Identification and Validation of Reference Genes for Expression Analysis Using qRT-PCR in Cimex hemipterus (Hemiptera: Cimicidae)
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Insects
2.2. Experimental Condition and Sample Collection
2.3. RNA Extraction and cDNA Synthesis
2.4. Reference Gene Selection, Primer Design, and qRT-PCR
2.5. Determination of Reference Gene Expression Stability
2.6. Validation of the Candidate Reference Genes
3. Results
3.1. Primer Specificity and Efficiency
3.2. Ct Values of Candidate Reference Genes
3.3. Stability of the 10 Reference Genes under Different Experimental Conditions
3.4. Validation of Candidate Reference Genes in Different Tissues
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001, 29, e45. [Google Scholar] [CrossRef] [PubMed]
- Bustin, S.A.; Benes, V.; Garson, J.A.; Hellemans, J.; Huggett, J.; Kubista, M.; Mueller, R.; Nolan, T.; Pfaffl, M.W.; Shipley, G.L.; et al. The MIQE guidelines: Minimum information for publication of quantitative real-time PCR experiments. Clin. Chem. 2009, 55, 611–622. [Google Scholar] [CrossRef] [PubMed]
- Bustin, S.A.; Benes, V.; Nolan, T.; Pfaffl, M.W. Quantitative real-time RT-PCR—A perspective. J. Mol. Endocrinol. 2005, 34, 597–601. [Google Scholar] [CrossRef] [PubMed]
- Pfaffl, M.W.; Tichopad, A.; Prgomet, C.; Neuvians, T.P. Determination of stable housekeeping genes, differentially regulated target genes and sample integrity: BestKeeper-Excel-based tool using pair-wise correlations. Biotechnol. Lett. 2004, 26, 509–515. [Google Scholar] [CrossRef]
- Radonić, A.; Thulke, S.; Mackay, I.M.; Landt, O.; Siegert, W.; Nitsche, A. Guideline to reference gene selection for quantitative real-time PCR. Biochem. Bioph. Res. Commun. 2004, 313, 856–862. [Google Scholar] [CrossRef]
- Lee, P.D.; Sladek, R.; Greenwood, C.M.T.; Hudson, T.J. Control genes and variability: Absence of ubiquitous reference transcripts in diverse mammalian expression studies. Genome Res. 2002, 12, 292–297. [Google Scholar] [CrossRef]
- Andersen, C.L.; Jensen, J.L.; Ørntoft, T.F. Normalization of real-time quantitative reverse transcription-PCR data: A model-based variance estimation approach to identify genes suited for normalization, applied to bladder and colon cancer data sets. Cancer Res. 2004, 64, 5245–5250. [Google Scholar] [CrossRef]
- Bémeur, C.; Ste-Marie, L.; Desjardins, P.; Hazell, A.S.; Vachon, L.; Butterworth, R.; Montgomery, J. Decreased β-actin mRNA expression in hyperglycemic focal cerebral ischemia in the rat. Neurosci. Lett. 2004, 357, 211–214. [Google Scholar] [CrossRef]
- Pan, H.; Yang, X.; Bidne, K.; Hellmich, R.L.; Siegfried, B.D.; Zhou, X. Selection of reference genes for RT-qPCR analysis in the monarch butterfly, Danaus plexippus (L.), a migrating bio-indicator. PLoS ONE 2015, 10, e0129482. [Google Scholar] [CrossRef]
- Yang, C.; Preisser, E.L.; Zhang, H.; Liu, Y.; Dai, L.; Pan, H.; Zhou, X. Selection of reference genes for RT-qPCR analysis in Coccinella septempunctata to assess un-intended effects of RNAi transgenic plants. Front. Plant Sci. 2016, 7, 1672. [Google Scholar]
- Yang, X.; Pan, H.; Yuan, L.; Zhou, X. Reference gene selection for RT-qPCR analysis in Harmonia axyridis, a global invasive lady beetle. Sci. Rep. 2018, 8, 2689. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liang, C.; Han, S.; Han, H.; Zhao, F.; He, Y. Selection of reference genes for Harmonia axyridis (Coleoptera: Coccinellidae) feeding on different diets. J. Asia-Pac. Entomol. 2019, 22, 1115–1122. [Google Scholar] [CrossRef]
- Guo, C.F.; Pan, H.P.; Zhang, L.H.; Ou, D.; Lu, Z.T.; Khan, M.M.; Qiu, B.L. Comprehensive assessment of candidate reference genes for gene expression studies using RT-qPCR in Tamarixia radiata, a predominant parasitoid of Diaphorina citri. Genes 2020, 11, 1178. [Google Scholar] [CrossRef]
- Dheda, K.; Huggett, J.F.; Chang, J.S.; Kim, L.U.; Bustin, S.A.; Johnson, M.A.; Rook, G.A.W.; Zumla, A. The implications of using an inappropriate reference gene for real-time reverse transcription PCR data normalization. Anal. Biochem. 2005, 344, 141–143. [Google Scholar] [CrossRef]
- Goddard, J.; deShazo, R. Bed bugs (Cimex lectularius) and clinical consequences of their bites. JAMA 2009, 301, 1358–1366. [Google Scholar] [CrossRef] [PubMed]
- Bernardeschi, C.; Cleach, L.L.; Delaunay, P.; Chosidow, O. Bed bug infestation. BMJ 2013, 346, f138. [Google Scholar] [CrossRef]
- Teng, K.F.; Feng, L.C. The geographical distribution of the two species of bedbugs, Cimex lectularius L. and C. hemiptera F., in China. Acta Entomol. Sin. 1953, 2, 253–264. [Google Scholar]
- Zhao, Y.; Feng, X.; Li, M.; Qiu, X. The double-mutation (M918I + L1014F) kdr allele is fixed in Cimex hemipterus populations in Guangxi, China. Bull. Entomol. Res. 2020, 110, 506–511. [Google Scholar] [CrossRef]
- Zhang, J.; Xia, Y.; Wang, C.; Han, D.; Ren, D.; Zheng, J.; Xu, X.; He, Y.; Wang, D. Morphological and molecular identification of tropical bed bugs from two cities of the Pearl River Delta in China. J. Med. Entomol. 2021, 58, 471–474. [Google Scholar] [CrossRef]
- Kong, D.; Han, D.; Zhai, R.; Wang, C.; Zhang, J.; Xia, Y.; Nian, X.; Liu, C.; He, Y.; Wang, D. A case study on tropical bed bug, Cimex hemipterus (Hemiptera: Cimicidae) infestation and management in dormitories. J. Econ. Entomol. 2022. [Google Scholar] [CrossRef]
- Wang, L.; Xu, Y.; Zeng, L. Resurgence of bed bugs (Hemiptera: Cimicidae) in mainland China. Fla. Entomol. 2013, 96, 131–136. [Google Scholar] [CrossRef]
- Wang, L.; Cai, X.; Xu, Y. Status of urban bed bug infestations in southern China: An analysis of pest control service records in Shenzhen in 2012 and Dongguan in 2013. J. Med. Entomol. 2015, 52, 76–80. [Google Scholar] [CrossRef] [PubMed]
- Ren, D.S.; Wu, H.X.; Xiu, P.C.; Song, X.P.; Yue, Y.J.; Lu, L.; Liu, Q.Y. National surveillance report on bed bugs in China, 2019. Chin. J. Vector Biol. Control 2020, 31, 423–425. [Google Scholar]
- McMeniman, C.J.; Corfas, R.A.; Matthews, B.J.; Ritchie, S.A.; Vosshall, L.B. Multimodal integration of carbon dioxide and other sensory cues drives mosquito attraction to humans. Cell 2014, 156, 1060–1071. [Google Scholar] [CrossRef]
- Raji, J.I.; Melo, N.; Castillo, J.S.; Gonzalez, S.; Saldana, V.; Stensmyr, M.C.; DeGennaro, M. Aedes aegypti mosquitoes detect acidic volatiles found in human odor using the IR8a pathway. Curr. Biol. 2019, 29, 1253–1262. [Google Scholar] [CrossRef]
- Greppi, C.; Laursen, W.J.; Budelli, G.; Chang, E.C.; Daniels, A.M.; van Giesen, L.; Smidler, A.L.; Catteruccia, F.; Garrity, P.A. Mosquito heat-seeking is driven by an ancestral cooling receptor. Science 2020, 367, 681–684. [Google Scholar] [CrossRef]
- Reinhardt, K.; Siva-Jothy, M.T. Biology of the bed bugs (Cimicidae). Annu. Rev. Entomol. 2007, 52, 351–374. [Google Scholar] [CrossRef]
- Doggett, S.L.; Miller, D.M.; Lee, C.Y. Advances in the Biology and Management of Modern Bed Bugs; Wiley-Blackwell: Chichester, West Sussex, UK, 2018. [Google Scholar]
- Liu, F.; Chen, Z.; Ye, Z.; Liu, N. The olfactory chemosensation of hematophagous Hemipteran insects. Front. Physiol. 2021, 12, 703768. [Google Scholar] [CrossRef]
- Kwon, H.W.; Lu, T.; Rützler, M.; Zwiebel, L.J. Olfactory responses in a gustatory organ of the malaria vector mosquito Anopheles gambiae. Proc. Natl. Acad. Sci. USA 2006, 103, 13526–13531. [Google Scholar] [CrossRef]
- Lu, T.; Qiu, Y.T.; Wang, G.; Kwon, J.Y.; Rutzler, M.; Kwon, H.W.; Pitts, R.J.; van Loon, J.J.A.; Takken, W.; Carlson, J.R.; et al. Odor coding in the maxillary palp of the malaria vector mosquito Anopheles gambiae. Curr. Biol. 2007, 17, 1533–1544. [Google Scholar] [CrossRef]
- Tauxe, G.M.; MacWilliam, D.; Boyle, S.M.; Guda, T.; Ray, A. Targeting a dual detector of skin and CO2 to modify mosquito host seeking. Cell 2013, 155, 1365–1379. [Google Scholar] [CrossRef] [PubMed]
- Mamidala, P.; Rajarapu, S.P.; Jones, S.C.; Mittapalli, O. Identification and validation of reference genes for quantitative real-time polymerase chain reaction in Cimex lectularius. J. Med. Entomol. 2011, 48, 947–951. [Google Scholar] [CrossRef] [PubMed]
- Zhu, F.; Sams, S.; Moural, T.; Haynes, K.F.; Potter, M.F.; Palli, S.R. RNA interference of NADPH-cytochrome P450 reductase results in reduced insecticide resistance in the bed bug, Cimex lectularius. PLoS ONE 2012, 7, e31037. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, J.; Liang, Q.; Xia, Y.; Kong, D.; Wang, C.; Mo, S.; He, Y.; Wang, D. Behavioral response of the tropical bed bug, Cimex hemipterus (Hemiptera: Cimicidae) to carbon dioxide. J. Econ. Entomol. 2021, 114, 2198–2203. [Google Scholar] [CrossRef]
- Vandesompele, J.; De Preter, K.; Pattyn, F.; Poppe, B.; Van Roy, N.; De Paepe, A.; Speleman, F. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 2002, 3, 14389. [Google Scholar] [CrossRef] [PubMed]
- Silver, N.; Best, S.; Jiang, J.; Thein, S.L. Selection of housekeeping genes for gene expression studies in human reticulocytes using real-time PCR. BMC Mol. Biol. 2006, 7, 33. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- IBM Corporation. IBM SPSS Statistics Base 22.0; IBM Corporation: Armonk, NY, USA, 2013. [Google Scholar]
- Liang, W.; Zou, X.; Carballar-Lejarazú, R.; Wu, L.; Sun, W.; Yuan, X.; Wu, S.; Li, P.; Ding, H.; Ni, L.; et al. Selection and evaluation of reference genes for qRT-PCR analysis in Euscaphis konishii Hayata based on transcriptome data. Plant Methods 2018, 14, 42. [Google Scholar] [CrossRef]
- Lü, J.; Chen, S.; Guo, M.; Ye, C.; Qiu, B.; Wu, J.; Yang, C.; Pan, H. Selection and validation of reference genes for RT-qPCR analysis of the ladybird beetle Henosepilachna vigintioctomaculata. Front. Physiol. 2018, 9, 1614. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Xiong, M.; Wang, J.; Lei, C.; Zhu, F. Reference gene stability of a synanthropic fly, Chrysomya megacephala. Parasite Vector 2015, 8, 565. [Google Scholar] [CrossRef]
- Li, X.; Gong, P.; Wang, B.; Wang, C.; Li, M.; Zhang, Y.; Li, X.; Gao, H.; Ju, J.; Zhu, X. Selection and validation of experimental condition-specific reference genes for qRT-PCR in Metopolophium dirhodum (Walker) (Hemiptera: Aphididae). Sci. Rep. 2020, 10, 21951. [Google Scholar] [CrossRef] [PubMed]
- Bustin, S.A. Absolute quantification of mRNA using real-time reverse transcription polymerase chain reaction assays. J. Mol. Endocrinol. 2000, 25, 169–193. [Google Scholar] [CrossRef] [PubMed]
- Van Hiel, M.B.; Van Wielendaele, P.; Temmerman, L.; Van Soest, S.; Vuerinckx, K.; Huybrechts, R.; Broeck, J.V.; Simonet, G. Identification and validation of housekeeping genes in brains of the desert locust Schistocerca gregaria under different developmental conditions. BMC Mol. Biol. 2009, 10, 56. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Horňáková, D.; Matoušková, P.; Kindl, J.; Valterová, I.; Pichová, I. Selection of reference genes for real-time polymerase chain reaction analysis in tissues from Bombus terrestris and Bombus lucorum of different ages. Anal. Biochem. 2010, 397, 118–120. [Google Scholar] [CrossRef] [PubMed]
- Lord, J.C.; Hartzer, K.; Toutges, M.; Oppert, B. Evaluation of quantitative PCR reference genes for gene expression studies in Tribolium castaneum after fungal challenge. J. Microbiol. Methods 2010, 80, 219–221. [Google Scholar] [CrossRef] [PubMed]
- Zhang, S.; An, S.; Li, Z.; Wu, F.; Yang, Q.; Liu, Y.; Cao, J.; Zhang, H.; Zhang, Q.; Liu, X. Identification and validation of reference genes for normalization of gene expression analysis using qRT-PCR in Helicoverpa armigera (Lepidoptera: Noctuidae). Gene 2015, 555, 393–402. [Google Scholar] [CrossRef]
- Li, M.; Li, X.; Wang, C.; Li, Q.; Zhu, S.; Zhang, Y.; Li, X.; Yang, F.; Zhu, X. Selection and validation of reference genes for qRT-PCR analysis of Rhopalosiphum padi (Hemiptera: Aphididae). Front. Physiol. 2021, 12, 663338. [Google Scholar] [CrossRef]
- Yang, C.; Pan, H.; Liu, Y.; Zhou, X. Temperature and development impacts on housekeeping gene expression in cowpea aphid, Aphis craccivora (Hemiptera: Aphidiae). PLoS ONE 2015, 10, e0130593. [Google Scholar]
- Ferguson, B.S.; Nam, H.; Hopkins, R.G.; Morrison, R.F. Impact of reference gene selection for target gene normalization on experimental outcome using real-time qRT-PCR in adipocytes. PLoS ONE 2010, 5, e15208. [Google Scholar] [CrossRef]
- Veazey, K.J.; Golding, M.C. Selection of stable reference genes for quantitative RT-PCR comparisons of mouse embryonic and extra-embryonic stem cells. PLoS ONE 2011, 6, e27592. [Google Scholar] [CrossRef]
- Wang, D.S.; Xia, Y.W.; Zhang, J.S.; Han, D.L.; Wang, C.L.; Zheng, J.; He, Y.R.; Ren, D.S.; Liu, J.; Deng, H. Problems and strategies in bed bug prevention and control in China. Chin. J. Vector Biol. Control 2020, 31, 502–507. [Google Scholar]
- How, Y.F.; Lee, C.Y. Survey of bed bugs in infested premises in Malaysia and Singapore. J. Vector Ecol. 2010, 35, 89–94. [Google Scholar] [CrossRef] [PubMed]
- Zulaikha, Z.; Hafiz, A.M.A.; Hafis, A.R.A.; Hassan, A.A. A survey on the infestation levels of tropical bed bugs in Peninsular Malaysia: Current updates and status on resurgence of Cimex hemipterus (Hemiptera: Cimicidae). Asian Pac. J. Trop. Dis. 2016, 6, 40–45. [Google Scholar] [CrossRef]
- Newberry, K. The tropical bedbug Cimex hemipterus near the southernmost extent of its range. Trans. R. Soc. Trop. Med. Hyg. 1990, 84, 745–747. [Google Scholar] [CrossRef]





| Gene | Primer Sequence a (5′–3′) | Amplicon Length (bp) | Efficiency b (%) | R2 c |
|---|---|---|---|---|
| RPL8 | F: AGGCACGGTTACATCAAAGG | 131 | 111.07 | 0.9952 |
| R: TCGGGAGCAATGAAGAGTTC | ||||
| RPL11 | F: GAAGAATGTCATGCGAGATGTCAGG | 129 | 92.28 | 0.9987 |
| R: CCTTTGAGAAGACTGGCTGCTG | ||||
| RPL13 | F: ATTGGCAGAGGTTCATTCGT | 131 | 100.91 | 0.9979 |
| R: GCATCTCACTGCTGGTCTCA | ||||
| RPS16 | F: AATGGTCGCCCACTTGAGAT | 158 | 87.46 | 0.9976 |
| R: GCCTGCCTGATTGCGTAGAT | ||||
| α-tubulin | F: TCAACTACCAACCACCCACT | 139 | 94.93 | 0.9990 |
| R: TTGGCGTACATCAAGTCAAA | ||||
| β-tubulin | F: CCTTTGCTGGACGCCTCATT | 84 | 103.67 | 0.9902 |
| R: CGACCCGACTGGTGCATACC | ||||
| GAPDH | F: GCATTTAGAGTCCCTGTCGC | 149 | 91.12 | 0.9806 |
| R: ACTTCATCTTCGGTGTAGCC | ||||
| EF1α | F: CGTTAGGACGTTTCGCTGTC | 103 | 106.65 | 0.9893 |
| R: GCCTTTGTCACTTTGCCACT | ||||
| Actin | F: GACTTCGAGCAGGAAATGGC | 114 | 98.08 | 0.9989 |
| R: TTCTGGGCAACGGAACCTCT | ||||
| NADH | F: AAAGACGAAGGTCGGGATTA | 76 | 87.11 | 0.9812 |
| R: GCATCAAAGAAACACGCATC |
| Candidate Gene | Experimental Conditions | All * | ||||
|---|---|---|---|---|---|---|
| Developmental Stage | Sex | Tissue | Gas Stimulation | Temperature | ||
| RPL8 | 19.15 ± 0.16 | 18.50 ± 0.42 | 19.33 ± 0.11 | 27.61 ± 0.56 | 21.26 ± 0.23 | 20.68 ± 0.40 |
| RPL11 | 18.23 ± 0.57 | 18.62 ± 0.16 | 19.29 ± 0.16 | 26.97 ± 0.49 | 22.39 ± 0.23 | 20.78 ± 0.41 |
| RPL13 | 18.75 ± 0.24 | 19.40 ± 0.66 | 22.24 ± 1.03 | 28.34 ± 0.60 | 21.53 ± 0.23 | 21.60 ± 0.48 |
| RPS16 | 17.94 ± 0.65 | 17.63 ± 0.15 | 22.73 ± 1.19 | 29.70 ± 0.87 | 30.44 ± 0.41 | 24.09 ± 0.83 |
| α-tubulin | 15.74 ± 0.67 | 16.59 ± 0.61 | 16.58 ± 0.16 | 23.08 ± 0.47 | 17.67 ± 0.16 | 17.47 ± 0.33 |
| β-tubulin | 20.61 ± 0.44 | 22.18 ± 0.97 | 19.50 ± 0.50 | 27.67 ± 0.65 | 20.95 ± 0.17 | 21.46 ± 0.38 |
| GAPDH | 17.88 ± 0.53 | 18.30 ± 0.32 | 20.25 ± 0.20 | 27.77 ± 0.48 | 22.67 ± 0.19 | 21.06 ± 0.45 |
| EF1α | 15.54 ± 0.54 | 15.52 ± 0.25 | 16.70 ± 0.17 | 24.27 ± 0.46 | 17.94 ± 0.23 | 17.55 ± 0.39 |
| Actin | 15.67 ± 1.20 | 16.87 ± 0.88 | 14.92 ± 0.31 | 23.29 ± 0.63 | 15.42 ± 0.12 | 16.46 ± 0.40 |
| NADH | 21.26 ± 0.35 | 26.60 ± 2.67 | 23.12 ± 0.52 | 32.34 ± 0.60 | 24.61 ± 0.10 | 24.61 ± 0.56 |
| Condition | Rank * | geNorm | NormFinder | BestKeeper | ∆Ct | ||||
|---|---|---|---|---|---|---|---|---|---|
| Gene | Stability | Gene | Stability | Gene | Stability | Gene | Stability | ||
| Developmental stage | 1 | RPL8 | 0.118 | EF1α | 0.274 | NADH | 0.283 | RPL8 | 0.622 |
| 2 | RPL11 | 0.118 | NADH | 0.278 | β-tubulin | 0.349 | EF1α | 0.623 | |
| 3 | EF1α | 0.240 | RPL8 | 0.334 | EF1α | 0.410 | RPL11 | 0.636 | |
| 4 | RPS16 | 0.269 | GAPDH | 0.378 | GAPDH | 0.428 | RPS16 | 0.675 | |
| 5 | RPL13 | 0.356 | RPL11 | 0.382 | RPL8 | 0.443 | NADH | 0.707 | |
| 6 | GAPDH | 0.434 | RPS16 | 0.433 | RPL11 | 0.457 | GAPDH | 0.722 | |
| 7 | NADH | 0.497 | β-tubulin | 0.588 | RPS16 | 0.490 | RPL13 | 0.837 | |
| 8 | α-tubulin | 0.560 | RPL13 | 0.685 | α-tubulin | 0.622 | β-tubulin | 0.865 | |
| 9 | β-tubulin | 0.629 | α-tubulin | 0.708 | RPL13 | 0.672 | α-tubulin | 0.896 | |
| 10 | Actin | 0.813 | Actin | 1.513 | Actin | 0.963 | Actin | 1.551 | |
| Sex | 1 | RPS16 | 0.328 | RPL8 | 0.364 | RPS16 | 0.290 | RPL8 | 1.709 |
| 2 | EF1α | 0.328 | RPL13 | 0.428 | RPL11 | 0.317 | RPL11 | 1.794 | |
| 3 | RPL11 | 0.640 | RPL11 | 0.709 | EF1α | 0.385 | GAPDH | 1.914 | |
| 4 | GAPDH | 0.749 | GAPDH | 1.133 | GAPDH | 0.520 | RPS16 | 1.944 | |
| 5 | RPL8 | 0.881 | α-tubulin | 1.192 | RPL8 | 0.691 | α-tubulin | 1.947 | |
| 6 | α-tubulin | 1.002 | Actin | 1.217 | α-tubulin | 1.253 | EF1α | 1.948 | |
| 7 | RPL13 | 1.183 | RPS16 | 1.380 | RPL13 | 1.272 | RPL13 | 2.039 | |
| 8 | Actin | 1.325 | β-tubulin | 1.428 | Actin | 1.771 | Actin | 2.091 | |
| 9 | β-tubulin | 1.421 | EF1α | 1.448 | β-tubulin | 1.986 | β-tubulin | 2.241 | |
| 10 | NADH | 2.388 | NADH | 6.188 | NADH | 5.589 | NADH | 6.256 | |
| Tissue | 1 | RPL8 | 0.355 | RPL8 | 0.178 | RPL8 | 0.329 | EF1α | 1.595 |
| 2 | RPL11 | 0.355 | RPL11 | 0.178 | α-tubulin | 0.415 | RPL8 | 1.600 | |
| 3 | EF1α | 0.484 | EF1α | 0.247 | RPL11 | 0.422 | RPL11 | 1.667 | |
| 4 | GAPDH | 0.556 | α-tubulin | 0.312 | EF1α | 0.490 | α-tubulin | 1.723 | |
| 5 | α-tubulin | 0.632 | GAPDH | 0.579 | GAPDH | 0.524 | GAPDH | 1.775 | |
| 6 | Actin | 0.847 | Actin | 0.830 | Actin | 0.808 | Actin | 1.915 | |
| 7 | β-tubulin | 1.057 | β-tubulin | 1.165 | β-tubulin | 1.173 | β-tubulin | 2.158 | |
| 8 | NADH | 1.313 | NADH | 2.099 | NADH | 1.524 | NADH | 2.656 | |
| 9 | RPL13 | 1.838 | RPL13 | 3.835 | RPL13 | 3.203 | RPL13 | 4.031 | |
| 10 | RPS16 | 2.353 | RPS16 | 4.235 | RPS16 | 3.629 | RPS16 | 4.412 | |
| Gas stimulation | 1 | Actin | 0.325 | RPL8 | 0.241 | EF1α | 0.893 | RPL8 | 0.689 |
| 2 | β-tubulin | 0.325 | β-tubulin | 0.400 | GAPDH | 0.958 | β-tubulin | 0.737 | |
| 3 | RPL8 | 0.440 | RPL11 | 0.435 | α-tubulin | 0.998 | RPL11 | 0.764 | |
| 4 | RPL11 | 0.491 | Actin | 0.453 | RPL11 | 1.004 | Actin | 0.766 | |
| 5 | α-tubulin | 0.588 | NADH | 0.579 | RPL8 | 1.100 | EF1α | 0.834 | |
| 6 | EF1α | 0.624 | EF1α | 0.616 | RPL13 | 1.105 | α-tubulin | 0.846 | |
| 7 | GAPDH | 0.644 | α-tubulin | 0.651 | NADH | 1.180 | NADH | 0.857 | |
| 8 | NADH | 0.696 | GAPDH | 0.718 | Actin | 1.231 | GAPDH | 0.892 | |
| 9 | RPL13 | 0.778 | RPL13 | 0.855 | β-tubulin | 1.281 | RPL13 | 1.041 | |
| 10 | RPS16 | 0.864 | RPS16 | 1.089 | RPS16 | 1.767 | RPS16 | 1.207 | |
| Temperature | 1 | RPL8 | 0.230 | RPL8 | 0.279 | NADH | 0.345 | RPL8 | 0.616 |
| 2 | RPL13 | 0.230 | β-tubulin | 0.343 | Actin | 0.390 | NADH | 0.653 | |
| 3 | EF1α | 0.360 | NADH | 0.361 | α-tubulin | 0.446 | β-tubulin | 0.660 | |
| 4 | RPL11 | 0.416 | GAPDH | 0.407 | β-tubulin | 0.554 | EF1α | 0.664 | |
| 5 | GAPDH | 0.464 | EF1α | 0.426 | GAPDH | 0.563 | GAPDH | 0.679 | |
| 6 | NADH | 0.512 | RPL13 | 0.447 | RPL11 | 0.726 | RPL13 | 0.688 | |
| 7 | β-tubulin | 0.528 | RPL11 | 0.462 | RPL8 | 0.764 | RPL11 | 0.702 | |
| 8 | Actin | 0.573 | α-tubulin | 0.568 | EF1α | 0.776 | α-tubulin | 0.791 | |
| 9 | α-tubulin | 0.605 | Actin | 0.593 | RPL13 | 0.797 | Actin | 0.795 | |
| 10 | RPS16 | 0.766 | RPS16 | 1.341 | RPS16 | 1.211 | RPS16 | 1.411 | |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kong, D.; Shi, D.; Wang, C.; Zhai, R.; Lyu, L.; He, Y.; Wang, D. Identification and Validation of Reference Genes for Expression Analysis Using qRT-PCR in Cimex hemipterus (Hemiptera: Cimicidae). Insects 2022, 13, 784. https://doi.org/10.3390/insects13090784
Kong D, Shi D, Wang C, Zhai R, Lyu L, He Y, Wang D. Identification and Validation of Reference Genes for Expression Analysis Using qRT-PCR in Cimex hemipterus (Hemiptera: Cimicidae). Insects. 2022; 13(9):784. https://doi.org/10.3390/insects13090784
Chicago/Turabian StyleKong, Delong, Daxia Shi, Changlu Wang, Ruyue Zhai, Lingling Lyu, Yurong He, and Desen Wang. 2022. "Identification and Validation of Reference Genes for Expression Analysis Using qRT-PCR in Cimex hemipterus (Hemiptera: Cimicidae)" Insects 13, no. 9: 784. https://doi.org/10.3390/insects13090784
APA StyleKong, D., Shi, D., Wang, C., Zhai, R., Lyu, L., He, Y., & Wang, D. (2022). Identification and Validation of Reference Genes for Expression Analysis Using qRT-PCR in Cimex hemipterus (Hemiptera: Cimicidae). Insects, 13(9), 784. https://doi.org/10.3390/insects13090784

