Chromosome 4 Duplication Associated with Strabismus Leads to Gene Expression Changes in iPSC-Derived Cortical Neurons
Abstract
1. Introduction
2. Materials and Methods
2.1. Introducing the 23 kb Chromosome 4 Duplication into iPSCs
- 5′oligo_S_t, 5′AGGAAGGAGATGCTGTCTCTCTTCACTGTTCCTGCAATGCAGAACCAAACGTTCCGGCTTGAACAAAGGCATTGACCATAAGTTACTGGCTTGAGTATT;
- Junction oligo, 5′-GGTTCCAGGACCCCCTGAAGATACCAAAATCCTGCTCGGTTCTCTGGTATGTTCCGGCTTTGAACAAAGGCATTGACCATAAGTTACTGGCTTGAGTATT
- 3′ oligo_S_t, 5′-AAAGTATACAGGAGAAAGTGCATGGGTTATATGCAAATACTATGCCATTTATACCAGAGAACCGAGCAGGATTTTGGTATCTTCAGGGGGTCCTGGAACC.
2.2. CRISPR Duplication Genotyping
2.3. Whole Genome Sequencing
2.4. Cortical Neuron Generation and Characterization
2.5. RNA Extraction and Library Preparation
2.6. RNA-Seq Data Analysis and Identification of Differentially Expressed Genes (DEGs)
2.7. RT-qPCR
2.8. Protein-Protein Interaction Network Analysis
2.9. Immunocytochemical Staining
3. Results
3.1. Model of Study
3.2. Inserting the Duplication in iPSCs
3.3. Differentiation into Cortical Neurons and RNA Library QC Measurements
3.4. Identification of Differentially Expressed Genes (DEGs) Between Control and Cells with the Duplication
3.5. DEGs in Mature Cortical Neurons
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Uretmen, O.; Egrilmez, S.; Kose, S.; Pamukçu, K.; Akkin, C.; Palamar, M. Negative social bias against children with strabismus. Acta Ophthalmol. Scand. 2003, 81, 138–142. [Google Scholar] [CrossRef] [PubMed]
- Davidson, S.; Quinn, G.E. The impact of pediatric vision disorders in adulthood. Pediatrics 2011, 127, 334–339. [Google Scholar] [CrossRef] [PubMed]
- Wen, G.; McKean-Cowdin, R.; Varma, R.; Tarczy-Hornoch, K.; Cotter, S.A.; Borchert, M.; Azen, S. General health-related quality of life in preschool children with strabismus or amblyopia. Ophthalmology 2011, 118, 574–580. [Google Scholar] [CrossRef]
- Hatt, S.R.; Leske, D.A.; Castañeda, Y.S.; Wernimont, S.M.; Liebermann, L.; Cheng-Patel, C.S.; Birch, E.E.; Holmes, J.M. Association of Strabismus With Functional Vision and Eye-Related Quality of Life in Children. JAMA Ophthalmol. 2020, 138, 528–535. [Google Scholar] [CrossRef]
- Whitman, M.C. Axonal Growth Abnormalities Underlying Ocular Cranial Nerve Disorders. Annu. Rev. Vis. Sci. 2021, 7, 827–850. [Google Scholar] [CrossRef]
- Stidwill, D. Epidemiology of strabismus. Ophthalmic. Physiol. Opt. 1997, 17, 536–539. [Google Scholar] [CrossRef] [PubMed]
- Greenberg, A.E.; Mohney, B.G.; Diehl, N.N.; Burke, J.P. Incidence and types of childhood esotropia: A population-based study. Ophthalmology 2007, 114, 170–174. [Google Scholar] [CrossRef] [PubMed]
- Bui Quoc, E.; Milleret, C. Origins of strabismus and loss of binocular vision. Front. Integr. Neurosci. 2014, 8, 71. [Google Scholar] [CrossRef]
- Sunyer-Grau, B.; Quevedo, L.; Rodríguez-Vallejo, M.; Argilés, M. Comitant strabismus etiology: Extraocular muscle integrity and central nervous system involvement-a narrative review. Graefes Arch. Clin. Exp. Ophthalmol. 2023, 261, 1781–1792. [Google Scholar] [CrossRef] [PubMed]
- Sanchez, M.M.; Whitman, M.C. Genetics of strabismus. Front. Ophthalmol. 2023, 3, 1233866. [Google Scholar]
- Shaaban, S.; MacKinnon, S.; Andrews, C.; Staffieri, S.E.; Maconachie, G.D.E.; Chan, W.M.; Whitman, M.C.; Morton, S.U.; Yazar, S.; MacGregor, S.; et al. Genome-Wide Association Study Identifies a Susceptibility Locus for Comitant Esotropia and Suggests a Parent-of-Origin Effect. Investig. Ophthalmol. Vis. Sci. 2018, 59, 4054–4064. [Google Scholar] [CrossRef]
- Plotnikov, D.; Shah, R.L.; Rodrigues, J.N.; Cumberland, P.M.; Rahi, J.S.; Hysi, P.G.; Atan, D.; Williams, C.; Guggenheim, J.A.; UK Biobank Eye and Vision Consortium. A commonly occurring genetic variant within the NPLOC4-TSPAN10-PDE6G gene cluster is associated with the risk of strabismus. Hum. Genet. 2019, 138, 723–737. [Google Scholar] [CrossRef]
- Whitman, M.C.; Di Gioia, S.A.; Chan, W.-M.; Gelber, A.; Pratt, B.M.; Bell, J.L.; Collins, T.E.; Knowles, J.A.; Armoskus, C.; Pato, M.; et al. Recurrent Rare Copy Number Variants Increase Risk for Esotropia. Investig. Ophthalmol. Vis. Sci. 2020, 61, 22. [Google Scholar] [CrossRef] [PubMed]
- Sanchez, M.M.; Chan, W.-M.; MacKinnon, S.E.; Barry, B.; Hunter, D.G.; Engle, E.C.; Whitman, M.C. Presence of Copy Number Variants Associated with Esotropia in Patients with Exotropia. JAMA Ophthalmol. 2024, 142, 243–247. [Google Scholar] [CrossRef]
- Salpietro, V.; Manole, A.; Efthymiou, S.; Houlden, H. A Review of Copy Number Variants in Inherited Neuropathies. Curr. Genom. 2018, 19, 412–419. [Google Scholar] [CrossRef]
- Forrest, M.P.; Penzes, P. Mechanisms of copy number variants in neuropsychiatric disorders: From genes to therapeutics. Curr. Opin. Neurobiol. 2023, 82, 102750. [Google Scholar] [CrossRef]
- Pantazis, C.B.; Yang, A.; Lara, E.; McDonough, J.A.; Blauwendraat, C.; Peng, L.; Oguro, H.; Kanaujiya, J.; Zou, J.; Sebesta, D.; et al. A reference human induced pluripotent stem cell line for large-scale collaborative studies. Cell Stem Cell 2022, 29, 1685–1702.e22. [Google Scholar] [CrossRef] [PubMed]
- Skarnes, W.C.; Pellegrino, E.; McDonough, J.A. Improving homology-directed repair efficiency in human stem cells. Methods 2019, 164–165, 18–28. [Google Scholar] [CrossRef] [PubMed]
- Whye, D.; Wood, D.; Saber, W.A.; Norabuena, E.M.; Makhortova, N.R.; Sahin, M.; Buttermore, E.D. A Robust Pipeline for the Multi-Stage Accelerated Differentiation of Functional 3D Cortical Organoids from Human Pluripotent Stem Cells. Curr. Protoc. 2023, 3, e641. [Google Scholar] [CrossRef] [PubMed]
- Bolger, A.M.; Lohse, M.; Usadel, B. Trimmomatic: A flexible trimmer for Illumina sequence data. Bioinformatics 2014, 30, 2114–2120. [Google Scholar] [CrossRef]
- Dobin, A.; Davis, C.A.; Schlesinger, F.; Drenkow, J.; Zaleski, C.; Jha, S.; Batut, P.; Chaisson, M.; Gingeras, T.R. STAR: Ultrafast universal RNA-seq aligner. Bioinformatics 2013, 29, 15–21. [Google Scholar] [CrossRef] [PubMed]
- Liao, Y.; Smyth, G.K.; Shi, W. featureCounts: An efficient general purpose program for assigning sequence reads to genomic features. Bioinformatics 2014, 30, 923–930. [Google Scholar] [CrossRef] [PubMed]
- Kolde, R. pheatmap: Pretty Heatmaps. R.p.v. 1.0.12, Editor. 2019. Available online: https://CRAN.R-project.org/package=pheatmap (accessed on 5 December 2023).
- Love, M.I.; Huber, W.; Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014, 15, 550. [Google Scholar] [CrossRef] [PubMed]
- Sun, L.; Dong, S.; Ge, Y.; Fonseca, J.P.; Robinson, Z.T.; Mysore, K.S.; Mehta, P. DiVenn: An Interactive and Integrated Web-Based Visualization Tool for Comparing Gene Lists. Front. Genet. 2019, 10, 421. [Google Scholar] [CrossRef] [PubMed]
- Werren, E.A.; Peirent, E.R.; Jantti, H.; Guxholli, A.; Srivastava, K.R.; Orenstein, N.; Narayanan, V.; Wiszniewski, W.; Dawidziuk, M.; Gawlinski, P.; et al. Biallelic variants in CSMD1 are implicated in a neurodevelopmental disorder with intellectual disability and variable cortical malformations. Cell Death Dis. 2024, 15, 379. [Google Scholar] [CrossRef] [PubMed]
- Mihoub, O.; Ben Chaaben, A.; Boukouaci, W.; Lajnef, M.; Ayari, F.; El Kefi, H.; Ben Ammar, H.; Abazza, H.; El Hechmi, Z.; Guemira, F.; et al. CSMD1 rs10503253 increases schizophrenia risk in a Tunisian population-group. Encephale 2024, 50, 380–385. [Google Scholar] [CrossRef]
- Brea-Fernández, A.J.; Álvarez-Barona, M.; Amigo, J.; Tubío-Fungueiriño, M.; Caamaño, P.; Fernández-Prieto, M.; Barros, F.; De Rubeis, S.; Buxbaum, J.; Carracedo, Á. Trio-based exome sequencing reveals a high rate of the de novo variants in intellectual disability. Eur. J. Hum. Genet. 2022, 30, 938–945. [Google Scholar] [CrossRef]
- Barel, O.; Shalev, S.A.; Ofir, R.; Cohen, A.; Zlotogora, J.; Shorer, Z.; Mazor, G.; Finer, G.; Khateeb, S.; Zilberberg, N.; et al. Maternally inherited Birk Barel mental retardation dysmorphism syndrome caused by a mutation in the genomically imprinted potassium channel KCNK9. Am. J. Hum. Genet. 2008, 83, 193–199. [Google Scholar] [CrossRef]
- Wu, D.; Zhao, B.; Cao, X.; Wan, J. Long non-coding RNA LINK-A promotes glioma cell growth and invasion via lactate dehydrogenase A. Oncol. Rep. 2017, 38, 1525–1532. [Google Scholar] [CrossRef]
- Kolarova, J.; Tangen, I.; Bens, S.; Gillessen-Kaesbach, G.; Gutwein, J.; Kautza, M.; Rydzanicz, M.; Stephani, U.; Siebert, R.; Ammerpohl, O.; et al. Array-based DNA methylation analysis in individuals with developmental delay/intellectual disability and normal molecular karyotype. Eur. J. Med. Genet. 2015, 58, 419–425. [Google Scholar] [CrossRef]
- Teroganova, N.; Girshkin, L.; Suter, C.M.; Green, M.J. DNA methylation in peripheral tissue of schizophrenia and bipolar disorder: A systematic review. BMC Genet. 2016, 17, 27. [Google Scholar] [CrossRef] [PubMed]
- Afsar, T.; Fu, H.; Khan, H.; Ali, Z.; Zehri, Z.; Zaman, G.; Abbas, S.; Mahmood, A.; Alam, Q.; Hu, J.; et al. Loss-of-function variant in the LRR domain of SLITRK2 implicated in a neurodevelopmental disorder. Front. Genet. 2023, 14, 1308116. [Google Scholar] [CrossRef] [PubMed]
- El Chehadeh, S.; Han, K.A.; Kim, D.; Jang, G.; Bakhtiari, S.; Lim, D.; Kim, H.Y.; Kim, J.; Kim, H.; Wynn, J.; et al. SLITRK2 variants associated with neurodevelopmental disorders impair excitatory synaptic function and cognition in mice. Nat. Commun. 2022, 13, 4112. [Google Scholar] [CrossRef]
- Fazeli, Z.; Ghaderian, S.M.H.; Najmabadi, H.; Omrani, M.D. Understanding the Molecular Basis of Fragile X Syndrome Using Differentiated Mesenchymal Stem Cells. Iran. J. Child Neurol. 2022, 16, 85–95. [Google Scholar] [PubMed]
- Smith, E.N.; Bloss, C.S.; Badner, J.A.; Barrett, T.; Belmonte, P.L.; Berrettini, W.; Byerley, W.; Coryell, W.; Craig, D.; Edenberg, H.J.; et al. Genome-wide association study of bipolar disorder in European American and African American individuals. Mol. Psychiatry 2009, 14, 755–763. [Google Scholar] [CrossRef] [PubMed]
- Cocco, C.; Corda, G.; Lisci, C.; Noli, B.; Carta, M.; Brancia, C.; Manca, E.; Masala, C.; Marrosu, F.; Solla, P.; et al. VGF peptides as novel biomarkers in Parkinson’s disease. Cell Tissue Res. 2020, 379, 93–107. [Google Scholar] [CrossRef] [PubMed]
- Karayel, O.; Winter, S.V.; Padmanabhan, S.; Kuras, Y.I.; Vu, D.T.; Tuncali, I.; Merchant, K.; Wills, A.-M.; Scherzer, C.R.; Mann, M. Proteome profiling of cerebrospinal fluid reveals biomarker candidates for Parkinson’s disease. Cell Rep. Med. 2022, 3, 100661. [Google Scholar] [CrossRef] [PubMed]
- Quinn, J.P.; Kandigian, S.E.; Trombetta, B.A.; Arnold, S.A.; Carlyle, B.C. VGF as a biomarker and therapeutic target in neurodegenerative and psychiatric diseases. Brain Commun. 2021, 3, fcab261. [Google Scholar] [CrossRef]
- Han, K.A.; Kim, J.; Kim, H.; Kim, D.; Lim, D.; Ko, J.; Um, J.W. Slitrk2 controls excitatory synapse development via PDZ-mediated protein interactions. Sci. Rep. 2019, 9, 17094. [Google Scholar] [CrossRef] [PubMed]
- Becerra, S.P.; Sagasti, A.; Spinella, P.; Notario, V. Pigment epithelium-derived factor behaves like a noninhibitory serpin. Neurotrophic activity does not require the serpin reactive loop. J. Biol. Chem. 1995, 270, 25992–25999. [Google Scholar] [CrossRef]
- Chan, S.O.; Chiu, F.C. Cloning and developmental expression of human 66 kd neurofilament protein. Brain Res. Mol. Brain Res. 1995, 29, 177–184. [Google Scholar] [CrossRef]
- Hirabayashi, T.; Yagi, T. Protocadherins in neurological diseases. Adv. Neurobiol. 2014, 8, 293–314. [Google Scholar] [PubMed]
- Flaherty, E.; Maniatis, T. The role of clustered protocadherins in neurodevelopment and neuropsychiatric diseases. Curr. Opin. Genet. Dev. 2020, 65, 144–150. [Google Scholar] [CrossRef] [PubMed]
- Chen, W.V.; Nwakeze, C.L.; Denny, C.A.; O’keeffe, S.; Rieger, M.A.; Mountoufaris, G.; Kirner, A.; Dougherty, J.D.; Hen, R.; Wu, Q.; et al. Pcdhαc2 is required for axonal tiling and assembly of serotonergic circuitries in mice. Science 2017, 356, 406–411. [Google Scholar] [CrossRef] [PubMed]
- Yim, Y.S.; Kwon, Y.; Nam, J.; Yoon, H.I.; Lee, K.; Kim, D.G.; Kim, E.; Kim, C.H.; Ko, J. Slitrks control excitatory and inhibitory synapse formation with LAR receptor protein tyrosine phosphatases. Proc. Natl. Acad. Sci. USA 2013, 110, 4057–4062. [Google Scholar] [CrossRef]
- Lee, Y.H.; Repka, M.X.; Borlik, M.F.; Velez, F.G.; Perez, C.; Yu, F.; Coleman, A.L.; Pineles, S.L. Association of Strabismus With Mood Disorders, Schizophrenia, and Anxiety Disorders Among Children. JAMA Ophthalmol. 2022, 140, 373–381. [Google Scholar] [CrossRef]
- Gutiérrez, C.; Santoni, J.L.M.; Merino, P.; de Liaño, P.G. Ophthalmologic Manifestations in Autism Spectrum Disorder. Turk. J. Ophthalmol. 2022, 52, 246–251. [Google Scholar] [CrossRef]
- Jin, K.; Aboobakar, I.F.; Whitman, M.C.; Oke, I. Mental Health Conditions Associated with Strabismus in a Diverse Cohort of US Adults. JAMA Ophthalmol. 2024, 142, 472–475. [Google Scholar] [CrossRef] [PubMed]
- Baum, M.L.; Wilton, D.K.; Fox, R.G.; Carey, A.; Hsu, Y.-H.H.; Hu, R.; Jäntti, H.J.; Fahey, J.B.; Muthukumar, A.K.; Salla, N.; et al. CSMD1 regulates brain complement activity and circuit development. Brain Behav. Immun. 2024, 119, 317–332. [Google Scholar] [CrossRef] [PubMed]
- The Schizophrenia Psychiatric Genome-Wide Association Study (GWAS) Consortium. Genome-wide association study identifies five new schizophrenia loci. Nat. Genet. 2011, 43, 969–976. [Google Scholar] [CrossRef]
- Trubetskoy, V.; Pardiñas, A.F.; Qi, T.; Panagiotaropoulou, G.; Awasthi, S.; Bigdeli, T.B.; Bryois, J.; Chen, C.-Y.; Dennison, C.A.; Hall, L.S.; et al. Mapping genomic loci implicates genes and synaptic biology in schizophrenia. Nature 2022, 604, 502–508. [Google Scholar] [CrossRef]
- Rebustini, I.T.; Crawford, S.E.; Becerra, S.P. PEDF Deletion Induces Senescence and Defects in Phagocytosis in the RPE. Int. J. Mol. Sci. 2022, 23, 7745. [Google Scholar] [CrossRef]
- Blazejewski, S.M.; Bennison, S.A.; Ha, N.T.; Liu, X.; Smith, T.H.; Dougherty, K.J.; Toyo-Oka, K. Rpsa Signaling Regulates Cortical Neuronal Morphogenesis via Its Ligand, PEDF, and Plasma Membrane Interaction Partner, Itga6. Cereb. Cortex 2022, 32, 770–795. [Google Scholar] [CrossRef] [PubMed]
- Tutukova, S.; Tarabykin, V.; Hernandez-Miranda, L.R. The Role of Neurod Genes in Brain Development, Function, and Disease. Front. Mol. Neurosci. 2021, 14, 662774. [Google Scholar] [CrossRef] [PubMed]
Gene | Description | Function | Diseases Associated |
---|---|---|---|
CSMD1 | CUB and Sushi multiple domains 1 | Component of membrane | Intellectual disability and schizophrenia [26,27] |
INA | Internexin neuronal intermediate filament protein α | Morphogenesis of neurons | |
KCNK9 | Potassium two pore domain channel subfamily K member 9 | Gene is imprinted in the brain | Birk–Barel Syndrome and Intellectual Disability [28,29] |
LINC01139 | Long intergenic non-protein coding RNA 1139 | Unknown | Glial tumor [30] |
LURAP1L-AS1 | LURAP1L antisense RNA 1 | Overlaps with TYRP1 gene associated with Albinism | |
NEUROD4 | Neuronal differentiation 4 | Mediates neuronal differentiation | |
PCDHA6 | Protocadherin α 6 | Cell–cell connections in the brain | |
PCDHB7 | Protocadherin β 7 | Cell–cell neural connections | |
PCDHGA8 | Protocadherin γ subfamily A, 8 | Cell–cell connections in the brain | |
PCDHGB4 | Protocadherin γ subfamily B, 4 | Cell–cell connections in the brain | |
PPIEL | Peptidylprolyl isomerase E like pseudogene | Unknown | May be associated with intellectual disability and bipolar disorder [31,32] |
SERPINF1 | Serpin family F member 1 | Neuronal differentiation in retinoblastoma cells | |
SLITRK2 | SLIT and NTRK like family member 2 | Synaptogenesis and excitatory synapse differentiation | Intellectual developmental disorder, X-Linked 111, Retinitis Pigmentosa 6 and bipolar disorder [33,34,35,36]. |
VGF | VGF nerve growth factor inducible | Neurogenesis and neuroplasticity | Parkinson’s disease, Alzheimer’s, Huntington’s, front-temporal lobar dementia, pain, schizophrenia and depression [37,38,39] |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Martinez-Sanchez, M.; Skarnes, W.; Jain, A.; Vemula, S.; Sun, L.; Rockowitz, S.; Whitman, M.C. Chromosome 4 Duplication Associated with Strabismus Leads to Gene Expression Changes in iPSC-Derived Cortical Neurons. Genes 2025, 16, 80. https://doi.org/10.3390/genes16010080
Martinez-Sanchez M, Skarnes W, Jain A, Vemula S, Sun L, Rockowitz S, Whitman MC. Chromosome 4 Duplication Associated with Strabismus Leads to Gene Expression Changes in iPSC-Derived Cortical Neurons. Genes. 2025; 16(1):80. https://doi.org/10.3390/genes16010080
Chicago/Turabian StyleMartinez-Sanchez, Mayra, William Skarnes, Ashish Jain, Sampath Vemula, Liang Sun, Shira Rockowitz, and Mary C. Whitman. 2025. "Chromosome 4 Duplication Associated with Strabismus Leads to Gene Expression Changes in iPSC-Derived Cortical Neurons" Genes 16, no. 1: 80. https://doi.org/10.3390/genes16010080
APA StyleMartinez-Sanchez, M., Skarnes, W., Jain, A., Vemula, S., Sun, L., Rockowitz, S., & Whitman, M. C. (2025). Chromosome 4 Duplication Associated with Strabismus Leads to Gene Expression Changes in iPSC-Derived Cortical Neurons. Genes, 16(1), 80. https://doi.org/10.3390/genes16010080