Effects of Temperature on the Timeliness of eDNA/eRNA: A Case Study of Fenneropenaeus chinensis
Abstract
:1. Introduction
2. Materials and Methods
2.1. Experimental Setup
2.2. Sample Collection and Processing
2.3. eDNA and eRNA Extraction and cDNA Synthesis
2.4. Quantitative Polymerase Chain Reaction
2.5. Statistical Analyses
3. Results
3.1. eDNA/RNA Target Gene Detection
3.2. eDNA/eRNA Release and the Initial Concentration
3.3. eDNA/eRNA Degradation Rates
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Kelly, R.P.; Port, J.A.; Yamahara, K.M.; Martone, R.G.; Lowell, N.; Thomsen, P.F.; Mach, M.E.; Bennett, M.; Prahler, E.; Caldwell, M.R.; et al. Harnessing DNA to improve environmental management. Science 2014, 344, 1455–1456. [Google Scholar] [CrossRef] [PubMed]
- Ficetola, G.F.; Miaud, C.; Pompanon, F.; Taberlet, P. Species detection using environmental DNA from water samples. Biol. Lett. 2008, 4, 423–425. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Thomsen, P.F.; Kielgast, J.; Iversen, L.L.; Wiuf, C.; Rasmussen, M.; Gilbert, M.T.P.; Orlando, L.; Willerslev, E. Monitoring endangered freshwater biodiversity using environmental DNA. Mol. Ecol. 2012, 21, 2565–2573. [Google Scholar] [CrossRef] [PubMed]
- Piaggio, A.J.; Engeman, R.M.; Hopken, M.W.; Humphrey, J.S.; Keacher, K.L.; Bruce, W.E.; Avery, M.L. Detecting an elusive invasive species: A diagnostic PCR to detect Burmese python in Florida waters and an assessment of persistence of environmental DNA. Mol. Ecol. Resour. 2014, 14, 374–380. [Google Scholar] [CrossRef] [Green Version]
- Rees, H.C.; Maddison, B.C.; Middleditch, D.J.; Patmore, J.R.M.; Gough, K.C. REVIEW: The detection of aquatic animal species using environmental DNA—A review of eDNA as a survey tool in ecology. J. Appl. Ecol. 2014, 51, 1450–1459. [Google Scholar] [CrossRef]
- Thomsen, P.F.; Kielgast, J.; Iversen, L.L.; Møller, P.R.; Rasmussen, M.; Willerslev, E. Detection of a Diverse Marine Fish Fauna Using Environmental DNA from Seawater Samples. PLoS ONE 2012, 7, e41732. [Google Scholar] [CrossRef]
- Barnes, M.A.; Turner, C.R. The ecology of environmental DNA and implications for conservation genetics. Conserv. Genet. 2016, 17, 1–17. [Google Scholar] [CrossRef] [Green Version]
- Goldberg, C.S.; Turner, C.R.; Deiner, K.; Klymus, K.E.; Thomsen, P.F.; Murphy, M.A.; Spear, S.F.; McKee, A.; Oyler-McCance, S.J.; Cornman, R.S.; et al. Critical considerations for the application of environmental DNA methods to detect aquatic species. Methods Ecol. Evol. 2016, 7, 1299–1307. [Google Scholar] [CrossRef]
- Tsuji, S.; Takahara, T.; Doi, H.; Shibata, N.; Yamanaka, H. The detection of aquatic macroorganisms using environmental DNA analysis—A review of methods for collection, extraction, and detection. Environ. DNA 2019, 1, 99–108. [Google Scholar] [CrossRef] [Green Version]
- Seymour, M. Rapid progression and future of environmental DNA research. Commun. Biol. 2019, 2, 80. [Google Scholar] [CrossRef] [Green Version]
- Evans, N.T.; Shirey, P.D.; Wieringa, J.G.; Mahon, A.R.; Lamberti, G.A. Comparative Cost and Effort of Fish Distribution Detection via Environmental DNA Analysis and Electrofishing. Fisheries 2017, 42, 90–99. [Google Scholar] [CrossRef]
- Sigsgaard, E.E.; Carl, H.; Møller, P.R.; Thomsen, P.F. Monitoring the near-extinct European weather loach in Denmark based on environmental DNA from water samples. Biol. Conserv. 2015, 183, 46–52. [Google Scholar] [CrossRef] [Green Version]
- Yamamoto, S.; Minami, K.; Fukaya, K.; Takahashi, K.; Sawada, H.; Murakami, H.; Tsuji, S.; Hashizume, H.; Kubonaga, S.; Horiuchi, T.; et al. Environmental DNA as a ‘Snapshot’ of Fish Distribution: A Case Study of Japanese Jack Mackerel in Maizuru Bay, Sea of Japan. PLoS ONE 2016, 11, e0149786. [Google Scholar] [CrossRef] [Green Version]
- Dejean, T.; Valentini, A.; Duparc, A.; Pellier-Cuit, S.; Pompanon, F.; Taberlet, P.; Miaud, C. Persistence of Environmental DNA in Freshwater Ecosystems. PLoS ONE 2011, 6, e23398. [Google Scholar] [CrossRef] [Green Version]
- Jane, S.F.; Wilcox, T.M.; McKelvey, K.S.; Young, M.K.; Schwartz, M.K.; Lowe, W.H.; Letcher, B.H.; Whiteley, A.R. Distance, flow and PCR inhibition: eDNA dynamics in two headwater streams. Mol. Ecol. Resour. 2015, 15, 216–227. [Google Scholar] [CrossRef]
- Barnes, M.A.; Turner, C.R.; Jerde, C.L.; Renshaw, M.A.; Chadderton, W.L.; Lodge, D.M. Environmental Conditions Influence eDNA Persistence in Aquatic Systems. Environ. Sci. Technol. 2014, 48, 1819–1827. [Google Scholar] [CrossRef]
- Deiner, K.; Altermatt, F. Transport Distance of Invertebrate Environmental DNA in a Natural River. PLoS ONE 2014, 9, e88786. [Google Scholar] [CrossRef] [Green Version]
- Darling, J.A.; Mahon, A.R. From molecules to management: Adopting DNA-based methods for monitoring biological invasions in aquatic environments. Environ. Res. 2011, 111, 978–988. [Google Scholar] [CrossRef]
- Merkes, C.M.; McCalla, S.G.; Jensen, N.R.; Gaikowski, M.P.; Amberg, J.J. Persistence of DNA in Carcasses, Slime and Avian Feces May Affect Interpretation of Environmental DNA Data. PLoS ONE 2014, 9, e113346. [Google Scholar] [CrossRef]
- Cristescu, M.E. Can Environmental RNA Revolutionize Biodiversity Science? Trends Ecol. Evol. 2019, 34, 694–697. [Google Scholar] [CrossRef]
- Pochon, X.; Zaiko, A.; Fletcher, L.M.; Laroche, O.; Wood, S.A. Wanted dead or alive? Using metabarcoding of environmental DNA and RNA to distinguish living assemblages for biosecurity applications. PLoS ONE 2017, 12, e0187636. [Google Scholar] [CrossRef] [PubMed]
- Wood, S.A.; Biessy, L.; Latchford, J.L.; Zaiko, A.; von Ammon, U.; Audrezet, F.; Cristescu, M.E.; Pochon, X. Release and degradation of environmental DNA and RNA in a marine system. Sci. Total Environ. 2020, 704, 135314. [Google Scholar] [CrossRef] [PubMed]
- Marshall, N.T.; Vanderploeg, H.A.; Chaganti, S.R. Environmental (e)RNA advances the reliability of eDNA by predicting its age. Sci. Rep. 2021, 11, 2769. [Google Scholar] [CrossRef] [PubMed]
- Lindahl, T. Instability and decay of the primary structure of DNA. Nature 1993, 362, 709–715. [Google Scholar] [CrossRef] [PubMed]
- Strickler, K.M.; Fremier, A.K.; Goldberg, C.S. Quantifying effects of UV-B, temperature, and pH on eDNA degradation in aquatic microcosms. Biol. Conserv. 2015, 183, 85–92. [Google Scholar] [CrossRef]
- Lopez-Garcia, P.; Philippe, H.; Gail, F.; Moreira, D. Autochthonous eukaryotic diversity in hydrothermal sediment and experimental microcolonizers at the Mid-Atlantic Ridge. Proc. Natl. Acad. Sci. USA 2003, 100, 697–702. [Google Scholar] [CrossRef] [Green Version]
- Hofreiter, M.; Serre, D.; Poinar, H.; Kuch, M.; Pääbo, S. Ancient DNA. Nat. Rev. Genet. 2001, 2, 353–359. [Google Scholar] [CrossRef]
- Zhu, B. Degradation of plasmid and plant DNA in water microcosms monitored by natural transformation and real-time polymerase chain reaction (PCR). Water Res. 2006, 40, 3231–3238. [Google Scholar] [CrossRef]
- Corinaldesi, C.; Beolchini, F.; Dell’Anno, A. Damage and degradation rates of extracellular DNA in marine sediments: Implications for the preservation of gene sequences. Mol. Ecol. 2008, 17, 3939–3951. [Google Scholar] [CrossRef]
- Poté, J.; Ackermann, R.; Wildi, W. Plant leaf mass loss and DNA release in freshwater sediments. Ecotoxicol. Environ. Saf. 2009, 72, 1378–1383. [Google Scholar] [CrossRef]
- Fu, X.H.; Wang, L.; Le, Y.Q.; Hu, J.J. Persistence and renaturation efficiency of thermally treated waste recombinant DNA in defined aquatic microcosms. J. Environ. Sci. Health Part A 2012, 47, 1975–1983. [Google Scholar] [CrossRef] [PubMed]
- Li, M.; Shan, X.; Wang, W.; Ding, X.; Dai, F.; Lv, D.; Wu, H. Qualitative and quantitative detection using eDNA technology: A case study of Fenneropenaeus chinensis in the Bohai Sea. Aquac. Fish. 2020, 5, 148–155. [Google Scholar] [CrossRef]
- Liu, P.; Li, J.; He, Y.; Kong, J.; Wang, Q. Present situation and protective measures of genetic resources in Fenneropenaeus chinensis. Mar. Fish. Res. 2004, 25, 80–85. [Google Scholar] [CrossRef]
- Wang, M.; Wang, W.; Xiao, G.; Liu, K.; Hu, Y.; Tian, T.; Kong, J.; Jin, X. Genetic diversity analysis of spawner and recaptured populations of Chinese shrimp (Fenneropenaeus chinensis) during stock enhancement in the Bohai Bay based on an SSR marker. Acta Oceanol. Sin. 2016, 35, 51–56. [Google Scholar] [CrossRef]
- Tian, X.; Dong, S.; Wang, F. Effects of different temperatures on the growth and energy budget of Chinese shrimp, Fenneropenaeus chinensis. J. Appl. Ecol. 2004, 15, 678–682. [Google Scholar] [CrossRef]
- Kaps, M.; Lamberson, W.R.; Ebrary, I. Biostatistics for animal science. J. Anim. Breed. Genet. 2005, 122, 215. [Google Scholar]
- Pilliod, D.S.; Goldberg, C.S.; Arkle, R.S.; Waits, L.P. Factors influencing detection of eDNA from a stream-dwelling amphibian. Mol. Ecol. Resour. 2014, 14, 109–116. [Google Scholar] [CrossRef] [PubMed]
- Lance, R.; Klymus, K.; Richter, C.; Guan, X.; Farrington, H.; Carr, M.; Thompson, N.; Chapman, D.; Baerwaldt, K. Experimental observations on the decay of environmental DNA from bighead and silver carps. Manag. Biol. Invasions 2017, 8, 343–359. [Google Scholar] [CrossRef] [Green Version]
- Veilleux, H.D.; Misutka, M.D.; Glover, C.N. Environmental DNA and environmental RNA: Current and prospective applications for biological monitoring. Sci. Total Environ. 2021, 782, 146891. [Google Scholar] [CrossRef]
- Miyata, K.; Inoue, Y.; Amano, Y.; Nishioka, T.; Yamane, M.; Kawaguchi, T.; Morita, O.; Honda, H. Fish environmental RNA enables precise ecological surveys with high positive predictivity. Ecol. Indic. 2021, 128, 107796. [Google Scholar] [CrossRef]
Gene | Primer | Primer Sequence (5′–3′) | Tm (°C) | Length (bp) |
---|---|---|---|---|
COI | DF | AGGGGTAGGAACAGGATGAAC | 57.7 | 106 |
COI | DR | GACACCAGCTAGATGCAGCG | 59.1 | 106 |
Probe | 5′6-FAM-TCAGCTAGAATTGCTCATGCCGGAGCTTCAGT-3′ BHQ1 | 66.2 | 106 |
Time (h) | 10 °C (copies/mL) | 15 °C (copies/mL) | 20 °C (copies/mL) | 25 °C (copies/mL) | |
---|---|---|---|---|---|
eDNA | 0 | 682.56 ± 43.15 | 625.15 ± 17.06 | 603.95 ± 117.17 | 614.87 ± 78.88 |
4 | 696.78 ± 54.77 | 523.17 ± 40.53 | 157.05 ± 25.23 | 80.51 ± 11.55 | |
8 | 627.12 ± 34.96 | 504.80 ± 75.79 | 105.58 ± 20.27 | 33.33 ± 31.34 | |
12 | 613.97 ± 71.83 | 478.02 ± 21.10 | 63.93 ± 12.48 | 24.99 ± 1.71 | |
24 | 379.07 ± 12.26 | 146.74 ± 6.44 | 33.03 ± 3.03 | 20.71 ± 3.46 | |
72 | 354.70 ± 23.17 | 47.71 ± 7.69 | 5.52 ± 0.62 | 5.28 ± 1.07 | |
120 | 230.43 ± 40.11 | 29.19 ± 3.37 | 3.65 ± 0.42 | 5.39 ± 1.14 | |
168 | 27.13 ± 7.73 | 21.43 ± 10.42 | 5.96 ± 1.75 | 7.39 ± 2.18 | |
336 | 12.17 ± 3.58 | 11.49 ± 2.36 | 8.44 ± 1.44 | 7.84 ± 2.72 | |
504 | 11.22 ± 4.04 | 10.02 ± 0.90 | 7.20 ± 0.45 | 6.44 ± 0.76 | |
eRNA | 0 | 688.2 ± 27.18 | 698.07 ± 74.92 | 720.26 ± 13.13 | 603.66 ± 72.64 |
4 | 386.8 ± 23.28 | 361.19 ± 12.70 | 223.71 ± 86.35 | 135.50 ± 11.92 | |
8 | 107.87 ± 72.90 | 130.36 ± 5.56 | 56.14 ± 3.86 | 22.52 ± 4.67 | |
12 | 46.16 ± 2.84 | 40.96 ± 23.46 | 14.52 ± 2.21 | 7.95 ± 1.71 | |
24 | 19.66 ± 3.00 | 35.29 ± 12.06 | 20.81 ± 2.01 | 8.46 ± 4.96 | |
72 | 23.74 ± 2.37 | 32.66 ± 4.36 | 6.86 ± 2.28 | 8.27 ± 2.18 | |
120 | 21.28 ± 4.77 | 18.27 ± 3.13 | 5.14 ± 1.83 | 8.93 ± 1.35 | |
168 | 3.42 ± 1.01 | 4.82 ± 0.51 | 3.40 ± 0.24 | 3.44 ± 0.34 | |
336 | 3.77 ± 1.49 | 3.33 ± 1.24 | 3.05 ± 0.48 | 3.65 ± 0.27 | |
504 | 4.11 ± 0.85 | 3.68 ± 2.65 | 1.61 ± 0.42 | 3.21 ± 0.10 |
Treatment (°C) | N0 (COI Copies per mL) | Average Model-Derived Degradation Rate Constant (λ) | Predicted Time Until eDNA/eRNA Degrades below Detectable Limits | |
---|---|---|---|---|
eDNA | 10 | 682.56 ± 43.15 | 0.011 | 383 |
15 | 625.15 ± 17.06 | 0.041 | 101 | |
20 | 603.95 ± 117.17 | 0.275 | 15 | |
25 | 614.87 ± 78.88 | 0.486 | 8 | |
eRNA | 10 | 688.20 ± 27.18 | 0.190 | 22 |
15 | 698.07 ± 74.92 | 0.192 | 22 | |
20 | 720.26 ± 13.13 | 0.300 | 14 | |
25 | 603.66 ± 72.64 | 0.379 | 11 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Qian, T.; Shan, X.; Wang, W.; Jin, X. Effects of Temperature on the Timeliness of eDNA/eRNA: A Case Study of Fenneropenaeus chinensis. Water 2022, 14, 1155. https://doi.org/10.3390/w14071155
Qian T, Shan X, Wang W, Jin X. Effects of Temperature on the Timeliness of eDNA/eRNA: A Case Study of Fenneropenaeus chinensis. Water. 2022; 14(7):1155. https://doi.org/10.3390/w14071155
Chicago/Turabian StyleQian, Tangyi, Xiujuan Shan, Weiji Wang, and Xianshi Jin. 2022. "Effects of Temperature on the Timeliness of eDNA/eRNA: A Case Study of Fenneropenaeus chinensis" Water 14, no. 7: 1155. https://doi.org/10.3390/w14071155
APA StyleQian, T., Shan, X., Wang, W., & Jin, X. (2022). Effects of Temperature on the Timeliness of eDNA/eRNA: A Case Study of Fenneropenaeus chinensis. Water, 14(7), 1155. https://doi.org/10.3390/w14071155