Rahnella aquatilis Isolated from Aedes albopictus Impairs Mosquito Reproduction Capacity
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Laboratory Ae. albopictus Maintenance
2.2. Characterization of Rahnella sp. Isolate
2.3. Quantitative PCR Amplification
2.4. Organ Dissection, Developmental Stages, and Field Ae. albopitus Collection
2.5. Generation of GFP-Tagged Bacteria
2.6. Introducing Bacteria to Ae. albopictus
2.7. Axenic (AX) and Conventional (CN) Culture of Ae. albopictus Larvae
2.8. Developmental Metrics
2.9. Antibiotic Treatment and Bacteria Oral Feeding for Adult Mosquitoes
2.10. Fecundity and Vitellogenesis Assay
2.11. Statistics
3. Results
3.1. Morphological, Physiological, and Biochemical Characteristics of Rahnella sp. RAeA1 Isolation
3.2. Distribution of R. aquatilis RAeA1 Isolate in Developmental Stages, Tissues, and Field Populations of Ae. albopictus
3.3. Distribution of Rah/hupB-GFP-Apr in Different Tissues and Transmission to Next Generation
3.4. Axenic Larvae Develop When Fed R. aquatilis RAeA1 Isolate but with Developmental Delay
3.5. R. aquatilis RAeA1 Isolate Impairs Egg Production and Ovary Maturation with Low Level of Ecdysteroids and Vitellogenin
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
Abbreviations
References
- Battaglia, V.; Agostini, V.; Moroni, E.; Colombo, G.; Lombardo, G.; Rambaldi Migliore, N.; Gabrieli, P.; Garofalo, M.; Gagliardi, S.; Gomulski, L.M.; et al. The worldwide spread of Aedes albopictus: New insights from mitogenomes. Front. Genet. 2022, 13, 931163. [Google Scholar] [CrossRef] [PubMed]
- Bonizzoni, M.; Gasperi, G.; Chen, X.; James, A.A. The invasive mosquito species Aedes albopictus: Current knowledge and future perspectives. Trends Parasitol. 2013, 29, 460–468. [Google Scholar] [CrossRef] [PubMed]
- Wilke, A.B.; Marrelli, M.T. Paratransgenesis: A promising new strategy for mosquito vector control. Parasit. Vectors 2015, 8, 342. [Google Scholar] [CrossRef]
- Ricci, I.; Damiani, C.; Capone, A.; DeFreece, C.; Rossi, P.; Favia, G. Mosquito/microbiota interactions: From complex relationships to biotechnological perspectives. Curr. Opin. Microbiol. 2012, 15, 278–284. [Google Scholar] [CrossRef] [PubMed]
- Strand, M.R. Composition and functional roles of the gut microbiota in mosquitoes. Curr. Opin. Insect Sci. 2018, 28, 59–65. [Google Scholar] [CrossRef]
- Caputo, B.; Moretti, R.; Manica, M.; Serini, P.; Lampazzi, E.; Bonanni, M.; Fabbri, G.; Pichler, V.; Della Torre, A.; Calvitti, M. A bacterium against the tiger: Preliminary evidence of fertility reduction after release of Aedes albopictus males with manipulated Wolbachia infection in an Italian urban area. Pest. Manag. Sci. 2020, 76, 1324–1332. [Google Scholar] [CrossRef]
- Coon, K.L.; Brown, M.R.; Strand, M.R. Gut bacteria differentially affect egg production in the anautogenous mosquito Aedes aegypti and facultatively autogenous mosquito Aedes atropalpus (Diptera: Culicidae). Parasit. Vectors 2016, 9, 375. [Google Scholar] [CrossRef]
- Scolari, F.; Casiraghi, M.; Bonizzoni, M. Aedes spp. and Their Microbiota: A Review. Front. Microbiol. 2019, 10, 2036. [Google Scholar] [CrossRef]
- Chen, S.; Zhang, D.; Augustinos, A.; Doudoumis, V.; Bel Mokhtar, N.; Maiga, H.; Tsiamis, G.; Bourtzis, K. Multiple Factors Determine the Structure of Bacterial Communities Associated With Aedes albopictus Under Artificial Rearing Conditions. Front. Microbiol. 2020, 11, 605. [Google Scholar] [CrossRef]
- Saab, S.A.; Dohna, H.Z.; Nilsson, L.K.J.; Onorati, P.; Nakhleh, J.; Terenius, O.; Osta, M.A. The environment and species affect gut bacteria composition in laboratory co-cultured Anopheles gambiae and Aedes albopictus mosquitoes. Sci. Rep. 2020, 10, 3352. [Google Scholar] [CrossRef]
- Gimonneau, G.; Tchioffo, M.T.; Abate, L.; Boissière, A.; Awono-Ambéné, P.H.; Nsango, S.E.; Christen, R.; Morlais, I. Composition of Anopheles coluzzii and Anopheles gambiae microbiota from larval to adult stages. Infect. Genet. Evol. 2014, 28, 715–724. [Google Scholar] [CrossRef] [PubMed]
- Coon, K.L.; Vogel, K.J.; Brown, M.R.; Strand, M.R. Mosquitoes rely on their gut microbiota for development. Mol. Ecol. 2014, 23, 2727–2739. [Google Scholar] [CrossRef] [PubMed]
- Guégan, M.; Zouache, K.; Démichel, C.; Minard, G.; Tran Van, V.; Potier, P.; Mavingui, P.; Valiente Moro, C. The mosquito holobiont: Fresh insight into mosquito-microbiota interactions. Microbiome 2018, 6, 49. [Google Scholar] [CrossRef]
- Yadav, K.K.; Datta, S.; Naglot, A.; Bora, A.; Hmuaka, V.; Bhagyawant, S.; Gogoi, H.K.; Veer, V.; Raju, P.S. Diversity of Cultivable Midgut Microbiota at Different Stages of the Asian Tiger Mosquito, Aedes albopictus from Tezpur, India. PLoS ONE 2016, 11, e0167409. [Google Scholar] [CrossRef]
- Brady, C.; Hunter, G.; Kirk, S.; Arnold, D.; Denman, S. Rahnella victoriana sp. nov., Rahnella bruchi sp. nov., Rahnella woolbedingensis sp. nov., classification of Rahnella genomospecies 2 and 3 as Rahnella variigena sp. nov. and Rahnella inusitata sp. nov., respectively and emended description of the genus Rahnella. Syst. Appl. Microbiol. 2014, 37, 545–552. [Google Scholar] [PubMed]
- Wang, Y.H.; Salam, N.; Liu, Q.; Yang, Z.W.; Cao, L.X.; Meng, X.L.; Nie, G.X.; Ju, J.H.; Li, W.J. Symbiotic bacteria associated with puffer fish Gastrophysus spadiceus and evaluation of their antimicrobial activities. 3 Biotech. 2017, 7, 366. [Google Scholar] [CrossRef]
- Briones-Roblero, C.I.; Rodríguez-Díaz, R.; Santiago-Cruz, J.A.; Zúñiga, G.; Rivera-Orduña, F.N. Degradation capacities of bacteria and yeasts isolated from the gut of Dendroctonus rhizophagus (Curculionidae: Scolytinae). Folia Microbiol. 2017, 62, 1–9. [Google Scholar] [CrossRef]
- Chakraborty, A.; Ashraf, M.Z.; Modlinger, R.; Synek, J.; Schlyter, F.; Roy, A. Unravelling the gut bacteriome of Ips (Coleoptera: Curculionidae: Scolytinae): Identifying core bacterial assemblage and their ecological relevance. Sci. Rep. 2020, 10, 18572. [Google Scholar] [CrossRef]
- Pineda-Mendoza, R.M.; Zúñiga, G.; López, M.F.; Hidalgo-Lara, M.E.; Santiago-Hernández, A.; López-López, A.; Orduña, F.N.R.; Cano-Ramírez, C. Rahnella sp., a Dominant Symbiont of the Core Gut Bacteriome of Dendroctonus Species, Has Metabolic Capacity to Degrade Xylan by Bifunctional Xylanase-Ferulic Acid Esterase. Front. Microbiol. 2022, 13, 911269. [Google Scholar] [CrossRef]
- Jin, G.; Kim, Y. Pantoea Bacteria Isolated from Three Thrips (Frankliniella occidentalis, Frankliniella intonsa, and Thrips tabaci) in Korea and Their Symbiotic Roles in Host Insect Development. J. Microbiol. Biotechnol. 2023, 33, 745–752. [Google Scholar] [CrossRef]
- Calvo, J.; Calvente, V.; de Orellano, M.E.; Benuzzi, D.; Sanz de Tosetti, M.I. Biological control of postharvest spoilage caused by Penicillium expansum and Botrytis cinerea in apple by using the bacterium Rahnella aquatilis. Int. J. Food Microbiol. 2007, 113, 251–257. [Google Scholar] [CrossRef]
- Mei, L.; Xu, S.; Lu, P.; Lin, H.; Guo, Y.; Wang, Y. CsrB a noncoding regulatory RNA, is required for BarA-dependent expression of biocontrol traits in Rahnella aquatilis HX2. PLoS ONE 2017, 12, e0187492. [Google Scholar] [CrossRef] [PubMed]
- El Khoury, S.; Giovenazzo, P.; Derome, N. Endogenous Honeybee Gut Microbiota Metabolize the Pesticide Clothianidin. Microorganisms 2022, 10, 493. [Google Scholar] [CrossRef]
- Zhao, Y.Q.; Xia, A.; Zhang, M.H.; Li, J.L.; Zhu, G.D.; Tang, J.X. Microbiota structure and diversity in Aedes albopictus at different developmental stages. Chin. J. Schistosomiasis Control 2022, 34, 475–483. (In Chinese) [Google Scholar]
- Gazzoni Araújo Gonçalves, G.; Feitosa, A.P.S.; Portela-Júnior, N.C.; de Oliveira, C.M.F.; de Lima Filho, J.L.; Brayner, F.A.; Alves, L.C. Use of MALDI-TOF MS to identify the culturable midgut microbiota of laboratory and wild mosquitoes. Acta Trop. 2019, 200, 105174. [Google Scholar] [CrossRef]
- Zouache, K.; Raharimalala, F.N.; Raquin, V.; Tran-Van, V.; Raveloson, L.H.; Ravelonandro, P.; Mavingui, P. Bacterial diversity of field-caught mosquitoes, Aedes albopictus and Aedes aegypti, from different geographic regions of Madagascar. FEMS Microbiol. Ecol. 2011, 75, 377–389. [Google Scholar] [CrossRef] [PubMed]
- Rose, W.A., 2nd; McGowin, C.L.; Spagnuolo, R.A.; Eaves-Pyles, T.D.; Popov, V.L.; Pyles, R.B. Commensal bacteria modulate innate immune responses of vaginal epithelial cell multilayer cultures. PLoS ONE 2012, 7, e32728. [Google Scholar] [CrossRef]
- Saitou, N.; Nei, M. The neighbor-joining method: A new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 1987, 4, 406–425. [Google Scholar]
- Tamura, K.; Dudley, J.; Nei, M.; Kumar, S. MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol. Biol. Evol. 2007, 24, 1596–1599. [Google Scholar] [CrossRef]
- Letunic, I.; Bork, P. Interactive Tree Of Life (iTOL) v5: An online tool for phylogenetic tree display and annotation. Nucleic Acids Res. 2021, 49, W293–W296. [Google Scholar] [CrossRef]
- Lu, P.; Bian, G.; Pan, X.; Xi, Z. Wolbachia induces density-dependent inhibition to dengue virus in mosquito cells. PLoS Negl. Trop. Dis. 2012, 6, e1754. [Google Scholar] [CrossRef] [PubMed]
- Romoli, O.; Schönbeck, J.C.; Hapfelmeier, S.; Gendrin, M. Production of germ-free mosquitoes via transient colonisation allows stage-specific investigation of host-microbiota interactions. Nat. Commun. 2021, 12, 942. [Google Scholar] [CrossRef]
- Wu, J.; Wang, Q.; Wang, D.; Wong, A.C.N.; Wang, G.H. Axenic and gnotobiotic insect technologies in research on host-microbiota interactions. Trends Microbiol. 2023, 31, 858–871. [Google Scholar] [CrossRef] [PubMed]
- Martinson, V.G.; Strand, M.R. Diet-Microbiota Interactions Alter Mosquito Development. Front. Microbiol. 2021, 12, 650743. [Google Scholar] [CrossRef]
- Xi, Z.; Ramirez, J.L.; Dimopoulos, G. The Aedes aegypti toll pathway controls dengue virus infection. PLoS Pathog. 2008, 4, e1000098. [Google Scholar] [CrossRef] [PubMed]
- Huang, Y.; Ng, F.S.; Jackson, F.R. Comparison of larval and adult Drosophila astrocytes reveals stage-specific gene expression profiles. G3 Genes Genomes Genet. 2015, 5, 551–558. [Google Scholar] [CrossRef]
- Pang, X.; Xiao, X.; Liu, Y.; Zhang, R.; Liu, J.; Liu, Q.; Wang, P.; Cheng, G. Mosquito C-type lectins maintain gut microbiome homeostasis. Nat. Microbiol. 2016, 1, 16023. [Google Scholar] [CrossRef]
- Zheng, J.; Xu, J.; Zhang, R.; Du, J.; Wang, H.; Li, J.; Zhou, D.; Sun, Y.; Shen, B. MicroRNA-989 targets 5-hydroxytryptamine receptor1 to regulate ovarian development and eggs production in Culex pipiens pallens. Parasit. Vectors 2023, 16, 326. [Google Scholar] [CrossRef]
- Harrison, R.E.; Yang, X.; Eum, J.H.; Martinson, V.G.; Dou, X.; Valzania, L.; Wang, Y.; Boyd, B.M.; Brown, M.R.; Strand, M.R. The mosquito Aedes aegypti requires a gut microbiota for normal fecundity, longevity and vector competence. Commun. Biol. 2023, 6, 1154. [Google Scholar] [CrossRef]
- Lee, S.D.; Jeon, D.; Kim, I.S.; Choe, H.; Kim, J.S. Rahnella aceris sp. nov., isolated from sap drawn from Acer pictum. Arch. Microbiol. 2020, 202, 2411–2417. [Google Scholar] [CrossRef]
- Valzania, L.; Martinson, V.G.; Harrison, R.E.; Boyd, B.M.; Coon, K.L.; Brown, M.R.; Strand, M.R. Both living bacteria and eukaryotes in the mosquito gut promote growth of larvae. PLoS Negl. Trop. Dis. 2018, 12, e0006638. [Google Scholar] [CrossRef]
- Coon, K.L.; Valzania, L.; Brown, M.R.; Strand, M.R. Predaceous Toxorhynchites mosquitoes require a living gut microbiota to develop. Proc. Biol. Sci. 2020, 287, 20192705. [Google Scholar]
- Zotzmann, S.; Steinbrink, A.; Schleich, K.; Frantzmann, F.; Xoumpholphakdy, C.; Spaeth, M.; Moro, C.V.; Mavingui, P.; Klimpel, S. Bacterial diversity of cosmopolitan Culex pipiens and invasive Aedes japonicus from Germany. Parasitol. Res. 2017, 116, 1899–1906. [Google Scholar] [CrossRef] [PubMed]
- Rani, A.; Sharma, A.; Rajagopal, R.; Adak, T.; Bhatnagar, R.K. Bacterial diversity analysis of larvae and adult midgut microflora using culture-dependent and culture-independent methods in lab-reared and field-collected Anopheles stephensi-an Asian malarial vector. BMC Microbiol. 2009, 9, 96. [Google Scholar] [CrossRef]
- Chavshin, A.R.; Oshaghi, M.A.; Vatandoost, H.; Pourmand, M.R.; Raeisi, A.; Terenius, O. Isolation and identification of culturable bacteria from wild Anopheles culicifacies, a first step in a paratransgenesis approach. Parasit. Vectors 2014, 7, 419. [Google Scholar] [CrossRef] [PubMed]
- Díaz, S.; Camargo, C.; Avila, F.W. Characterization of the reproductive tract bacterial microbiota of virgin, mated, and blood-fed Aedes aegypti and Aedes albopictus females. Parasit. Vectors 2021, 14, 592. [Google Scholar] [CrossRef]
- Giraud, É.; Varet, H.; Legendre, R.; Sismeiro, O.; Aubry, F.; Dabo, S.; Dickson, L.B.; Valiente Moro, C.; Lambrechts, L. Mosquito-bacteria interactions during larval development trigger metabolic changes with carry-over effects on adult fitness. Mol. Ecol. 2022, 31, 1444–1460. [Google Scholar] [CrossRef] [PubMed]
- Gaio Ade, O.; Gusmão, D.S.; Santos, A.V.; Berbert-Molina, M.A.; Pimenta, P.F.; Lemos, F.J. Contribution of midgut bacteria to blood digestion and egg production in Aedes aegypti (diptera: Culicidae) (L.). Parasit. Vectors 2011, 4, 105. [Google Scholar] [CrossRef]
- Mao, Q.; Wu, W.; Huang, L.; Yi, G.; Jia, D.; Chen, Q.; Chen, H.; Wei, T. Insect bacterial symbiont-mediated vitellogenin uptake into ooocytes to support egg development. mBio 2020, 11, e01142-20. [Google Scholar] [CrossRef]
- Lau, M.J.; Ross, P.A.; Endersby-Harshman, N.M.; Yang, Q.; Hoffmann, A.A. Wolbachia inhibits ovarian formation and increases blood feeding rate in female Aedes aegypti. PLoS Negl. Trop. Dis. 2022, 16, e0010913. [Google Scholar] [CrossRef]
- Roy, S.; Saha, T.T.; Zou, Z.; Raikhel, A.S. Regulatory pathways controlling female insect reproduction. Annu. Rev. Entomol. 2018, 63, 489–511. [Google Scholar] [CrossRef] [PubMed]
- Sun, G.; Zhu, J.; Chen, L.; Raikhel, A.S. Synergistic action of E74B and ecdysteroid receptor in activating a 20-hydroxyecdysone effector gene. Proc. Natl. Acad. Sci. USA 2005, 102, 15506–15511. [Google Scholar] [CrossRef] [PubMed]
- Kodrík, D.; Čapková Frydrychová, R.; Hlávková, D.; Skoková Habuštová, O.; Štěrbová, H. Unusual functions of insect vitellogenins: Minireview. Physiol Res. 2023, 72, S475–S487. [Google Scholar] [CrossRef] [PubMed]
Name | Sequence (5′–3′) | Purpose |
---|---|---|
GFP-5F | GTATCGCTATGTGCACTGCTTTGGTGTC | Upstream homologous arm |
GFP-5R | GTTTACGGCGTCTTTCAACGCTTTTCCTG | |
GFP-3F | TTACAGCGTCGAAACGATTAGCAACAC | Downstream homologous arm |
GFP-3R | CTTTCAGCTCATCGTCTGTAGCGGTC | |
GFPApr-F | CAGGAAAAGCGTTGAAAGACGCCGTAAACCGTGGTTCTGGTGGTGAAGCAG | GFP-APR amplification |
GFPApr-R | GTGTTGCTAATCGTTTCGACGCTGTAAGGAATAGGAACTTATGAGCTCAGCCAATC | |
GFP-outF | GTGCTGAGAAGCTGGGCATTAACG | Outer identification |
GFP-outR | CACTTTGTCTTGTAGTGAGGTAGCATCCAG | |
GFP-R | CCATTAGTTGCATCACCTTCACCTTCAC | Insertion identification |
Apr-F | GGCAGAGCAGATCATCTCTGATCCATTG | |
GSF | GTTCGTGCCTTCATCCGTTTC | Sequencing |
442R | AGAAGCCCTTAGAGCCTCTCAAAG | Sequencing |
GFP-seqF | GGTTCTTTCACCGTGCGTGAG | Sequencing |
Characteristic | RAeA1 | |
---|---|---|
Gelatin hydrolysis | − | |
Hydrogen sulfide production | − | |
N2 | + | |
NO2 | + | |
Acid production from | D-Glucose | + |
D-Mannitol | + | |
Lactose | + | |
D-Srobitol | + | |
Inositol | − | |
L-rhamnose | + | |
D-saccharose | + | |
D-melbiose | − | |
Amygdalin | + | |
L-arabinose | − | |
Citrate | − | |
Enzyme activities | Arginine dihydrolase | − |
Lysine decarboxylase | − | |
Orinithine decarboxylase | − | |
Phenylalanine deaminase | − | |
Urease | − | |
Tryptophanase | − |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Gu, L.; Li, L.; Sun, J.; Zhao, Y.; Wan, K.; Zhang, M.; Li, J.; Zhang, M.; Zhu, G.; Tang, J. Rahnella aquatilis Isolated from Aedes albopictus Impairs Mosquito Reproduction Capacity. Insects 2025, 16, 257. https://doi.org/10.3390/insects16030257
Gu L, Li L, Sun J, Zhao Y, Wan K, Zhang M, Li J, Zhang M, Zhu G, Tang J. Rahnella aquatilis Isolated from Aedes albopictus Impairs Mosquito Reproduction Capacity. Insects. 2025; 16(3):257. https://doi.org/10.3390/insects16030257
Chicago/Turabian StyleGu, Ling, Lin Li, Jinyang Sun, Yongqiao Zhao, Kai Wan, Meichun Zhang, Julin Li, Meihua Zhang, Guoding Zhu, and Jianxia Tang. 2025. "Rahnella aquatilis Isolated from Aedes albopictus Impairs Mosquito Reproduction Capacity" Insects 16, no. 3: 257. https://doi.org/10.3390/insects16030257
APA StyleGu, L., Li, L., Sun, J., Zhao, Y., Wan, K., Zhang, M., Li, J., Zhang, M., Zhu, G., & Tang, J. (2025). Rahnella aquatilis Isolated from Aedes albopictus Impairs Mosquito Reproduction Capacity. Insects, 16(3), 257. https://doi.org/10.3390/insects16030257