Study Hepatitis B and D Virus Infection. Front. Microbiol. 2023, 14, 1169770. [Google Scholar] [CrossRef] [PubMed]
- Lee, G.S.; Purdy, M.A.; Choi, Y. Cell Culture Systems for Studying Hepatitis B and Hepatitis D Virus Infections. Life 2023, 13, 1527. [Google Scholar] [CrossRef]
- Günther, S.; Li, B.C.; Miska, S.; Krüger, D.H.; Meisel, H.; Will, H. A Novel Method for Efficient Amplification of Whole Hepatitis B Virus Genomes Permits Rapid Functional Analysis and Reveals Deletion Mutants in Immunosuppressed Patients. J. Virol. 1995, 69, 5437–5444. [Google Scholar] [CrossRef]
- Sells, M.A.; Chen, M.L.; Acs, G. Production of Hepatitis B Virus Particles in Hep G2 Cells Transfected with Cloned Hepatitis B Virus DNA. Proc. Natl. Acad. Sci. USA 1987, 84, 1005–1009. [Google Scholar] [CrossRef]
- Elizalde, M.M.; Giadans, C.G.; Campos, R.H.; Flichman, D.M. Impact of Core Protein Naturally Selected Mutants Associated with HBeAg-negative Status in HBV Biosynthesis. J. Med. Virol. 2023, 95, e29195. [Google Scholar] [CrossRef]
- Elizalde, M.M.; Mojsiejczuk, L.; Speroni, M.; Bouzas, B.; Tadey, L.; Mammana, L.; Campos, R.H.; Flichman, D.M. Molecular and Biological Characterization of Hepatitis B Virus Subgenotype F1b Clusters: Unraveling Its Role in Hepatocarcinogenesis. Front. Microbiol. 2022, 13, 946703. [Google Scholar] [CrossRef]
- Laras, A.; Koskinas, J.; Dimou, E.; Kostamena, A.; Hadziyannis, S.J. Intrahepatic Levels and Replicative Activity of Covalently Closed Circular Hepatitis B Virus DNA in Chronically Infected Patients. Hepatology 2006, 44, 694–702. [Google Scholar] [CrossRef]
- Laras, A.; Koskinas, J.; Hadziyannis, S.J. In Vivo Suppression of Precore MRNA Synthesis Is Associated with Mutations in the Hepatitis B Virus Core Promoter. Virology 2002, 295, 86–96. [Google Scholar] [CrossRef]
- Xia, Y.; Cheng, X.; Li, Y.; Valdez, K.; Chen, W.; Liang, T.J. Hepatitis B Virus Deregulates the Cell Cycle To Promote Viral Replication and a Premalignant Phenotype. J. Virol. 2018, 92, e00722-18. [Google Scholar] [CrossRef] [PubMed]
- Butnariu, M.; Quispe, C.; Koirala, N.; Khadka, S.; Salgado-Castillo, C.M.; Akram, M.; Anum, R.; Yeskaliyeva, B.; Cruz-Martins, N.; Kumar, M.M.M.; et al. Bioactive Effects of Curcumin in Human Immunodeficiency Virus Infection Along with the Most Effective Isolation Techniques and Type of Nanoformulations. Int. J. Nanomed. 2022, 17, 3619–3632. [Google Scholar] [CrossRef] [PubMed]
- Balasubramanian, A.; Pilankatta, R.; Teramoto, T.; Sajith, A.M.; Nwulia, E.; Kulkarni, A.; Padmanabhan, R. Inhibition of Dengue Virus by Curcuminoids. Antiviral Res. 2019, 162, 71–78. [Google Scholar] [CrossRef] [PubMed]
- Šudomová, M.; Hassan, S.T.S. Nutraceutical Curcumin with Promising Protection against Herpesvirus Infections and Their Associated Inflammation: Mechanisms and Pathways. Microorganisms 2021, 9, 292. [Google Scholar] [CrossRef] [PubMed]
- Nittayananta, W.; Lerdsamran, H.; Chutiwitoonchai, N.; Promsong, A.; Srichana, T.; Netsomboon, K.; Prasertsopon, J.; Kerdto, J. A Novel Film Spray Containing Curcumin Inhibits SARS-CoV-2 and Influenza Virus Infection and Enhances Mucosal Immunity. Virol. J. 2024, 21, 26. [Google Scholar] [CrossRef] [PubMed]
- Hu, A.; Huang, J.J.; Zhang, J.F.; Dai, W.J.; Li, R.L.; Lu, Z.Y.; Duan, J.L.; Li, J.P.; Chen, X.P.; Fan, J.P.; et al. Curcumin Induces G2/M Cell Cycle Arrest and Apoptosis of Head and Neck Squamous Cell Carcinoma in Vitro and in Vivo through ATM/Chk2/P53-Dependent Pathway. Oncotarget 2017, 8, 50747–50760. [Google Scholar] [CrossRef]
- Dai, J.; Gu, L.; Su, Y.; Wang, Q.; Zhao, Y.; Chen, X.; Deng, H.; Li, W.; Wang, G.; Li, K. Inhibition of Curcumin on Influenza A Virus Infection and Influenzal Pneumonia via Oxidative Stress, TLR2/4, P38/JNK MAPK and NF-ΚB Pathways. Int. Immunopharmacol. 2018, 54, 177–187. [Google Scholar] [CrossRef]
- Colpitts, C.C.; Schang, L.M.; Rachmawati, H.; Frentzen, A.; Pfaender, S.; Behrendt, P.; Brown, R.J.; Bankwitz, D.; Steinmann, J.; Ott, M.; et al. Turmeric Curcumin Inhibits Entry of All Hepatitis C Virus Genotypes into Human Liver Cells. Gut 2014, 63, 1137–1149. [Google Scholar] [CrossRef]
- Teng, C.F.; Yu, C.H.; Chang, H.Y.; Hsieh, W.C.; Wu, T.H.; Lin, J.H.; Wu, H.C.; Jeng, L.B.; Su, I.J. Chemopreventive Effect of Phytosomal Curcumin on Hepatitis B Virus-Related Hepatocellular Carcinoma in A Transgenic Mouse Model. Sci. Rep. 2019, 9, 10338. [Google Scholar] [CrossRef]
- Fan, Z.; Duan, X.; Cai, H.; Wang, L.; Li, M.; Qu, J.; Li, W.; Wang, Y.; Wang, J. Curcumin Inhibits the Invasion of Lung Cancer Cells by Modulating the PKCα/Nox-2/ROS/ATF-2/MMP-9 Signaling Pathway. Oncol. Rep. 2015, 34, 691–698. [Google Scholar] [CrossRef]
- Shakibaei, M.; Buhrmann, C.; Kraehe, P.; Shayan, P.; Lueders, C.; Goel, A. Curcumin Chemosensitizes 5-Fluorouracil Resistant MMR-Deficient Human Colon Cancer Cells in High Density Cultures. PLoS ONE 2014, 9, e85397. [Google Scholar] [CrossRef] [PubMed]
- Sha, J.; Li, J.; Wang, W.; Pan, L.; Cheng, J.; Li, L.; Zhao, H.; Lin, W. Curcumin Induces G0/G1 Arrest and Apoptosis in Hormone Independent Prostate Cancer DU-145 Cells by down Regulating Notch Signaling. Biomed. Pharmacother. 2016, 84, 177–184. [Google Scholar] [CrossRef] [PubMed]
- Martínez-Castillo, M.; Villegas-Sepúlveda, N.; Meraz-Rios, M.A.; Hernández-Zavala, A.; Berumen, J.; Coleman, M.A.; Orozco, L.; Cordova, E.J. Curcumin Differentially Affects Cell Cycle and Cell Death in Acute and Chronic Myeloid Leukemia Cells. Oncol. Lett. 2018, 15, 6777–6783. [Google Scholar] [CrossRef] [PubMed]
- El-Saadony, M.T.; Yang, T.; Korma, S.A.; Sitohy, M.; Abd El-Mageed, T.A.; Selim, S.; Al Jaouni, S.K.; Salem, H.M.; Mahmmod, Y.; Soliman, S.M.; et al. Impacts of Turmeric and Its Principal Bioactive Curcumin on Human Health: Pharmaceutical, Medicinal, and Food Applications: A Comprehensive Review. Front. Nutr. 2023, 9, 1040259. [Google Scholar] [CrossRef]
- He, Y.; Xu, K.; Keiner, B.; Zhou, J.; Czudai, V.; Li, T.; Chen, Z.; Liu, J.; Klenk, H.-D.; Shu, Y.L.; et al. Influenza A Virus Replication Induces Cell Cycle Arrest in G0/G1 Phase. J. Virol. 2010, 84, 12832–12840. [Google Scholar] [CrossRef]
- Kannan, R.P.; Hensley, L.L.; Evers, L.E.; Lemon, S.M.; McGivern, D.R. Hepatitis C Virus Infection Causes Cell Cycle Arrest at the Level of Initiation of Mitosis. J. Virol. 2011, 85, 7989–8001. [Google Scholar] [CrossRef]
- Wang, J.; Reuschel, E.L.; Shackelford, J.M.; Jeang, L.; Shivers, D.K.; Diehl, J.A.; Yu, X.F.; Finkel, T.H. HIV-1 Vif Promotes the G1- to S-Phase Cell-Cycle Transition. Blood 2011, 117, 1260–1269. [Google Scholar] [CrossRef]
- Yang, Y.; Yan, Y.; Chen, Z.; Hu, J.; Wang, K.; Tang, N.; Li, X.; Zhou, Z. Histone Deacetylase Inhibitors Romidepsin and Vorinostat Promote Hepatitis b Virus Replication by Inducing Cell Cycle Arrest. J. Clin. Transl. Hepatol. 2021, 9, 160–168. [Google Scholar] [CrossRef]
- Xu, L.; Tu, Z.; Xu, G.; Hu, J.L.; Cai, X.F.; Zhan, X.X.; Wang, Y.W.; Huang, Y.; Chen, J.; Huang, A.L. S-Phase Arrest after Vincristine Treatment May Promote Hepatitis B Virus Replication. World J. Gastroenterol. 2015, 21, 1498–1509. [Google Scholar] [CrossRef]
Primer | Sequence (5′-3′) |
---|---|
CCND2 Fw | GAGGAACAGAAGTGCGAAGAA |
CCND2 Rv | CATGGCAAACTTAAAGTCGGT |
CDKN2A Fw | AACCTCGGGAAACTTAGAT |
CDKN2A Rv | ATGGACATTTACGGTAGTGGG |
TGFB Fw | ACAAGCCCAGAGAGGTTAAGG |
TGFB Rv | TGCTAGGATTACAGGCGTGAG |
GADD45B Fw | GCAACATGACGCTGGAAGAG |
GADD45B Rv | GGATGAGCGTGAAGTGGATT |
MHS2 Fw | CTACGATGGATTTGGGTTAGC |
MHS2 Rv | TGCGATTCTCCAATATACTGA |
BAX Fw | ATGGGCTGGACATTGGACTTC |
BAX Rv | GATGGTGAGTGAGGCGGTGAG |
BCL-2 Fw | AGATTGATGGGATCGTTGCCT |
BCL-2 Rv | ATCTCCCGCATCCCACTCGTA |
FAS Fw | AATGCCCAAGTGACTGACATC |
FAS Rv | GGGCTTTGTCTGTGTACTCCT |
C/EBPβ Fw | GACACGGGACTGACGCAACAC |
C/EBPβ Rv | CAACAACCCCGCAGGAACATCT |
GAPDH Fw | CTCTGACTTCAACAGCGACAC |
GAPDH Fw | AGCCAAATTCGTTGTCATAC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Elizalde, M.M.; Fuentes, P.; Chiappetta, D.; Flichman, D.M. Contrasting Effect of Curcumin on Hepatitis B Virus Replication According to the Hepatoma Cell Line. Pathogens 2025, 14, 203. https://doi.org/10.3390/pathogens14020203
Elizalde MM, Fuentes P, Chiappetta D, Flichman DM. Contrasting Effect of Curcumin on Hepatitis B Virus Replication According to the Hepatoma Cell Line. Pathogens. 2025; 14(2):203. https://doi.org/10.3390/pathogens14020203
Chicago/Turabian StyleElizalde, María Mercedes, Pedro Fuentes, Diego Chiappetta, and Diego Martín Flichman. 2025. "Contrasting Effect of Curcumin on Hepatitis B Virus Replication According to the Hepatoma Cell Line" Pathogens 14, no. 2: 203. https://doi.org/10.3390/pathogens14020203
APA StyleElizalde, M. M., Fuentes, P., Chiappetta, D., & Flichman, D. M. (2025). Contrasting Effect of Curcumin on Hepatitis B Virus Replication According to the Hepatoma Cell Line. Pathogens, 14(2), 203. https://doi.org/10.3390/pathogens14020203