Sublethal Dose of β-Cypermethrin Impairs the Olfaction of Bactrocera dorsalis by Suppressing the Expression of Chemosensory Genes
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Insects
2.2. β-Cypermethrin Bioassay
2.3. Olfactory Preference Assays
2.4. Electroantennogram (EAG)
2.5. Quantitative Real-Time PCR
2.6. Statistical Analysis
3. Results
3.1. Bioassay
3.2. Olfactory Preference
3.3. EAG Analysis
3.4. Differential Expression of Olfactory Genes upon β-Cypermethrin Exposure
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Liquido, N.J.; Mcquate, G.T.; Suiter, K.A. Compendium of Fruit Fly Host Information (CoFFHI), 3.0 ed; United States Department of Agriculture, Center for Plant Health Science and Technology: Raleigh, NC, USA, 2017. Available online: https://coffhi.cphst.org/ (accessed on 24 October 2017).
- Chen, P.H.; Wu, W.J.; Hsu, J.C. Detection of male oriental fruit fly (Diptera: Tephritidae) susceptibility to naled- and fipronil-Intoxicated methyl eugenol. J. Econ. Entomol. 2019, 112, 316–323. [Google Scholar] [CrossRef] [PubMed]
- Wei, D.D.; He, W.; Lang, N.; Miao, Z.Q.; Xiao, L.F.; Dou, W.; Wang, J.J. Recent research status of Bactrocera dorsalis: Insights from resistance mechanisms and population structure. Arch. Insect Biochem. 2019, 102, e21601. [Google Scholar] [CrossRef] [PubMed]
- Clarke, A.R.; Li, Z.H.; Qin, Y.J.; Zhao, Z.H.; Liu, L.J.; Schutze, M.K. Bactrocera dorsalis (Hendel) (Diptera: Tephritidae) is not invasive through Asia: It’s been there all along. J. Appl. Entomol. 2019, 143, 797–801. [Google Scholar] [CrossRef]
- Liu, H.; Zhang, D.J.; Xu, Y.J.; Wang, L.; Cheng, D.F.; Qi, Y.X.; Zeng, L.; Lu, Y.Y. Invasion, expansion, and control of Bactrocera dorsalis (Hendel) in China. J. Integr. Agric. 2019, 18, 771–787. [Google Scholar] [CrossRef]
- Lu, X.P.; Xu, L.; Meng, L.W.; Wang, L.L.; Niu, J.Z.; Wang, J.J. Divergent molecular evolution in glutathione S-transferase conferring malathion resistance in the oriental fruit fly, Bactrocera dorsalis (Hendel). Chemosphere 2020, 242, 125203. [Google Scholar] [CrossRef] [PubMed]
- Jin, T.; Zeng, L.; Lin, Y.Y.; Lu, Y.Y.; Liang, G.W. Insecticide resistance of the oriental fruit fly, Bactrocera dorsalis (Hendel) (Diptera: Tephritidae), in mainland China. Pest Manag. Sci. 2011, 67, 370–376. [Google Scholar] [CrossRef] [PubMed]
- Kuo, T.C.Y.; Hu, C.C.; Chien, T.Y.; Chen, M.J.M.; Feng, H.T.; Chen, L.F.O.; Chen, C.Y.; Hsu, J.C. Discovery of genes related to formothion resistance in oriental fruit fly (Bactrocera dorsalis) by a constrained functional genomics analysis. Insect Mol. Biol. 2015, 24, 338–347. [Google Scholar] [CrossRef] [PubMed]
- Song, L.; Zhang, J.M.; Lu, Y.B. Sublethal effects of indoxacarb and beta-cypermethrin on Plutella xylostella (Lepidoptera: Plutellidae). Acta Entomol. Sin. 2013, 56, 521–529. [Google Scholar]
- Bloomquist, J.R. Ion channels as targets for insecticides. Annu. Rev. Entomol. 1996, 41, 163–190. [Google Scholar] [CrossRef] [PubMed]
- Desneux, N.; Decourtye, A.; Delpuech, J.M. The sublethal effects of pesticides on beneficial arthropods. Annu. Rev. Entomol. 2007, 52, 81–106. [Google Scholar] [CrossRef]
- Belzunces, L.P.; Tchamitchian, S.; Brunet, J.-L. Neural effects of insecticides in the honey bee. Apidologie 2012, 43, 348–370. [Google Scholar] [CrossRef]
- Zuo, Y.Y.; Wang, K.; Lin, F.F.; Li, Y.T.; Peng, X.; Piñero, J.C.; Chen, M.H. Sublethal effects of indoxacarb and beta-cypermethrin on Rhopalosiphum padi(Hemiptera: Aphididae) under laboratory conditions. Fla. Entomol. 2016, 99, 445–450. [Google Scholar] [CrossRef]
- Montano-Campaz, M.L.; Dias, L.G.; Bacca, T.; Toro-Restrepo, B.; Oliveira, E.E. Exposures to deltamethrin on immature Chironomus columbiensis drive sublethal and transgenerational effects on their reproduction and wing morphology. Chemosphere 2022, 296, 134042. [Google Scholar] [CrossRef] [PubMed]
- Joncour, B.; Nelson, W.A. Sublethal concentration of insecticide amplifies interference competition in a tortrix moth. Ecotoxicol. Environ. Saf. 2021, 220, 112324. [Google Scholar] [CrossRef] [PubMed]
- Guedes, R.N.C.; Cutler, G.C. Insecticide-induced hormesis and arthropod pest management. Pest Manag. Sci. 2014, 70, 690–697. [Google Scholar] [CrossRef] [PubMed]
- Cutler, G.C.; Ramanaidu, K.; Astatkie, T.; Isman, M.B. Green peach aphid, Myzus persicae (Hemiptera: Aphididae), reproduction during exposure to sublethal concentrations of imidacloprid and azadirachtin. Pest Manag. Sci. 2009, 65, 205–209. [Google Scholar] [CrossRef] [PubMed]
- Rakotondravelo, M.; Smitley, D.; Calabrese, E.; Ladoni, M. Traces of imidacloprid induce hormesis as a stimulatory conditioned response of sweetpotato whitefly (Hemiptera: Aleyrodidae). Environ. Entomol. 2019, 48, 1418–1424. [Google Scholar] [CrossRef] [PubMed]
- Cao, Y.; Yang, H.; Li, J.; Wang, C.; Li, C.; Gao, Y.L. Sublethal effects of imidacloprid on the population development of western flower thrips Frankliniella occidentalis (Thysanoptera: Thripidae). Insects 2019, 10, 3. [Google Scholar] [CrossRef]
- Tricoire-Leignel, H.; Thany, S.H.; Gadenne, C.; Anton, S. Pest insect olfaction in an insecticide-contaminated environment: Info-disruption or hormesis effect. Front. Physiol. 2012, 3, 58. [Google Scholar] [CrossRef]
- Maryoung, L.A.; Blunt, B.; Tierney, K.B.; Schlenk, D. Sublethal toxicity of chlorpyrifos to salmonid olfaction after hypersaline acclimation. Aquat. Toxicol. 2015, 161, 94–101. [Google Scholar] [CrossRef]
- Tappert, L.; Pokorny, T.; Hofferberth, J.; Ruther, J. Sublethal doses of imidacloprid disrupt sexual communication and host finding in a parasitoid wasp. Sci. Rep. 2017, 7, 42756. [Google Scholar] [CrossRef] [PubMed]
- Peng, Y.C.; Yang, E.C. Sublethal dosage of imidacloprid reduces the microglomerular density of honey bee mushroom bodies. Sci. Rep. 2016, 6, 19298. [Google Scholar] [CrossRef]
- Hou, Q.L.; Chen, E.H.; Jiang, H.B.; Wei, D.D.; Gui, S.H.; Wang, J.J.; Smagghe, G. Adipokinetic hormone receptor gene identification and its role in triacylglycerol mobilization and sexual behavior in the oriental fruit fly (Bactrocera dorsalis). Insect Biochem. Mol. Biol. 2017, 90, 1–13. [Google Scholar] [CrossRef] [PubMed]
- Shen, G.M.; Dou, W.; Huang, Y.; Jiang, X.Z.; Smagghe, G.; Wang, J.J. In silico cloning and annotation of genes involved in the digestion, detoxification and RNA interference mechanism in the midgut of Bactrocera dorsalis Hendel (Diptera: Tephritidae). Insect Mol. Biol. 2013, 22, 354–365. [Google Scholar] [CrossRef] [PubMed]
- Meng, L.W.; Yuan, G.R.; Lu, X.P.; Jing, T.X.; Zheng, L.S.; Yong, H.X.; Wang, J.J. Two delta class glutathione S-transferases involved in the detoxification of malathion in Bactrocera dorsalis (Hendel). Pest Manag. Sci. 2019, 75, 1527–1538. [Google Scholar] [CrossRef] [PubMed]
- Xu, L.; Jiang, H.B.; Tang, K.Y.; Yan, Y.; Schetelig, M.F.; Wang, J.J. CRISPR-mediated mutagenesis of the odorant receptor co-receptor (Orco) gene disrupts olfaction-mediated behaviors in Bactrocera dorsalis. Insect Sci. 2021. online ahead of print. [Google Scholar] [CrossRef]
- Jayanthi, P.D.K.; Kempraj, V.; Aurade, R.M.; Venkataramanappa, R.K.; Nandagopal, B.; Verghese, A.; Bruce, T.J.A. Specific volatile compounds from mango elicit oviposition in gravid Bactrocera dorsalis females. J. Chem. Ecol. 2014, 40, 259–266. [Google Scholar] [CrossRef]
- Manoukis, N.C.; Cha, D.H.; Collignon, R.M.; Shelly, T.E. Terminalia larval host fruit reduces the response of Bactrocera dorsalis (Diptera: Tephritidae) adults to the male lure methyl eugenol. J. Econ. Entomol. 2018, 111, 1644–1649. [Google Scholar] [CrossRef]
- Shi, W.; Liu, H.; Ye, H. Behavioral response of Bactrocera dorsalis to five kinds of odor volatile of mango. Chin. Bull. Entomol. 2010, 47, 318–321. [Google Scholar]
- Li, H.F.; Huang, X.Y.; Yang, Y.H.; Chen, X.F.; Yang, Y.; Wang, J.J.; Jiang, H.B. The short neuropeptide F receptor regulates olfaction-mediated foraging behavior in the oriental fruit fly Bactrocera dorsalis (Hendel). Insect Biochem. Mol. Biol. 2022, 140, 9. [Google Scholar] [CrossRef]
- Gui, S.H.; Jiang, H.B.; Xu, L.; Pei, Y.X.; Liu, X.Q.; Guy, S.G.; Wang, J.J. Role of a tachykinin-related peptide and its receptor in modulating the olfactory sensitivity in the oriental fruit fly, Bactrocera dorsalis (Hendel). Insect Biochem. Mol. Biol. 2017, 80, 71–78. [Google Scholar] [CrossRef]
- Yang, Y.; Xiong, Y.; Li, H.F.; Zhao, H.J.; Tang, G.H.; Meng, L.W.; Wang, J.J.; Jiang, H.B. The adipokinetic hormone signaling system regulates the sensitivity of Bactrocera dorsalis to malathion. Pestic. Biochem. Physiol. 2021, 174, 104808. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCt method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Sedaratian, A.; Fathipour, Y.; Talaei-Hassanloui, R.; Jurat-Fuentes, J.L. Fitness costs of sublethal exposure to Bacillus thuringiensis in Helicoverpa armigera: A carryover study on offspring. J. Appl. Entomol. 2013, 137, 540–549. [Google Scholar] [CrossRef]
- Zhang, X.; Xu, Q.J.; Lu, W.W.; Liu, F. Sublethal effects of four synthetic insecticides on the generalist predator Cyrtorhinus lividipennis. J. Pest Sci. 2015, 88, 383–392. [Google Scholar] [CrossRef]
- Zhang, R.M.; He, S.Y.; Zeng, J.W.; Chen, J.H.; Dong, J.F. Cross-resistance and lack of fitness costs occurred in the cyantraniliprole-resistant oriental fruit fly. Phytoparasitica 2021, 49, 703–712. [Google Scholar] [CrossRef]
- Linn, C.E.; Roelofs, W.L. Sublethal effects of neuroactive compounds on pheromone response thresholds in male oriental fruit moths. Arch. Insect Biochem. Physiol. 1984, 1, 331–344. [Google Scholar] [CrossRef]
- Xiao, D.; Tan, X.L.; Wang, W.J.; Zhang, F.; Desneux, N.; Wang, S. Modification of flight and locomotion performances, respiratory metabolism and transcriptome expression in the lady beetle Harmonia axyridis through sublethal pesticide exposure. Front. Physiol. 2017, 8, 33. [Google Scholar] [CrossRef]
- Leal, W.S. Odorant reception in rnsects: Roles of receptors, binding proteins, and degrading Enzymes. Annu. Rev. Entomol. 2013, 58, 373–391. [Google Scholar] [CrossRef]
- Chen, X.F.; Lei, Y.B.; Li, H.F.; Xu, L.; Yang, H.; Wang, J.J.; Jiang, H.B. CRISPR/Cas9 mutagenesis abolishes odorant-binding protein BdorOBP56f-2 and impairs the perception of methyl eugenol in Bactrocera dorsalis (Hendel). Insect Biochem. Mol. Biol. 2021, 139, 7. [Google Scholar] [CrossRef]
- Chen, X.F.; Yang, H.; Wu, S.X.; Zhao, W.; Hao, G.F.; Wang, J.J.; Jiang, H.B. BdorOBP69a is involved in the perception of the phenylpropanoid compound methyl eugenol in oriental fruit fly (Bactrocera dorsalis) males. Insect Biochem. Mol. Biol. 2022, 147, 103801. [Google Scholar] [CrossRef]
- Wicher, D.; Miazzi, F. Functional properties of insect olfactory receptors: Ionotropic receptors and odorant receptors. Cell Tissue Res. 2021, 383, 7–19. [Google Scholar] [CrossRef] [PubMed]
- Lalouette, L.; Pottier, M.-A.; Wycke, M.-A.; Boitard, C.; Bozzolan, F.; Maria, A.; Demondion, E.; Chertemps, T.; Lucas, P.; Renault, D.; et al. Unexpected effects of sublethal doses of insecticide on the peripheral olfactory response and sexual behavior in a pest insect. Environ. Sci. Pollut. Res. 2016, 23, 3073–3085. [Google Scholar] [CrossRef] [PubMed]
- Rabhi, K.K.; Deisig, N.; Demondion, E.; Le Corre, J.; Robert, G.; Tricoire-Leignel, H.; Lucas, P.; Gadenne, C.; Anton, S. Low doses of a neonicotinoid insecticide modify pheromone response thresholds of central but not peripheral olfactory neurons in a pest insect. Proc. R. Soc. B-Biol. Sci. 2016, 283, 20152987. [Google Scholar] [CrossRef] [PubMed]
- Kang, Z.W.; Liu, F.H.; Pang, R.P.; Tian, H.G.; Liu, T.X. Effect of sublethal doses of imidacloprid on the biological performance of aphid endoparasitoid Aphidius gifuensis (Hymenoptera: Aphidiidae) and Influence on its related gene expression. Front. Physiol. 2018, 9, 1729. [Google Scholar] [CrossRef]
- Ni, L. The structure and function of ionotropic receptors in Drosophila. Front. Mol. Neurosci. 2021, 13, 638839. [Google Scholar] [CrossRef]
- Ono, H.; Hee, A.K.W.; Jiang, H.B. Recent advancements in studies on chemosensory mechanisms underlying detection of semiochemicals in dacini fruit flies of economic importance (Diptera: Tephritidae). Insects 2021, 12, 106. [Google Scholar] [CrossRef]
Primer | Sequence (5′-3′) | Amplification Efficiency | Product Length (nt) |
---|---|---|---|
qPCR-α-tubulin-F | CGCATTCATGGTTGATAACG | 97.5% | 184 |
qPCR-α-tubulin-R | GGGCACCAAGTTAGTCTGGA | ||
qPCR-rps 3-F | TAAGTTGACCGGAGGTTTGG | 98.3% | 169 |
qPCR-rps 3-R | TGGATCACCAGAGTGGATCA | ||
qPCR-ORco-F | TTGACATCCACCATTATGCTGAC | 95.3% | 209 |
qPCR-ORco-R | TCCTCGGAGCCATCATACCA | ||
qPCR-IR8a-F | ATTGCGGCGTTGGTGGGTA | 97.7% | 185 |
qPCR-IR8a-R | GAGACGGCTTTTGGTGCTT | ||
qPCR-IR25a-F | TTGCTCCAGGTAATGCCTCC | 96.5% | 189 |
qPCR-IR25a-R | TCGTTTTCCCTCCTTCGCAA | ||
qPCR-IR76b-F | CCACTTTGGACGAGGGTGAA | 101.5% | 194 |
qPCR-IR76b-R | AGGCTTCTGCTCCTTATCGC | ||
qPCR-IR93a-F | AAGTGTAGCGGTCATGGTGG | 90.7% | 171 |
qPCR-IR93a-R | TGCAAAGACACCTCGCTTCT |
Insecticide | n | Slope ± SE | X2 | df | Concentration (95% CI) (ng/fly) | RR * |
---|---|---|---|---|---|---|
β-cypermethrin | 360 | 2.85 ± 0.47 | 1.96 | 4 | LD30 = 9.70 (7.91–11.18) | 11.7 |
LD50 = 14.50 (12.76–14.46) |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wu, S.-X.; Chen, Y.; Lei, Q.; Peng, Y.-Y.; Jiang, H.-B. Sublethal Dose of β-Cypermethrin Impairs the Olfaction of Bactrocera dorsalis by Suppressing the Expression of Chemosensory Genes. Insects 2022, 13, 721. https://doi.org/10.3390/insects13080721
Wu S-X, Chen Y, Lei Q, Peng Y-Y, Jiang H-B. Sublethal Dose of β-Cypermethrin Impairs the Olfaction of Bactrocera dorsalis by Suppressing the Expression of Chemosensory Genes. Insects. 2022; 13(8):721. https://doi.org/10.3390/insects13080721
Chicago/Turabian StyleWu, Shuang-Xiong, Yang Chen, Quan Lei, Yuan-Yuan Peng, and Hong-Bo Jiang. 2022. "Sublethal Dose of β-Cypermethrin Impairs the Olfaction of Bactrocera dorsalis by Suppressing the Expression of Chemosensory Genes" Insects 13, no. 8: 721. https://doi.org/10.3390/insects13080721
APA StyleWu, S.-X., Chen, Y., Lei, Q., Peng, Y.-Y., & Jiang, H.-B. (2022). Sublethal Dose of β-Cypermethrin Impairs the Olfaction of Bactrocera dorsalis by Suppressing the Expression of Chemosensory Genes. Insects, 13(8), 721. https://doi.org/10.3390/insects13080721