Osteoprotegerin Gene Polymorphisms Are Associated with Subclinical Atherosclerosis in the Mexican Mestizo Population
Abstract
1. Introduction
2. Materials and Methods
2.1. Study Population
2.2. Single Nucleotide Polymorphism (SNPs) Selection and Genotyping
2.3. Bioinformatics Analysis of Prediction of Transcription Factor Bindings Sites
2.4. Statistical Analysis
3. Results
3.1. Characteristics of the Studied Groups
3.2. Association of OPG Gene Polymorphisms with Subclinical Atherosclerosis
3.3. Haplotype Association Analysis of OPG Gene Polymorphisms
3.4. In Silico Analysis of Transcription Factor Binding Sites to OPG Polymorphisms
3.5. Analysis of CAC Score between C Allele Carriers and Non-C Carriers
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Posadas-Romero, C.; López-Bautista, F. Prevalencia y extensión de la calcificación arterial coronaria en población mexicana asintomática cardiovascular: Estudio Genética de la Enfermedad Aterosclerosa. Arch. Cardiol. Mex. 2017, 87, 292–301. [Google Scholar] [CrossRef] [PubMed]
- Acuña-Valerio, J.; Rodas-Díaz, M.A. Aortic valve calcification prevalence and association with coronary risk factors and atherosclerosis in Mexican population. Arch. Cardiol. Mex. 2017, 87, 108–115. [Google Scholar] [CrossRef] [PubMed]
- Faggiano, A.; Santangelo, G. Cardiovascular Calcification as a Marker of Increased Cardiovascular Risk and a Surrogate for Subclinical Atherosclerosis: Role of Echocardiography. J. Clin. Med. 2021, 10, 1668. [Google Scholar] [CrossRef] [PubMed]
- Faggiano, P.; Dasseni, N. Cardiac calcification as a marker of subclinical atherosclerosis and predictor of cardiovascular events: A review of the evidence. Eur. J. Prev. Cardiol. 2019, 26, 1191–1204. [Google Scholar] [CrossRef] [PubMed]
- Li, W.; Su, S.A. Emerging roles of fibroblasts in cardiovascular calcification. J. Cell. Mol. Med. 2021, 25, 1808–1816. [Google Scholar] [CrossRef] [PubMed]
- Miller, M. An emerging paradigm in atherosclerosis: Focus on subclinical disease. Postgrad. Med. 2009, 121, 49–59. [Google Scholar] [CrossRef]
- Rochette, L.; Meloux, A. The Role of Osteoprotegerin in Vascular Calcification and Bone Metabolism: The Basis for Developing New Therapeutics. Calcif. Tissue Int. 2019, 105, 239–251. [Google Scholar] [CrossRef]
- Abdi, S.; Binbaz, R.A. Association of RANKL and OPG Gene Polymorphism in Arab Women with and without Osteoporosis. Genes 2021, 12, 200. [Google Scholar] [CrossRef]
- Dutka, M.; Bobiński, R. Osteoprotegerin and RANKL-RANK-OPG-TRAIL signalling axis in heart failure and other cardiovascular diseases. Heart Fail. Rev. 2021, 1–17. [Google Scholar] [CrossRef]
- Kiani, A.N.; Aukrust, P. Serum osteoprotegrin (OPG) in subclinical atherosclerosis in systemic lupus erythematosus. Lupus 2017, 26, 865–870. [Google Scholar] [CrossRef]
- Dekker, M.; Waissi, F. High levels of osteoprotegerin are associated with coronary artery calcification in patients suspected of a chronic coronary syndrome. Sci. Rep. 2021, 11, 18946. [Google Scholar] [CrossRef] [PubMed]
- Makarović, S.; Makarović, Z. Osteoprotegerin and Vascular Calcification: Clinical and Prognostic Relevance. Coll. Antropol. 2015, 39, 461–468. [Google Scholar] [PubMed]
- Higgins, C.L.; Isbilir, S. Distribution of alkaline phosphatase, osteopontin, RANK ligand and osteoprotegerin in calcified human carotid atheroma. Protein J. 2015, 34, 315–328. [Google Scholar] [CrossRef] [PubMed]
- Luna-Luna, M.; Cruz-Robles, D. Differential expression of osteopontin, and osteoprotegerin mRNA in epicardial adipose tissue between patients with severe coronary artery disease and aortic valvular stenosis: Association with HDL subclasses. Lipids Health Dis. 2017, 16, 156. [Google Scholar] [CrossRef]
- Cottin, Y.; Issa, R. Association between Serum Osteoprotegerin Levels and Severity of Coronary Artery Disease in Patients with Acute Myocardial Infarction. J. Clin. Med. 2021, 10, 4326. [Google Scholar] [CrossRef]
- Strobescu-Ciobanu, C.; Giuşcă, S.E. Osteopontin and osteoprotegerin in atherosclerotic plaque—Are they significant markers of plaque vulnerability? Rom. J. Morphol. Embryol. 2020, 61, 793–801. [Google Scholar] [CrossRef]
- Pérez de Ciriza, C.; Moreno, M. Circulating osteoprotegerin is increased in the metabolic syndrome and associates with subclinical atherosclerosis and coronary arterial calcification. Clin. Biochem. 2014, 47, 272–278. [Google Scholar] [CrossRef]
- Hakimi, M.; Hyhlik-Dürr, A. The expression of glycophorin A and osteoprotegerin is locally increased in carotid atherosclerotic lesions of symptomatic compared to asymptomatic patients. Int. J. Mol. Med. 2013, 32, 331–338. [Google Scholar] [CrossRef][Green Version]
- Miramontes-González, J.P.; Usategui-Martín, R. VEGFR2 and OPG genes modify the risk of subclinical coronary atherosclerosis in patients with familial hypercholesterolemia. Atherosclerosis 2019, 285, 17–22. [Google Scholar] [CrossRef]
- Pleskovič, A.; Ramuš, S.M. Polymorphism rs2073618 of the osteoprotegerin gene as a potential marker of subclinical carotid atherosclerosis in Caucasians with type 2 diabetes mellitus. Vasa 2017, 46, 355–362. [Google Scholar] [CrossRef][Green Version]
- Villarreal-Molina, T.; Posadas-Romero, C. The ABCA1 gene R230C variant is associated with decreased risk of premature coronary artery disease: The genetics of atherosclerotic disease (GEA) study. PLoS ONE 2012, 7, e49285. [Google Scholar] [CrossRef] [PubMed]
- Posadas-Sánchez, R.; López-Uribe Á, R. Association of the I148M/PNPLA3 (rs738409) polymorphism with premature coronary artery disease, fatty liver, and insulin resistance in type 2 diabetic patients and healthy controls. The GEA study. Immunobiology 2017, 222, 960–966. [Google Scholar] [CrossRef] [PubMed]
- Medina-Urrutia, A.; Posadas-Romero, C. Role of adiponectin and free fatty acids on the association between abdominal visceral fat and insulin resistance. Cardiovasc. Diabetol. 2015, 14, 20. [Google Scholar] [CrossRef] [PubMed]
- Hernández-Avila, M.; Romieu, I. Validity and reproducibility of a food frequency questionnaire to assess dietary intake of women living in Mexico City. Salud Publica Mex. 1998, 40, 133–140. [Google Scholar] [CrossRef] [PubMed]
- Mautner, G.C.; Mautner, S.L. Coronary artery calcification: Assessment with electron beam CT and histomorphometric correlation. Radiology 1994, 192, 619–623. [Google Scholar] [CrossRef] [PubMed]
- Messeguer, X.; Escudero, R. PROMO: Detection of known transcription regulatory elements using species-tailored searches. Bioinformatics 2002, 18, 333–334. [Google Scholar] [CrossRef] [PubMed]
- Xu, Z.; Taylor, J.A. SNPinfo: Integrating GWAS and candidate gene information into functional SNP selection for genetic association studies. Nucleic Acids Res. 2009, 37, W600–W605. [Google Scholar] [CrossRef]
- Zhao, H.; Cao, Y. The association between OPG rs3102735 gene polymorphism, microembolic signal and stroke severity in acute ischemic stroke patients. Gene 2017, 613, 25–29. [Google Scholar] [CrossRef]
- Soufi, M.; Schoppet, M. Osteoprotegerin gene polymorphisms in men with coronary artery disease. J. Clin. Endocrinol. Metab. 2004, 89, 3764–3768. [Google Scholar] [CrossRef][Green Version]
- Pérez-Hernández, N.; Posadas-Sánchez, R. Genetic Variants and Haplotypes in OPG Gene Are Associated with Premature Coronary Artery Disease and Traditional Cardiovascular Risk Factors in Mexican Population: The GEA Study. DNA Cell Biol. 2020, 39, 2085–2094. [Google Scholar] [CrossRef]
- Rhee, E.J.; Oh, K.W. The relationship between four single nucleotide polymorphisms in the promoter region of the osteoprotegerin gene and aortic calcification or coronary artery disease in Koreans. Clin. Endocrinol. 2006, 64, 689–697. [Google Scholar] [CrossRef] [PubMed]
- Alkady, E.A.; Selim, Z.I. Association of serum osteoprotegerin and osteoprotegerin gene polymorphism with subclinical carotid artery atherosclerosis and disease activity in rheumatoid arthritis patients. Egypt. Rheumatol. 2020, 42, 183–188. [Google Scholar] [CrossRef]
- Barquera, R.; Hernández-Zaragoza, D.I. The immunogenetic diversity of the HLA system in Mexico correlates with underlying population genetic structure. Hum. Immunol 2020, 81, 461–474. [Google Scholar] [CrossRef] [PubMed]
- Del Angel-Pablo, A.D.; Juárez-Martín, A.I. HLA Allele and Haplotype Frequencies in Three Urban Mexican Populations: Genetic Diversity for the Approach of Genomic Medicine. Diagnostics 2020, 10, 47. [Google Scholar] [CrossRef]
- Salazar-Flores, J.; Dondiego-Aldape, R. Population structure and paternal admixture landscape on present-day Mexican-Mestizos revealed by Y-STR haplotypes. Am. J. Hum. Biol. 2010, 22, 401–409. [Google Scholar] [CrossRef]
- Juárez-Cedillo, T.; Zuñiga, J. Genetic admixture and diversity estimations in the Mexican Mestizo population from Mexico City using 15 STR polymorphic markers. Forensic Sci. Int. Genet. 2008, 2, e37–e39. [Google Scholar] [CrossRef]
- Luna-Luna, M.; Zentella-Dehesa, A. Epicardial Adipose Tissue in the Progression and Calcification of the Coronary Artery Disease. In Biochemistry of Cardiovascular Dysfunction in Obesity; Springer: Berlin/Heidelberg, Germany, 2020; pp. 195–213. [Google Scholar]
- Min, H.; Morony, S. Osteoprotegerin reverses osteoporosis by inhibiting endosteal osteoclasts and prevents vascular calcification by blocking a process resembling osteoclastogenesis. J. Exp. Med. 2000, 192, 463–474. [Google Scholar] [CrossRef]
- Schoppet, M.; Preissner, K.T. RANK ligand and osteoprotegerin: Paracrine regulators of bone metabolism and vascular function. Arterioscler. Thromb. Vasc. Biol. 2002, 22, 549–553. [Google Scholar] [CrossRef]
- Gunes, M.; Temizkan, S. Serum osteoprotegerin levels, endothelial function and carotid intima-media thickness in type 2 diabetic patients. J. Diabetes Complicat. 2021, 35, 108073. [Google Scholar] [CrossRef]
- Krzanowski, M.; Krzanowska, K. Elevated Circulating Osteoprotegerin Levels in the Plasma of Hemodialyzed Patients With Severe Artery Calcification. Ther. Apher. Dial. 2018, 22, 519–529. [Google Scholar] [CrossRef]
- Gaudio, A.; Privitera, F. Relationships between osteoprotegerin, receptor activator of the nuclear factor kB ligand serum levels and carotid intima-media thickness in patients with type 2 diabetes mellitus. Panminerva Med. 2014, 56, 221–225. [Google Scholar] [PubMed]
- Akinci, B.; Demir, T. Serum osteoprotegerin is associated with carotid intima media thickness in women with previous gestational diabetes. Diabetes Res. Clin. Pract. 2008, 82, 172–178. [Google Scholar] [CrossRef] [PubMed]
- Kalvakolanu, D.V.; Roy, S.K. CCAAT/enhancer binding proteins and interferon signaling pathways. J. Interferon Cytokine Res. 2005, 25, 757–769. [Google Scholar] [CrossRef] [PubMed]
Metabolic and Clinical Characteristics * |
Subclinical Atherosclerosis (n = 372) |
Controls (n = 1041) | p |
---|---|---|---|
Age (years) | 59 ± 8 | 51 ± 9 | <0.0001 |
Gender (% male) | 75.5 | 42.3 | <0.0001 |
BMI (kg/m2) | 28.2 [26.0–31.0] | 27.8 [25.4–30.9] | <0.0001 |
Waist circumference | 98 ± 11 | 94 ± 11 | 0.022 |
Triglycerides (mg/dL) | 161 [120–221] | 145 [107–202] | 0.025 |
Glucose (mg/dL) | 94 [86–105] | 90 [84–97] | <0.0001 |
Alanine transaminase (IU/L) | 24 [18–32] | 24 [18–34] | 0.391 |
Aspartate transaminase (IU/L) | 25 [21–30] | 25 [20–30] | 0.596 |
Apolipoprotein AI (mg/dL) | 133 [114–156] | 134 [114–156] | 0.804 |
Alkaline phosphatase (IU/L) | 77 [64–92] | 81 [68–96] | 0.006 |
Serum calcium (mg/dL) | 9.7 ± 0.5 | 9.7 ± 0.6 | 0.907 |
Serum phosphorus (mg/dL) | 3.4 ± 0.5 | 3.5 ± 0.5 | 0.003 |
Cardiovascular risk factors | |||
Obesity (%) | 32.8 | 30.5 | 0.434 |
Smoking habits (%) | 21.5 | 22.9 | 0.613 |
Subcutaneous abdominal fat (%) | 58.6 | 48.7 | 0.001 |
Hypoalphalipoproteinemia (%) | 45.2 | 52.2 | 0.022 |
Non-HDL cholesterol > 160 mg/dL (%) | 42.5 | 27.6 | <0.0001 |
LDL-cholesterol ≥ 130 mg/dL (%) | 44.9 | 28.8 | <0.0001 |
SNPrsID | ID Assay | MAF | Analyzed Sequence |
---|---|---|---|
rs3102735 | C___1971046_10 | 16% | CTCTAGGGTTCGCTGTCTCCCCCAT[C/T]AATTCCTGGTCTAGAAGTTAGACT |
rs3134070 | C__27466052_20 | 33% | TCCGCCCCAGCCCTGAAAGCGTTAA[C/T]CCTGGAGCTTTCTGCACACCCCCCG |
rs3134069 | C__27464534_20 | 10% | TTCCTACGCGCTGAACTTCTGGAGT[A/C]GCCTCCTCGAGGTCTTTCCACTAGC |
rs2073618 | C___1971047_40 | 33% | GGTTTCCGGGGACCACAATGAACAA[C/G]TTGCTGTGCTGCGCGCTCGTGGTAA |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Cazarín-Santos, B.G.; Pérez-Hernández, N.; Posadas-Sánchez, R.; Vargas-Alarcón, G.; Pérez-Méndez, Ó.; Rodríguez-Silverio, J.; Roque-Ramírez, B.; Borgonio-Cuadra, V.M.; Rodríguez-Pérez, J.M. Osteoprotegerin Gene Polymorphisms Are Associated with Subclinical Atherosclerosis in the Mexican Mestizo Population. Diagnostics 2022, 12, 1433. https://doi.org/10.3390/diagnostics12061433
Cazarín-Santos BG, Pérez-Hernández N, Posadas-Sánchez R, Vargas-Alarcón G, Pérez-Méndez Ó, Rodríguez-Silverio J, Roque-Ramírez B, Borgonio-Cuadra VM, Rodríguez-Pérez JM. Osteoprotegerin Gene Polymorphisms Are Associated with Subclinical Atherosclerosis in the Mexican Mestizo Population. Diagnostics. 2022; 12(6):1433. https://doi.org/10.3390/diagnostics12061433
Chicago/Turabian StyleCazarín-Santos, Benny Giovanni, Nonanzit Pérez-Hernández, Rosalinda Posadas-Sánchez, Gilberto Vargas-Alarcón, Óscar Pérez-Méndez, Juan Rodríguez-Silverio, Bladimir Roque-Ramírez, Verónica Marusa Borgonio-Cuadra, and José Manuel Rodríguez-Pérez. 2022. "Osteoprotegerin Gene Polymorphisms Are Associated with Subclinical Atherosclerosis in the Mexican Mestizo Population" Diagnostics 12, no. 6: 1433. https://doi.org/10.3390/diagnostics12061433
APA StyleCazarín-Santos, B. G., Pérez-Hernández, N., Posadas-Sánchez, R., Vargas-Alarcón, G., Pérez-Méndez, Ó., Rodríguez-Silverio, J., Roque-Ramírez, B., Borgonio-Cuadra, V. M., & Rodríguez-Pérez, J. M. (2022). Osteoprotegerin Gene Polymorphisms Are Associated with Subclinical Atherosclerosis in the Mexican Mestizo Population. Diagnostics, 12(6), 1433. https://doi.org/10.3390/diagnostics12061433