Inhibition of Zoonotic Pathogens Naturally Found in Pig Manure by Black Soldier Fly Larvae and Their Intestine Bacteria
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Rearing of Neonate BSF Larvae
2.2. Pig Manure
2.3. BSF Larva Conversion Systems
2.4. Zoonotic Pathogen Populations Counting Methods
2.5. Screening of the Antagonistic Activity of the Bacteria from the Gut of the BSF Larvae against Manure-Associated Zoonotic Pathogens
2.6. Quantitative Real-Time PCR (qRT-PCR) Analysis of the AMP Genes
2.7. Strains, Plasmids, and Reagents
2.8. Assay of the DLP4 Antimicrobial Activity In Vitro
2.9. Data Analysis
3. Results
3.1. Evaluation of the Efficiency of the BSF Larvae in Reducing Zoonotic Pathogens in Pig Manure
3.2. Antagonistic Activity In Vitro
3.3. Transcriptional Patterns of Antibacterial Genes DLP4 and Cg-Ubiquitin
3.4. Recombinant Expression and Purification of the DLP4 Gene in P. pastoris
3.5. Antimicrobial Assays of the Purified DLP4
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Li, J.; Li, C.; Wang, M.; Wang, L.; Liu, X.; Gao, C.; Ren, L.; Luo, Y. Gut Structure and microbial communities in Sirex noctilio (Hymenoptera: Siricidae) and their predicted contribution to larval nutrition. Front. Microbiol. 2021, 12, 641141. [Google Scholar] [CrossRef]
- Moretta, A.; Salvia, R.; Scieuzo, C.; Di Somma, A.; Vogel, H.; Pucci, P.; Sgambato, A.; Wolff, M.; Falabella, P. A bioinformatic study of antimicrobial peptides identified in the Black Soldier Fly (BSF) Hermetia illucens (Diptera: Stratiomyidae). Sci. Rep. 2020, 10, 16875. [Google Scholar] [CrossRef]
- Wang, S.; Liu, X.; Xia, Z.; Xie, G.; Tang, B.; Wang, S. Transcriptome analysis of the molecular mechanism underlying immunity and reproduction trade-off in Locusta migratoria infected by Micrococcus luteus. PLoS ONE 2019, 14, e0211605. [Google Scholar] [CrossRef] [PubMed]
- Sahoo, A.; Swain, S.S.; Behera, A.; Sahoo, G.; Mahapatra, P.K.; Panda, S.K. Antimicrobial peptides derived from insects offer a novel therapeutic option to combat biofilm: A review. Front. Microbiol. 2021, 12, 661195. [Google Scholar] [CrossRef] [PubMed]
- Gupta, A.; Nair, S. Dynamics of insect-microbiome interaction influence host and microbial symbiont. Front. Microbiol. 2020, 11, 1357. [Google Scholar] [CrossRef]
- Dillon, R.J.; Dillon, V.M. The gut bacteria of insects: Nonpathogenic interactions. Annu. Rev. Entomol. 2004, 49, 71–92. [Google Scholar] [CrossRef] [PubMed]
- Shi, W.; Xie, S.; Chen, X.; Sun, S.; Zhou, X.; Liu, L.; Gao, P.; Kyrpides, N.C.; No, E.G.; Yuan, J.S. Comparative genomic analysis of the endosymbionts of herbivorous insects reveals eco-environmental adaptations: Biotechnology applications. PLoS Genet. 2013, 9, e1003131. [Google Scholar] [CrossRef]
- Lin, X.L.; Pan, Q.J.; Tian, H.G.; Douglas, A.E.; Liu, T.X. Bacteria abundance and diversity of different life stages of Plutella xylostella (Lepidoptera: Plutellidae), revealed by bacteria culture-dependent and PCR-DGGE methods. Insect Sci. 2015, 22, 375–385. [Google Scholar] [CrossRef] [PubMed]
- Amer, A.; Hamdy, B.; Mahmoud, D.; Elanany, M.; Rady, M.; Alahmadi, T.; Alharbi, S.; AlAshaal, S. Antagonistic activity of bacteria isolated from the Periplaneta americana L. gut against some multidrug-resistant human pathogens. Antibiotics 2021, 10, 294. [Google Scholar] [CrossRef]
- Robles-Fort, A.; García-Robles, I.; Fernando, W.; Hoskin, D.W.; Rausell, C.; Real, M.D. Dual antimicrobial and antiproliferative activity of TcPaSK peptide derived from a Tribolium castaneum insect defensin. Microorganisms 2021, 9, 222. [Google Scholar] [CrossRef]
- Park, S.I.; Kim, J.W.; Yoe, S.M. Purifcation and characterization of a novel antibacterial peptide from black soldier fy (Hermetia illucens) larvae. Dev. Comp. Immunol. 2015, 52, 98–106. [Google Scholar] [CrossRef] [PubMed]
- Hanzawa, H.; Shimada, I.; Kuzuhara, T.; Komano, H.; Kohda, D.; Inagaki, F.; Natori, S.; Arata, Y. 1H nuclear magnetic resonance study of the solution conformation of an antibacterial protein, sapecin. FEBS Lett. 1990, 269, 413–420. [Google Scholar] [CrossRef] [Green Version]
- Cerovský, V.; Zdárek, J.; Fucík, V.; Monincová, L.; Voburka, Z.; Bém, R. Lucifensin, the long-sought antimicrobial factor of medicinal maggots of the blowfly Lucilia sericata. Cell Mol. Life Sci. 2010, 67, 455–466. [Google Scholar] [CrossRef]
- Xu, D.; Lu, W. Defensins: A Double-Edged Sword in Host Immunity. Front. Immunol. 2020, 11, 764. [Google Scholar] [CrossRef]
- Schlesinger, D.H.; Goldstein, G. Molecular conservation of 74 amino acid sequence of ubiquitin between cattle and man. Nature 1975, 255, 423–424. [Google Scholar] [CrossRef]
- Seo, J.K.; Lee, M.J.; Go, H.J.; Kim, G.D.; Jeong, H.D.; Nam, B.H.; Park, N.G. Purification and antimicrobial function of ubiquitin isolated from the gill of Pacific oyster, Crassostrea gigas. Mol. Immunol. 2013, 53, 88–98. [Google Scholar] [CrossRef]
- Chen, C.; Qin, H.; Tan, J.; Hu, Z.; Zeng, L. The Role of Ubiquitin-Proteasome Pathway and Autophagy-Lysosome Pathway in Cerebral Ischemia. Oxid. Med. Cell Longev. 2020, 2020, 5457049. [Google Scholar] [CrossRef]
- Bachère, E.; Rosa, R.D.; Schmitt, P.; Poirier, A.; Merou, N.; Charrière, G.M.; Destoumieux-Garzón, D. The new insights into the oyster antimicrobial defense: Cellular, molecular and genetic view. Fish Shellfish Immunol. 2015, 46, 50–64. [Google Scholar] [CrossRef] [Green Version]
- Mazza, L.; Xiao, X.; Ur Rehman, K.; Cai, M.; Zhang, D.; Fasulo, S.; Tomberlin, J.K.; Zheng, L.; Soomro, A.A.; Yu, Z.; et al. Management of chicken manure using black soldier fly (Diptera: Stratiomyidae) larvae assisted by companion bacteria. Waste Manag. 2020, 102, 312–318. [Google Scholar] [CrossRef] [PubMed]
- Newton, G.L.; Sheppard, D.C.; Watson, D.W.; Burtle, G.J.; Thelen, E.E. The black soldier fly, Hermetia illucens, as a manure management/resource recovery tool. Symp. State Sci. Anim. Manure Waste Manag. 2016, 1, 57. [Google Scholar]
- Joosten, L.; Lecocq, A.; Jensen, A.B.; Haenen, O.; Schmitt, E.; Eilenberg, J. Review of insect pathogen risks for the black soldier fly (Hermetia illucens) and guidelines for reliable production. Entomol. Exp. Appl. 2020, 168, 432–447. [Google Scholar] [CrossRef]
- Liu, Q.; Tomberlin, J.K.; Brady, J.A.; Sanford, M.R.; Yu, Z. Black soldier fly (Diptera: Stratiomyidae) larvae reduce Escherichia coli in dairy manure. Environ. Entomol. 2008, 37, 1525–1530. [Google Scholar] [CrossRef]
- Erickson, M.C.; Islam, M.; Sheppard, C.; Liao, J.; Doyle, M.P. Reduction of Escherichia coli O157:H7 and Salmonella enterica serovar Enteritidis in chicken manure by larvae of the black soldier fly. J. Food Prot. 2004, 67, 685–690. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Choi, W.H.; Yun, J.H.; Chu, J.P.; Chu, K.B. Antibacterial effect of extracts of Hermetia illucens (Diptera: Stratiomyidae) larvae against Gram-negative bacteria. Entomol. Res. 2012, 42, 219–226. [Google Scholar] [CrossRef]
- Park, S.I.; Chang, B.S.; Yoe, S.M. Detection of antimicrobial substances from larvae of the black soldier fly, Hermetia illucens (Diptera: Stratiomyidae). Entomol. Res. 2014, 44, 58–64. [Google Scholar] [CrossRef]
- Lee, K.S.; Yun, E.Y.; Goo, T.W. Antimicrobial Activity of an Extract of Hermetia illucens Larvae Immunized with Lactobacillus casei against Salmonella Species. Insects 2020, 11, 704. [Google Scholar] [CrossRef]
- Zhou, D.Z.; Cao, L.; Wang, M.L.; Yu, Z.N.; Zhang, J.B. Screening of antagonistic bacteria from gut of black soldier fly and the molecular identification of antimicrobial active substances. Microbiol./Weishengwuxue Tongbao 2012, 39, 1614–1621. [Google Scholar]
- Zhang, J.; Huang, L.; He, J.; Tomberlin, J.K.; Li, J.; Lei, C.; Sun, M.; Liu, Z.; Yu, Z. An artificial light source influences mating and oviposition of black soldier flies, Hermetia illucens. J. Insect Sci. 2010, 10, 202. [Google Scholar] [CrossRef] [Green Version]
- Huang, Y.; Yu, Y.; Zhan, S.; Tomberlin, J.K.; Huang, D.; Cai, M.; Zheng, L.; Yu, Z.; Zhang, J. Dual oxidase duox and toll-like receptor 3 tlr3 in the toll pathway suppress zoonotic pathogens through regulating the intestinal bacterial community homeostasis in Hermetia illucens L. PLoS ONE 2020, 15, e0225873. [Google Scholar] [CrossRef]
- Zivkovic, S.; Stojanovic, S.; Ivanovic, Z.; Gavrilovic, V.; Popovic, T.; Balaz, J. Screening of antagonistic activity of microorganisms against colletotrichum acutatum and colletotrichum gloeosporioides. Arch. Biol. Sci. 2010, 62, 611–623. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Guo, C.; Huang, Y.; Zheng, H.; Tang, L.; He, J.; Xiang, L.; Liu, D.; Jiang, H. Secretion and activity of antimicrobial peptide cecropin D expressed in Pichia pastoris. Exp. Ther. Med. 2012, 4, 1063–1068. [Google Scholar] [CrossRef] [Green Version]
- Mulder, K.C.; de Lima, L.A.; Aguiar, P.S.; Carneiro, F.C.; Franco, O.L.; Dias, S.C.; Parachin, N.S. Production of a modified peptide clavanin in Pichia pastoris: Cloning, expression, purification and in vitro activities. AMB Express 2015, 5, 129. [Google Scholar] [CrossRef] [Green Version]
- Sultana, A.; Luo, H.; Ramakrishna, S. Harvesting of antimicrobial peptides from insect (hermetia illucens) and its applications in the food packaging. Appl. Sci. 2021, 11, 6991. [Google Scholar] [CrossRef]
- Wang, X.B.; Nan, W.; Cai, R.J.; Geng, W.N.; Xu, X.Y. Changes in speciation, mobility and bioavailability of Cd, Cr and as during the transformation process of pig manure by black soldier fly larvae (Hermetia illucens). J. Integr. Agric. 2021, 20, 1157–1166. [Google Scholar] [CrossRef]
- Lalander, C.H.; Fidjeland, J.; Diener, S.; Eriksson, S.; Vinnerås, B. High waste-to-biomass conversion and efficient Salmonella spp. reduction using black soldier fly for waste recycling. Agron. Sustain. Dev. 2015, 35, 261–271. [Google Scholar] [CrossRef]
- Awasthi, M.K.; Liu, T.; Awasthi, S.K.; Duan, Y.; Pandey, A.; Zhang, Z. Manure pretreatments with black soldier fly Hermetia illucens L. (Diptera: Stratiomyidae): A study to reduce pathogen content. Sci. Total Environ. 2020, 737, 139842. [Google Scholar] [CrossRef] [PubMed]
- Tanga, C.M.; Waweru, J.W.; Tola, Y.H.; Onyoni, A.A.; Khamis, F.M.; Ekesi, S.; Paredes, J.C. Organic waste substrates induce important shifts in gut microbiota of black soldier fly (Hermetia illucens L.): Coexistence of conserved, variable, and potential pathogenic microbes. Front. Microbiol. 2021, 12, 635881. [Google Scholar] [CrossRef] [PubMed]
- Prakash, O.; Shouche, Y.; Jangid, K.; Kostka, J.E. Microbial cultivation and the role of microbial resource centers in the omics era. Appl. Microbiol. Biotechnol. 2013, 97, 51–62. [Google Scholar] [CrossRef] [PubMed]
- Yi, H.Y.; Chowdhury, M.; Huang, Y.D.; Yu, X.Q. Insect antimicrobial peptides and their applications. Appl. Microbiol. Biotechnol. 2014, 98, 5807–5822. [Google Scholar] [CrossRef] [Green Version]
- Al Souhail, Q.; Hiromasa, Y.; Rahnamaeian, M.; Giraldo, M.C.; Takahashi, D.; Valent, B.; Vilcinskas, A.; Kanost, M.R. Characterization and regulation of expression of an antifungal peptide from hemolymph of an insect, Manduca sexta. Dev. Comp. Immunol. 2016, 61, 258–268. [Google Scholar] [CrossRef] [Green Version]
- Pöppel, A.K.; Vogel, H.; Wiesner, J.; Vilcinskas, A. Antimicrobial peptides expressed in medicinal maggots of the blow fly Lucilia sericata show combinatorial activity against bacteria. Antimicrob. Agents Chemother. 2015, 59, 2508–2514. [Google Scholar] [CrossRef] [Green Version]
- Lee, J.; Bang, K.; Hwang, S.; Cho, S. cDNA cloning and molecular characterization of a defensin-like antimicrobial peptide from larvae of Protaetia brevitarsis seulensis (Kolbe). Mol. Biol. Rep. 2016, 43, 371–379. [Google Scholar] [CrossRef]
- Vieira, C.S.; Waniek, P.J.; Castro, D.P.; Mattos, D.P.; Moreira, O.C.; Azambuja, P. Impact of Trypanosoma cruzi on antimicrobial peptide gene expression and activity in the fat body and midgut of Rhodnius prolixus. Parasit. Vectors 2016, 9, 119. [Google Scholar] [CrossRef] [Green Version]
- Manniello, M.D.; Moretta, A.; Salvia, R.; Scieuzo, C.; Lucchetti, D.; Vogel, H.; Sgambato, A.; Falabella, P. Insect antimicrobial peptides: Potential weapons to counteract the antibiotic resistance. Cell Mol. Life Sci. 2021, 78, 4259–4282. [Google Scholar] [CrossRef]
- Arora, S.; Baptista, C.; Lim, C.S. Maggot metabolites and their combinatory effects with antibiotic on Staphylococcus aureus. Ann. Clin. Microbiol. Antimicrob. 2011, 10, 6. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, Z.; Wang, J.; Zhang, B.; Liu, H.; Song, W.; He, J.; Lv, D.; Wang, S.; Xu, X. Activity of antibacterial protein from maggots against Staphylococcus aureus in vitro and in vivo. Int. J. Mol. Med. 2013, 31, 1159–1165. [Google Scholar] [CrossRef] [PubMed]
- Jacobs, C.G.C.; Steiger, S.; Heckel, D.G.; Wielsch, N.; Vilcinskas, A.; Vogel, H. Sex, offspring and carcass determine antimicrobial peptide expression in the burying beetle. Sci. Rep. 2016, 6, 25409. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Gene | Primer1 Sequence (5′-3′) | Primer 2 Sequence (5′-3′) |
---|---|---|
qβ-actin | AAACCTTCAACGCCCCAGC | GGCGTGTGGAAGAGCATAACC |
qDLP4 | CTGTGACCTGTTGAGCCCTTT | AACAGCTCTTTTGTCACACCATC |
qCg-Ubiquitin | TCGTCAAGACTTTGACCGGC | GGGTGCGTCCATCTTCCAAT |
Strain No. | Highest Identity Sequences | Query Coverage | E-Value | Percent Identity | GeneBank Accession No. |
---|---|---|---|---|---|
BSF-F | Serratia marcescens | 100% | 0.0 | 100% | CP050960.1 |
BSF-CL | B. subtilis | 99% | 0.0 | 99.86% | MW345828.1 |
Microorganism Strain | MIC (µM) |
---|---|
Staphylococcus aureus CICC10001 | 1.5 |
Salmonella enterica serovar Typhimurium CICC10420 | 27 |
Escherichia coli CICC10003 | >30 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Elhag, O.; Zhang, Y.; Xiao, X.; Cai, M.; Zheng, L.; Jordan, H.R.; Tomberlin, J.K.; Huang, F.; Yu, Z.; Zhang, J. Inhibition of Zoonotic Pathogens Naturally Found in Pig Manure by Black Soldier Fly Larvae and Their Intestine Bacteria. Insects 2022, 13, 66. https://doi.org/10.3390/insects13010066
Elhag O, Zhang Y, Xiao X, Cai M, Zheng L, Jordan HR, Tomberlin JK, Huang F, Yu Z, Zhang J. Inhibition of Zoonotic Pathogens Naturally Found in Pig Manure by Black Soldier Fly Larvae and Their Intestine Bacteria. Insects. 2022; 13(1):66. https://doi.org/10.3390/insects13010066
Chicago/Turabian StyleElhag, Osama, Yuanpu Zhang, Xiaopeng Xiao, Minmin Cai, Longyu Zheng, Heather R. Jordan, Jeffery K. Tomberlin, Feng Huang, Ziniu Yu, and Jibin Zhang. 2022. "Inhibition of Zoonotic Pathogens Naturally Found in Pig Manure by Black Soldier Fly Larvae and Their Intestine Bacteria" Insects 13, no. 1: 66. https://doi.org/10.3390/insects13010066
APA StyleElhag, O., Zhang, Y., Xiao, X., Cai, M., Zheng, L., Jordan, H. R., Tomberlin, J. K., Huang, F., Yu, Z., & Zhang, J. (2022). Inhibition of Zoonotic Pathogens Naturally Found in Pig Manure by Black Soldier Fly Larvae and Their Intestine Bacteria. Insects, 13(1), 66. https://doi.org/10.3390/insects13010066