Sensitive Detection of Plasma Fibrinogen Chain A mRNA in Hepatocellular Carcinoma Using Semi-Nested RT-PCR
Abstract
1. Introduction
2. Materials and Methods
2.1. Subjects and Methods
2.2. Sample Collection and Processing
2.3. Quantification of FGA mRNA
2.3.1. First Round of Amplification
2.3.2. Second Round of Amplification
2.4. Data Analysis
3. Results and Discussion
3.1. Study Population Characteristics
3.2. Plasma Concentrations of FGA mRNA Across Patient Groups
3.3. Diagnostic Performance of Plasma FGA mRNA
3.4. Combined Use of Plasma FGA mRNA and AFP for Diagnosis
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
| HCC | Hepatocellular carcinoma |
| CLD | Chronic liver disease |
| HD | Healthy donor |
| AFP | Alpha-fetoprotein |
| FGA mRNA | Fibrinogen alpha chain messenger RNA |
| cfRNA | Cell-free RNA |
| RT-PCR | Reverse transcription polymerase chain reaction |
| ROC | Receiver operating characteristic |
| AUC | Area under the curve |
| IC | Internal control |
| BCLC | Barcelona Clinic Liver Cancer |
| ALT | Alanine aminotransferase |
| AST | Aspartate aminotransferase |
| HBV | Hepatitis B virus |
| HCV | Hepatitis C virus |
| IQR | Interquartile range |
| JSGE | Japanese Society of Gastroenterology |
| EASL | European Association for the Study of the Liver |
References
- Bray, F.; Laversanne, M.; Sung, H.; Ferlay, J.; Siegel, R.L.; Soerjomataram, I.; Jemal, A. Global cancer statistics 2022: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J. Clin. 2024, 74, 229–263. [Google Scholar] [CrossRef] [PubMed]
- McMahon, B.; Cohen, C.; Brown, R.S.; El-Serag, H., Jr.; Ioannou, G.N.; Lok, A.S.; Roberts, L.R.; Singal, A.G.; Block, T. Opportunities to address gaps in early detection and improve outcomes of liver cancer. JNCI Cancer Spectr. 2023, 7, pkad034. [Google Scholar] [CrossRef] [PubMed]
- Melendez-Torres, J.; Singal, A.G. Early detection of hepatocellular carcinoma: Roadmap for improvement. Expert Rev. Anticancer. Ther. 2022, 22, 621–632. [Google Scholar] [CrossRef] [PubMed]
- Singal, A.G.; Llovet, J.M.; Yarchoan, M.; Mehta, N.; Heimbach, J.K.; Dawson, L.A.; Jou, J.H.; Kulik, L.M.; Agopian, V.G.; Marrero, J.A.; et al. AASLD Practice Guidance on prevention, diagnosis, and treatment of hepatocellular carcinoma. Hepatology 2023, 78, 1922–1965. [Google Scholar] [CrossRef] [PubMed]
- European Association for the Study of the Liver. EASL Clinical Practice Guidelines: Management of hepatocellular carcinoma. J. Hepatol. 2018, 69, 182–236. [Google Scholar] [CrossRef] [PubMed]
- Kudo, M.; Kawamura, Y.; Hasegawa, K.; Tateishi, R.; Kariyama, K.; Shiina, S.; Toyoda, H.; Imai, Y.; Hiraoka, A.; Ikeda, M.; et al. Management of Hepatocellular Carcinoma in Japan: JSH Consensus Statements and Recommendations 2021 Update. Liver Cancer 2021, 10, 181–223. [Google Scholar] [CrossRef] [PubMed]
- Schlosser, S.; Tümen, D.; Volz, B.; Neumeyer, K.; Egler, N.; Kunst, C.; Tews, H.C.; Schmid, S.; Kandulski, A.; Müller, M.; et al. HCC biomarkers—State of the old and outlook to future promising biomarkers and their potential in everyday clinical practice. Front. Oncol. 2022, 12, 1016952. [Google Scholar] [CrossRef] [PubMed]
- Lehrich, B.M.; Zhang, J.; Monga, S.P.; Dhanasekaran, R. Battle of the biopsies: Role of tissue and liquid biopsy in hepatocellular carcinoma. J. Hepatol. 2024, 80, 515–530. [Google Scholar] [CrossRef] [PubMed]
- Pös, O.; Biró, O.; Szemes, T.; Nagy, B. Circulating cell-free nucleic acids: Characteristics and applications. Eur. J. Hum. Genet. 2018, 26, 937–945. [Google Scholar] [CrossRef] [PubMed]
- Kim, H.J.; Rames, M.J.; Goncalves, F.; Kirschbaum, C.W.; Roskams-Hieter, B.; Spiliotopoulos, E.; Briand, J.; Doe, A.; Estabrook, J.; Wagner, J.T.; et al. Selective enrichment of plasma cell-free messenger RNA in cancer-associated extracellular vesicles. Commun. Biol. 2023, 6, 885. [Google Scholar] [CrossRef] [PubMed]
- Roskams-Hieter, B.; Kim, H.J.; Anur, P.; Wagner, J.T.; Callahan, R.; Spiliotopoulos, E.; Kirschbaum, C.W.; Civitci, F.; Spellman, P.T.; Thompson, R.F.; et al. Plasma cell-free RNA profiling distinguishes cancers from pre-malignant conditions in solid and hematologic malignancies. Npj Precis. Oncol. 2022, 6, 28. [Google Scholar] [CrossRef] [PubMed]
- European Association for the Study of the Liver. EASL 2017 Clinical Practice Guidelines on the management of hepatitis B virus infection. J. Hepatol. 2017, 67, 370–398. [Google Scholar] [CrossRef] [PubMed]
- Yoshiji, H.; Nagoshi, S.; Akahane, T.; Asaoka, Y.; Ueno, Y.; Ogawa, K.; Kawaguchi, T.; Kurosaki, M.; Sakaida, I.; Shimizu, M.; et al. Evidence-based clinical practice guidelines for Liver Cirrhosis 2020. J. Gastroenterol. 2021, 56, 593–619. [Google Scholar] [CrossRef] [PubMed]
- Sun, N.; Zhang, C.; Lee, Y.; Tran, B.V.; Wang, J.; Kim, H.; Lee, J.; Zhang, R.Y.; Wang, J.J.; Hu, J.; et al. HCC EV ECG score: An extracellular vesicle-based protein assay for detection of early-stage hepatocellular carcinoma. Hepatology 2023, 77, 774–788. [Google Scholar] [CrossRef] [PubMed]
- Wolberg, A.S. Fibrinogen and fibrin: Synthesis, structure, and function in health and disease. J. Thromb. Haemost. 2023, 21, 3005–3015. [Google Scholar] [CrossRef] [PubMed]
- Ferrín, G.; Rodríguez-Perálvarez, M.; Aguilar-Melero, P.; Ranchal, I.; Llamoza, C.; Linares, C.I.; González-Rubio, S.; Muntané, J.; Briceño, J.; López-Cillero, P.; et al. Plasma protein biomarkers of hepatocellular carcinoma in HCV-infected alcoholic patients with cirrhosis. PLoS ONE 2015, 10, e0118527. [Google Scholar] [CrossRef] [PubMed]
- Dong, W.; Xia, Z.; Chai, Z.; Qiu, Z.; Wang, X.; Yang, Z.; Wang, J.; Zhang, T.; Zhang, Q.; Jin, J. Proteomic analysis of small extracellular vesicles from the plasma of patients with hepatocellular carcinoma. World J. Surg. Oncol. 2022, 20, 387. [Google Scholar] [CrossRef] [PubMed]
- Kenarangi, T.; Bakhshi, E.; InanlooRahatloo, K.; Biglarian, A. Identification of gene signature in RNA-Seq hepatocellular carcinoma data by Pareto-optimal cluster algorithm. Gastroenterol. Hepatol. Bed Bench 2022, 15, 387–394. [Google Scholar] [PubMed]
- Han, X.; Liu, Z.; Cui, M.; Lin, J.; Li, Y.; Qin, H.; Sheng, J.; Zhang, X. FGA influences invasion and metastasis of hepatocellular carcinoma through the PI3K/AKT pathway. Aging 2024, 16, 12806–12819. [Google Scholar] [CrossRef] [PubMed]
- Chen, L.; Zhang, C.; Xue, R.; Liu, M.; Bai, J.; Bao, J.; Wang, Y.; Jiang, N.; Li, Z.; Wang, W.; et al. Deep whole-genome analysis of 494 hepatocellular carcinomas. Nature 2024, 627, 586–593. [Google Scholar] [CrossRef] [PubMed]






| Amplification Round | Primers/Probe | Sequence (5′-3′) |
|---|---|---|
| 1st PCR round | Forward primer (FGA-Fo) | CGACGTAAAACGACGGCCAGT-GAGAGGCGATTTTTCCTCAG |
| Reverse primer (FGA-Ro) | CTGGCATATCATGACATACGACCTGA-CTGCTTCTCAGATCCTC | |
| Forward primer (IC-Fo) | CGACGTAAAACGACGGCCAGT-ACTAGCGTGCCTTTGTAA | |
| Reverse primer (IC-Ro) | CTGGCATATCATGACATACGACCTGA-GAGCGATACGAGCA | |
| 2nd PCR round | Forward primer (FGA-Fi) | ACCGTGATAATACCTAC |
| Forward primer (IC-Fi) | CTCATTCGTTTCGGAAGAGC | |
| Reverse primer (U-Ri) | CTGGCATATCATGACATACGACCTGA | |
| Internal control sequence (IC) | CGGCGTAATACGACTCACTATAGGGATGAACCGACGACGACTACAGCGTGCCTTTGTAAGCACAAGCTGATGAGTACGAACTTATGTACTCATTCGTTTCGGAAGAGCGGGCGGCTGCTCGCGGATACCCGTACCTCGGGTTTCCGTCTTGCTCGTATCGCTCGAGAACGCAAGTTCTGTTAACGTGAGTCTTGTAAAACCTTCTTTTTACGTTTACTCTCGTGTTAAAAATCTGAATTCTTCTAGAGTTCCTGATCTTC | |
| Characteristics | Category | HCC a (n = 80) | CLD b (n = 57) | HD c (n = 17) | p-Value |
|---|---|---|---|---|---|
| Gender | Male n (%) | 75 (93.7%) | 51 (89.5%) | 13 (76.5%) | >0.05 |
| Female n (%) | 5 (6.3%) | 6 (10.5%) | 4 (23.5%) | ||
| Age (years) | <50 | 12 (15.0%) | 29 (50.9%) | 11 (64.7%) | <0.05 |
| 50–59 | 16 (20.0%) | 10 (17.5%) | 1 (5.9%) | ||
| 60–69 | 32 (40.0%) | 10 (17.5%) | 4 (23.5%) | ||
| ≥70 | 20 (25.0%) | 8 (14.1%) | 1 (5.9%) | ||
| Median (IQR) | 64.0 (54.3–69.8) | 49.0 (41.0–61.5) | 43.0 (36.5–69.0) | p(a,b) = 0.000 * p(a,c) = 0.004 * | |
| PLT | Median (IQR) | 181.5 (125.3–225.3) | 153.0 (94.0–211.0) | - | - |
| Prothrombin % | Median (IQR) | 86.0 (79.0–93.0) | - | - | - |
| INR | Median (IQR) | 1.10 (1.05–1.17) | - | - | - |
| Albumin | Median (IQR) | 37.7 (34.2–40.4) | - | - | - |
| Bilirubin total | Median (IQR) | 13.7 (11.0–19.1) | 15.0 (10.8–36.0) | - | - |
| AFP | Median (IQR) | 52.69 (5.57–944.05) | 4.39 (2.80–6.96) | - | p < 0.05 |
| AST | Median (IQR) | 55.2 (33.6–86.1) | 54.1 (31.3–92.5) | 27.6 (22.8–30.7) | p a,c < 0.05 p b,c < 0.05 |
| ALT | Median (IQR) | 43.6 (29.4–68.2) | 45.5 (30.5–85.4) | 25.6 (19.2–36.5) | p a,c < 0.05 p b,c < 0.05 |
| Risk factor | Cirrhosis | 40 (50.0%) | 27 (47.4%) | 0 (0%) | - |
| HBV | 67 (83.8%) | 52 (91.2%) | 0 (0%) | - | |
| HCV | 1 (1.3%) | 3 (5.3%) | 0 (0%) | - | |
| Alcohol-related | 10 (12.5%) | - | 0 (0%) | - | |
| Number of tumors | Single n (%) | 51 (63.7%) | - | ||
| Two n (%) | 11 (13.8%) | - | |||
| Three n (%) | 4 (5.0%) | - | |||
| More than three n (%) | 14 (17.5%) | - | |||
| Greatest diameter (mm) | Median (IQR) | 48.5 (32.3–70.8) | - | ||
| Tumor location | Right lobe n (%) | 49 (61.2%) | - | ||
| Left lobe n (%) | 16 (20.0%) | - | |||
| Both n (%) | 15 (18.8%) | - | |||
| Vascular invasion | Yes | 23 (28.7%) | - | ||
| No | 57 (71.3%) | - | |||
| Metastatic lymph node | Yes | 3 (3.8%) | - | ||
| No | 77 (96.2%) | - | |||
| Extrahepatic spread | Yes | 4 (5.0%) | - | ||
| No | 76 (95.0%) | - | |||
| BCLC stage | 0 | 1 (1.25%) | - | - | |
| A | 40 (50.0%) | ||||
| B | 12 (15.0%) | - | - | ||
| C | 26 (32.5%) | - | - | ||
| D | 1 (1.25%) | - | - |
| AFP Level | HCC Detected by Combined Marker (Above Threshold) | HCC Missed by Combined Marker (Below Threshold) | Total |
|---|---|---|---|
| High AFP (≥20 ng/mL) | 48 | 0 | 48 |
| Low AFP (<20 ng/mL) | 22 | 10 | 32 |
| Total | 70 | 10 | 80 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Duong, H.; Ngo, M.; Dao, T.; Hoang, T.; Nguyen, U.; Ho, T. Sensitive Detection of Plasma Fibrinogen Chain A mRNA in Hepatocellular Carcinoma Using Semi-Nested RT-PCR. Diagnostics 2025, 15, 1364. https://doi.org/10.3390/diagnostics15111364
Duong H, Ngo M, Dao T, Hoang T, Nguyen U, Ho T. Sensitive Detection of Plasma Fibrinogen Chain A mRNA in Hepatocellular Carcinoma Using Semi-Nested RT-PCR. Diagnostics. 2025; 15(11):1364. https://doi.org/10.3390/diagnostics15111364
Chicago/Turabian StyleDuong, Huy, Minh Ngo, Trang Dao, Trang Hoang, Ung Nguyen, and Tho Ho. 2025. "Sensitive Detection of Plasma Fibrinogen Chain A mRNA in Hepatocellular Carcinoma Using Semi-Nested RT-PCR" Diagnostics 15, no. 11: 1364. https://doi.org/10.3390/diagnostics15111364
APA StyleDuong, H., Ngo, M., Dao, T., Hoang, T., Nguyen, U., & Ho, T. (2025). Sensitive Detection of Plasma Fibrinogen Chain A mRNA in Hepatocellular Carcinoma Using Semi-Nested RT-PCR. Diagnostics, 15(11), 1364. https://doi.org/10.3390/diagnostics15111364

