No Clinical Symptom Experienced after Consumption of Berry Fruits with Positive RT-qPCR Signals of Human Norovirus
Abstract
:1. Introduction
2. Results and Discussion
3. Materials and Methods
3.1. Human Volunteer Study Organization
3.2. Detection of Fucα1-2Gal and HBGA Phenotyping in Saliva Samples
3.3. Virus Extraction Procedures from Berry Samples Based on ISO 15216-2
3.4. Virus Extraction from Stool Samples
3.5. RNA Extraction and RT-qPCR Analyses
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Atmar, R.L.; Estes, M.K. The epidemiologic and clinical importance of norovirus infection. Gastroenterol. Clin. 2006, 35, 275–290. [Google Scholar] [CrossRef]
- Bozkurt, H.; Phan-Thien, K.-Y.; van Ogtrop, F.; Bell, T.; McConchie, R. Outbreaks, occurrence, and control of norovirus and hepatitis a virus contamination in berries: A review. Crit. Rev. Food Sci. Nutr. 2021, 61, 116–138. [Google Scholar] [CrossRef]
- Mäde, D.; Trübner, K.; Neubert, E.; Höhne, M.; Johne, R. Detection and typing of norovirus from frozen strawberries involved in a large-scale gastroenteritis outbreak in Germany. Food Environ. Virol. 2013, 5, 162–168. [Google Scholar] [CrossRef] [Green Version]
- Rispens, J.R.; Freeland, A.; Wittry, B.; Kramer, A.; Barclay, L.; Vinjé, J.; Treffiletti, A.; Houston, K. Notes from the Field: Multiple Cruise Ship Outbreaks of Norovirus Associated with Frozen Fruits and Berries—United States, 2019. Morb. Mortal. Wkly. Rep. 2020, 69, 501. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ettayebi, K.; Crawford, S.E.; Murakami, K.; Broughman, J.R.; Karandikar, U.; Tenge, V.R.; Neill, F.H.; Blutt, S.E.; Zeng, X.L.; Qu, L.; et al. Replication of human noroviruses in stem cell–derived human enteroids. Science 2016, 353, 1387. [Google Scholar] [CrossRef] [PubMed]
- Jones, M.K.; Grau, K.R.; Costantini, V.; Kolawole, A.O.; De Graaf, M.; Freiden, P.; Graves, C.L.; Koopmans, M.; Wallet, S.M.; Tibbetts, S.A. Human norovirus culture in B cells. Nat. Protoc. 2015, 10, 1939. [Google Scholar] [CrossRef] [Green Version]
- Van Dycke, J.; Ny, A.; Conceição-Neto, N.; Maes, J.; Hosmillo, M.; Cuvry, A.; Goodfellow, I.; Nogueira, T.C.; Verbeken, E.; Matthijnssens, J. A robust human norovirus replication model in zebrafish larvae. PLoS Pathog. 2019, 15, e1008009. [Google Scholar] [CrossRef] [Green Version]
- Richards, G.P. Critical review of norovirus surrogates in food safety research: Rationale for considering volunteer studies. Food Environ. Virol. 2012, 4, 6–13. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cook, N.; Williams, L.; D’Agostino, M. Prevalence of Norovirus in produce sold at retail in the United Kingdom. Food Microbiol. 2019, 79, 85–89. [Google Scholar] [CrossRef]
- Gao, X.; Wang, Z.; Wang, Y.; Liu, Z.; Guan, X.; Ma, Y.; Zhou, H.; Jiang, Y.; Cui, W.; Wang, L. Surveillance of norovirus contamination in commercial fresh/frozen berries from Heilongjiang Province, China, using a TaqMan real-time RT-PCR assay. Food Microbiol. 2019, 82, 119–126. [Google Scholar] [CrossRef]
- Zhao, M.Y.; Li, D. Discovery of Components Acting as the Obstacles in the Detection of Enteric Viruses from Berries. Food Environ. Virol. 2020, 12, 191–197. [Google Scholar] [CrossRef] [PubMed]
- Tan, M.; Jin, M.; Xie, H.; Duan, Z.; Jiang, X.; Fang, Z. Outbreak studies of a GII-3 and a GII-4 norovirus revealed an association between HBGA phenotypes and viral infection. J. Med. Virol. 2008, 80, 1296–1301. [Google Scholar] [CrossRef] [PubMed]
- Tan, M.; Jiang, X. Norovirus gastroenteritis, carbohydrate receptors, and animal models. PLoS Pathog. 2010, 6, e1000983. [Google Scholar] [CrossRef] [PubMed]
- Sun, X.; Guo, N.; Li, J.; Yan, X.; He, Z.; Li, D.; Jin, M.; Xie, G.; Pang, L.; Zhang, Q. Rotavirus infection and histo-blood group antigens in the children hospitalized with diarrhoea in China. Clin. Microbiol. Infect. 2016, 22, 740. [Google Scholar] [CrossRef] [Green Version]
- Kobayashi, D.; Yokota, K.; Yamagata-Uyama, S.; Saito, M. Factors associated with the detection of norovirus among asymptomatic adults. Clin. Microbiol. Infect. 2021, in press. [Google Scholar] [CrossRef]
- Nordgren, J.; Svensson, L. Genetic susceptibility to human norovirus infection: An update. Viruses 2019, 11, 226. [Google Scholar] [CrossRef] [Green Version]
- Roth, A.N.; Karst, S.M. Norovirus mechanisms of immune antagonism. Curr. Opin. Virol. 2016, 16, 24–30. [Google Scholar] [CrossRef] [Green Version]
- Lowther, J.A.; Gustar, N.E.; Hartnell, R.E.; Lees, D.N. Comparison of norovirus RNA levels in outbreak-related oysters with background environmental levels. J. Food Prot. 2012, 75, 389–393. [Google Scholar] [CrossRef]
- Knight, A.; Li, D.; Uyttendaele, M.; Jaykus, L.-A. A critical review of methods for detecting human noroviruses and predicting their infectivity. Crit. Rev. Microbiol. 2013, 39, 295–309. [Google Scholar] [CrossRef]
- Li, D.; Zhao, M.Y.; Tan, T.H.M. What makes a foodborne virus: Comparing coronaviruses with human noroviruses. Curr. Opin. Food Sci. 2021, 42, 1–7. [Google Scholar] [CrossRef]
- Nordgren, J.; Sharma, S.; Bucardo, F.; Nasir, W.; Günaydın, G.; Ouermi, D.; Nitiema, L.W.; Becker-Dreps, S.; Simpore, J.; Hammarström, L. Both Lewis and secretor status mediate susceptibility to rotavirus infections in a rotavirus genotype–dependent manner. Clin. Infect. Dis. 2014, 59, 1567–1573. [Google Scholar] [CrossRef] [PubMed] [Green Version]

| Saliva Phenotypes of the Cohort Consumed Berries with Positive hNoV RT-qPCR Signals | RT-qPCR Detection (Ct Values) of hNoVs from Stool Samples of the Cohort before Berry Consumption | RT-qPCR Detection Results (Ct Values) of hNoVs (GI and GII) from Berry Samples with Recovery Rates Higher than 1% | ||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Fucα1-2Gal-R | A | B | H1 | Lea | Leb | Lex | Ley | GI | GII | |
| + | + | - | - | + | + | - | + | 39.7 | NA | Fresh raspberry (GI 37.1); Fresh strawberry (GI 37.3) |
| + | + | - | - | - | + | + | + | NA | 36.8 | Frozen raspberry (GI 35.3, GII 35.3) |
| + | + | - | - | + | - | + | + | 39.9 | NA | Fresh strawberry (GI 36.0) |
| + | + | - | - | + | + | + | + | 38.6 | NA | Frozen raspberry (GI 35.3, GII 34.6) |
| + | - | + | - | + | + | - | + | NA | NA | Frozen strawberry (GI 34.4); Frozen raspberry (GI 38.7) |
| + | - | + | - | - | + | - | + | NA | 36.1 | Fresh strawberry (GI 39.7); Fresh strawberry (GII 39.5) |
| + | - | + | - | - | + | - | + | NA | NA | Fresh strawberry (GI 39.5); Frozen strawberry (GI 39.6) |
| + | + | + | - | + | + | - | + | 38.5 | NA | Fresh raspberry (GI 38.5) |
| + | + | + | - | + | + | + | + | NA | NA | Fresh strawberry (GI 40.0, GII 38.0); Fresh strawberry (GI 40.0) |
| + | - | - | + | - | - | - | + | NA | 34.7 | Fresh strawberry (GI 39.1) |
| + | - | - | + | + | + | + | + | NA | NA | Fresh strawberry (GI 38.6); Frozen strawberry (GI 34.9, GII 37.2) |
| + | - | - | - | - | + | - | + | NA | 38.3 | Fresh strawberry (GI 35.5); Fresh strawberry (GI 39.7); Fresh raspberry (GI 39.1) |
| + | - | - | - | - | + | - | + | NA | 37.3 | Frozen strawberry (GI 39.5) |
| - | - | - | - | + | + | + | + | NA | 37.7 | Frozen raspberry (GI 34.1); Fresh strawberry (GI 38.5, GII 36.8); Fresh strawberry (GI 32.9, GII 36.2); Fresh strawberry (GI 38.9) |
| - | - | - | - | + | + | + | + | NA | NA | Fresh strawberry (GI 34.8) |
| - | - | - | - | - | + | + | - | NA | NA | Fresh strawberry (GI 37.7, GII 36.0); Fresh strawberry (GI 38.2) |
| Target | Sequence of Primer, Probe and Plasmids Inserts (5′-3′) | PCR Annealing and Extension Conditions | References | |
|---|---|---|---|---|
| hNoV GI | Forward Primer | CGC TGG ATG CGN TTC CAT | Annealing: 60 °C, 30 s Extension: 72 °C, 30 s | ISO15216:2017 |
| Reverse Primer | CCT TAG ACG CCA TCA TCA TTT AC | |||
| Probe | FAM-TGG ACA GGA GAY CGC RAT CT-TAMRA | |||
| Plasmid Insert | CGCTGGATGCGCTTCCATGACCTCGGATTGTGGACAGGAGATCGCGATCTTCTGCGGATCCGAATTCGTAAATGATGATGGCGTCTAAGG | |||
| hNoV GII | Forward Primer | ATG TTC AGR TGG ATG AGR TTC TCW GA | Annealing: 6 °C, 30 s Extension: 72 °C, 30 s | ISO15216:2017 |
| Reverse Primer | TCG ACG CCA TCT TCA TTC ACA | |||
| Probe | FAM-AGC ACG TGG GAG GGC GAT CG-TAMRA | |||
| Plasmid Insert | ATGTTCAGATGGATGAGATTCTCAGATCTGAGCACGTGGGAGGGCGATCGCAATCTGGCTCGGATCCCCAGCTTTGTGAATGAAGATGGCGTCGA | |||
| MS2 | Forward Primer | GCT CTG AGA GCG GCT CTA TTG | Annealing: 60 °C,1 min | [11] |
| Reverse Primer | CGT TAT AGC GGA CCG CGT | |||
| Probe | FAM-CCG AGA CCA ATG TGC GCC GTG-TAMRA | |||
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Eshaghi Gorji, M.; Tan, M.T.H.; Zhao, M.Y.; Li, D. No Clinical Symptom Experienced after Consumption of Berry Fruits with Positive RT-qPCR Signals of Human Norovirus. Pathogens 2021, 10, 846. https://doi.org/10.3390/pathogens10070846
Eshaghi Gorji M, Tan MTH, Zhao MY, Li D. No Clinical Symptom Experienced after Consumption of Berry Fruits with Positive RT-qPCR Signals of Human Norovirus. Pathogens. 2021; 10(7):846. https://doi.org/10.3390/pathogens10070846
Chicago/Turabian StyleEshaghi Gorji, Mohamad, Malcolm Turk Hsern Tan, Mitchie Y. Zhao, and Dan Li. 2021. "No Clinical Symptom Experienced after Consumption of Berry Fruits with Positive RT-qPCR Signals of Human Norovirus" Pathogens 10, no. 7: 846. https://doi.org/10.3390/pathogens10070846
APA StyleEshaghi Gorji, M., Tan, M. T. H., Zhao, M. Y., & Li, D. (2021). No Clinical Symptom Experienced after Consumption of Berry Fruits with Positive RT-qPCR Signals of Human Norovirus. Pathogens, 10(7), 846. https://doi.org/10.3390/pathogens10070846

