Genetic and Bioinformatic Strategies to Improve Diagnosis in Three Inherited Bleeding Disorders in Bogotá, Colombia
Abstract
1. Introduction
2. Materials and Methods
2.1. Study Sample
2.2. DNA Extraction
2.3. Genetic Analysis of F8, F9, and VWF Genes
2.4. Variation Effect Analysis on F8, F9, and VWF Proteins
2.5. High-Resolution Melting Analysis
2.6. High-Resolution Melting Data Analysis
2.6.1. Domain Identification
2.6.2. Domain Melting Region Identification and Analysis
2.6.3. Difference Plot
3. Results
3.1. Genetic Analysis of F8, F9, and VWF Genes
3.2. Development of an Open-Source Code in Python for HRM Data Analysis
3.3. High-Resolution Melting Technique Validation
4. Discussion
4.1. Genetic Analysis of F8 Gene
4.2. Genetic Analysis of F9 Gene
4.3. Genetic Analysis of VWF Gene
4.4. High-Resolution Melting Technique Validation
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Peyvandi, F.; Kaufman, R.J.; Seligsohn, U.; Salomon, O.; Bolton-Maggs, P.H.B.; Spreafico, M.; Menegatti, M.; Palla, R.; Siboni, S.; Mannucci, P.M. Rare bleeding disorders. Haemophilia 2006, 12, 137–142. [Google Scholar] [CrossRef]
 - Ling, G.; Luo, P.-L. Inherited bleeding disorders. Medicine 2021, 49, 225–228. [Google Scholar] [CrossRef]
 - Swystun, L.L.; James, P.D. Genetic diagnosis in hemophilia and von Willebrand disease. Blood Rev. 2017, 31, 47–56. [Google Scholar] [CrossRef] [PubMed]
 - Shinozawa, K.; Amano, K.; Hagiwara, T.; Bingo, M.; Chikasawa, Y.; Inaba, H.; Kinai, E.; Fukutake, K. Genetic analysis of carrier status in female members of Japanese hemophilia families. J. Thromb. Haemost. 2021, 19, 1493–1505. [Google Scholar] [CrossRef] [PubMed]
 - Kitchen, S.; Key, N.S.; Signer-Romero, K. Current laboratory practices in the diagnosis and management of haemophilia: A global assessment. Haemophilia 2015, 21, 550–557. [Google Scholar] [CrossRef] [PubMed]
 - Acuña, L.; Sánchez, P.; Piñeros, L.; Soler, L.A.; Alvis, L.F.; Martínez, A.; Niño, A. Situación de la Hemofilia en Colombia 2019; Fondo Colombiano de Enfermedades de Alto Costo: Bogotá, Colombia, 2019. [Google Scholar]
 - Stonebraker, J.S.; Bolton-Maggs, P.H.B.; Soucie, J.M.; Walker, I.; Brooker, M. A study of variations in the reported haemophilia B prevalence around the world. Haemophilia 2011, 18, e91–e94. [Google Scholar] [CrossRef] [PubMed]
 - Salviato, R.; Belvini, D.; Radossi, P.; Tagariello, G. High resolution melting for F9 gene mutation analysis in patients with haemophilia B. Blood Transfus. Trasfus. Sangue 2019, 17, 72. [Google Scholar] [CrossRef]
 - Kakela, J.K.; Friedman, K.D.; Haberichter, S.L.; Buchholz, N.P.; Christopherson, P.A.; Kroner, P.A.; Gill, J.C.; Montgomery, R.R.; Bellissimo, D.B. Genetic mutations in von Willebrand disease identified by DHPLC and DNA sequence analysis. Mol. Genet. Metab. 2006, 87, 262–271. [Google Scholar] [CrossRef]
 - Yunis, L.K.; Linares, A.; Cabrera, E.; Yunis, J.J. Systematic molecular analysis of hemophilia A patients from Colombia. Genet. Mol. Biol. 2018, 41, 750–757. [Google Scholar] [CrossRef]
 - Lin, S.-Y.; Su, Y.-N.; Hung, C.-C.; Tsay, W.; Chiou, S.-S.; Chang, C.-T.; Ho, H.-N.; Lee, C.-N. Mutation spectrum of 122 hemophilia A families from Taiwanese population by LD-PCR, DHPLC, multiplex PCR and evaluating the clinical application of HRM. BMC Med. Genet. 2008, 9, 53. [Google Scholar] [CrossRef]
 - Erali, M.; Wittwer, C.T. High resolution melting analysis for gene scanning. Methods 2010, 50, 250–261. [Google Scholar] [CrossRef]
 - Rouleau, E.; Lefol, C.; Bourdon, V.; Coulet, F.; Noguchi, T.; Soubrier, F.; Bieche, I.; Olschwang, S.; Sobol, H.; Lidereau, R. Quantitative PCR high-resolution melting (qPCR-HRM) curve analysis, a new approach to simultaneously screen point mutations and large rearrangements: Application toMLH1germline mutations in Lynch syndrome. Hum. Mutat. 2009, 30, 867–875. [Google Scholar] [CrossRef] [PubMed]
 - Ebili, H.O. Cancer mutation screening: Comparison of high-resolution melt analysis between two platforms. Ecancermedicalscience 2015, 9, 522. [Google Scholar] [CrossRef]
 - Ghanbari, B.A. PCR-HRM for Detecting JAK2V617F Gene Mutation: Is It a Sensitive Assay? BCCR 2020, 11, 222–229. [Google Scholar]
 - Diaz-Garcia, H.; Guzmán-Ortiz, A.; Angeles-Floriano, T.; Parra-Ortega, I.; López-Martínez, B.; Martínez-Saucedo, M.; Aquino-Jarquin, G.; Sánchez-Urbina, R.; Quezada, H.; Granados-Riveron, J. Genotyping of the Major SARS-CoV-2 Clade by Short-Amplicon High-Resolution Melting (SA-HRM) Analysis. Genes 2021, 12, 531. [Google Scholar] [CrossRef]
 - Butterfield, R.J.; Imburgia, C.; Mayne, K.; Newcomb, T.; Dunn, D.M.; Duval, B.; Feldkamp, M.L.; Johnson, N.E.; Weiss, R.B. High throughput screening for expanded CTG repeats in myotonic dystrophy type 1 using melt curve analysis. Mol. Genet. Genom. Med. 2021, 9, e1619. [Google Scholar] [CrossRef]
 - Sambrook, J.; Green, M.R. Molecular Cloning: A Laboratory Manual, 4th ed.; Cold Spring Harbor Laboratory Press: Long Island, NY, USA, 1989; Volume 33. [Google Scholar]
 - Polanía, D.C.; Narváez, D.M.; de Restrepo, H.G. Genética Molecular De La Hemofilia a En Una Familia Colombiana Con Diagnóstico De Enfermedad De Von WILLEBRAND Y DE HEMOFILIA A. Medicina 2014, 36, 298–319. Available online: http://revistamedicina.net/ojsanm/index.php/Medicina/article/view/107-2/361 (accessed on 21 June 2021).
 - Bagnall, R.D.; Waseem, N.; Green, P.M.; Giannelli, F. Recurrent inversion breaking intron 1 of the factor VIII gene is a frequent cause of severe hemophilia A. Blood 2002, 99, 168–174. [Google Scholar] [CrossRef] [PubMed]
 - de Jong, A.; Eikenboom, J. Von Willebrand disease mutation spectrum and associated mutation mechanisms. Thromb. Res. 2017, 159, 65–75. [Google Scholar] [CrossRef]
 - Ye, J.; Coulouris, G.; Zaretskaya, I.; Cutcutache, I.; Rozen, S.; Madden, T.L. Primer-BLAST: A tool to design target-specific primers for polymerase chain reaction. BMC Bioinform. 2012, 13, 134. [Google Scholar] [CrossRef] [PubMed]
 - Kent, W.J.; Sugnet, C.W.; Furey, T.S.; Roskin, K.M.; Pringle, T.H.; Zahler, A.M.; Haussler, A.D. The Human Genome Browser at UCSC. Genome Res. 2002, 12, 996–1006. [Google Scholar] [CrossRef]
 - Adzhubei, I.A.; Schmidt, S.; Peshkin, L.; Ramensky, V.E.; Gerasimova, A.; Bork, P.; Kondrashov, A.S.; Sunyaev, S.R. A method and server for predicting damaging missense mutations. Nat. Methods 2010, 7, 248–249. [Google Scholar] [CrossRef]
 - Schwarz, J.M.; Cooper, D.N.; Schuelke, M.; Seelow, D. MutationTaster2: Mutation prediction for the deep-sequencing age. Nat. Methods 2014, 11, 361–362. [Google Scholar] [CrossRef] [PubMed]
 - McLaren, W.; Gil, L.; Hunt, S.E.; Riat, H.S.; Ritchie, G.R.S.; Thormann, A.; Flicek, P.; Cunningham, F. The Ensembl Variant Effect Predictor. Genome Biol. 2016, 17, 122. [Google Scholar] [CrossRef] [PubMed]
 - Capriotti, E.; Calabrese, R.; Casadio, R. Predicting the insurgence of human genetic diseases associated to single point protein mutations with support vector machines and evolutionary information. Bioinformatics 2006, 22, 2729–2734. [Google Scholar] [CrossRef]
 - McVey, J.H.; Rallapalli, P.M.; Kemball-Cook, G.; Hampshire, D.J. The euroéan association for haemophilia and allied disorders (EAHAD) Coagulation Variant Databases: Important resources for haemostasis clinicians and researchers. Haemophilia 2020, 26, 306–313. [Google Scholar] [CrossRef]
 - Hawker, C.D.; Roberts, W.L.; DaSilva, A.; Stam, G.D.; Owen, W.E.; Curtis, D.; Choi, B.-S.; Ring, T.A. Development and Validation of an Automated Thawing and Mixing Workcell. Clin. Chem. 2007, 53, 2209–2211. [Google Scholar] [CrossRef] [PubMed][Green Version]
 - Li, H.; Lan, R.; Peng, N.; Sun, J.; Zhu, Y. High resolution melting curve analysis with MATLAB-based program. Measurement 2016, 90, 178–186. [Google Scholar] [CrossRef]
 - Dunnen, J.T.D.; Dalgleish, R.; Maglott, D.R.; Hart, R.K.; Greenblatt, M.S.; McGowan-Jordan, J.; Roux, A.-F.; Smith, T.; Antonarakis, S.E.; Taschner, P.E.; et al. HGVS Recommendations for the Description of Sequence Variants: 2016 Update. Hum. Mutat. 2016, 37, 564–569. [Google Scholar] [CrossRef] [PubMed]
 - Cygan, P.H.; Kouides, P.A. Regulation and importance of factor VIII levels in hemophilia A carriers. Curr. Opin. Hematol. 2021, 28, 315–322. [Google Scholar] [CrossRef]
 - Cooper, D.N.; Krawczak, M.; Polychronakos, C.; Tyler-Smith, C.; Kehrer-Sawatzki, H. Where genotype is not predictive of phenotype: Towards an understanding of the molecular basis of reduced penetrance in human inherited disease. Qual. Life Res. 2013, 132, 1077–1130. [Google Scholar] [CrossRef]
 - Venceslá, A.; Alvárez-Román, M.T.; Rivas, I.; Fernández, I.; Butta, N.; Baena, M.; Fuentes-Prior, P.; Tizzano, E.; Jiménez-Yuste, V.; Martín-Salces, M. Clinical and genetic findings in five female patients with haemophilia A: Identification of a novel missense mutation, p.Phe2127Ser. Thromb. Haemost. 2010, 104, 718–723. [Google Scholar] [CrossRef]
 - Halldén, C.; Nilsson, D.; Säll, T.; Lidén, A.C.; Ljung, R. Origin of Swedish hemophilia A mutations. J. Thromb. Haemost. 2012, 10, 2503–2511. [Google Scholar] [CrossRef]
 - Peyvandi, F.; Garagiola, I.; Young, G. The past and future of haemophilia: Diagnosis, treatments, and its complications. Lancet 2016, 388, 187–197. [Google Scholar] [CrossRef]
 - Castillo-González, D. Hemofilia II. Aspectos moleculares y de genética poblacional. Rev. Cuba. Hematol. Inmunol. y Hemoter. 2012, 28, 111–119. [Google Scholar]
 - Favier, R.; Lavergne, J.-M.; Costa, J.-M.; Caron, C.; Mazurier, C.; Viémont, M.; Delpech, M.; Valleix, S. Unbalanced X-chromosome inactivation with a novel FVIII gene mutation resulting in severe hemophilia A in a female. Blood 2000, 96, 4373–4375. [Google Scholar] [CrossRef] [PubMed]
 - Valleix, S.; Vinciguerra, C.; Lavergne, J.-M.; Leuer, M.; Delpech, M.; Négrier, C. Skewed X-chromosome inactivation in monochorionic diamniotic twin sisters results in severe and mild hemophilia A. Blood 2002, 100, 3034–3036. [Google Scholar] [CrossRef] [PubMed]
 - Biguzzi, E.; Castelli, F.; Lijfering, W.M.; Cannegieter, S.C.; Eikenboom, J.; Rosendaal, F.R.; Vlieg, A.V.H. Rise of levels of von Willebrand factor and factor VIII with age: Role of genetic and acquired risk factors. Thromb. Res. 2021, 197, 172–178. [Google Scholar] [CrossRef]
 - Kadir, R.A.; Sabin, C.; Owens, D.; Lee, C.A.; Economides, D.L. Variations in Coagulation Factors in Women: Effects of Age, Ethnicity, Menstrual Cycle and Combined Oral Contraceptive. Thromb. Haemost. 1999, 82, 1456–1461. [Google Scholar] [CrossRef] [PubMed]
 - Miesbach, W.; Alesci, S.; Geisen, C.; Oldenburg, J. Association between phenotype and genotype in carriers of haemophilia A. Haemophilia 2010, 17, 246–251. [Google Scholar] [CrossRef] [PubMed]
 - Brandstetter, H.; Bauer, M.; Huber, R.; Lollar, P.; Bode, W. X-ray structure of clotting factor IXa: Active site and module structure related to Xase activity and hemophilia B. Proc. Natl. Acad. Sci. USA 1995, 92, 9796–9800. [Google Scholar] [CrossRef] [PubMed]
 - Ludwig, M.; Schwaab, R.; Eigel, A.; Horst, J.; Egli, H.; Brackmann, H.H.; Olek, K. Identification of a single nucleotide C-to-T transition and five different deletions in patients with severe hemophilia B. Am. J. Hum. Genet. 1989, 45, 115–122. [Google Scholar]
 - Chen, S.-H.; Zhang, M.; Lovrien, E.W.; Scott, C.R.; Thompson, A.R. CG dinucleotide transitions in the factor IX gene account for about half of the point mutations in hemophilia B patients: A Seattle series. Qual. Life Res. 1991, 87, 177–182. [Google Scholar] [CrossRef]
 - Eikenboom, J.C.; Reitsma, P.H.; Briet, E.; Peerlinck, K.M.J. Recessive inheritance of von Willebrand’s disease type I. Lancet 1993, 341, 982–986. [Google Scholar] [CrossRef]
 - Goodeve, A.; Eikenboom, J.; Castaman, G.; Rodeghiero, F.; Federici, A.B.; Batlle, J.; Meyer, D.; Mazurier, C.; Goudemand, J.; Schneppenheim, R.; et al. Phenotype and genotype of a cohort of families historically diagnosed with type 1 von Willebrand disease in the European study, Molecular and Clinical Markers for the Diagnosis and Management of Type 1 von Willebrand Disease (MCMDM-1VWD). Blood 2006, 109, 112–121. [Google Scholar] [CrossRef]
 - James, P.D.; Notley, C.; Hegadorn, C.; Leggo, J.; Tuttle, A.; Tinlin, S.; Association of Hemophilia Clinic Directors of Canada. The mutational spectrum of type 1 von Willebrand disease: Results from a Canadian cohort study. Ethics 2007, 109, 145–154. [Google Scholar] [CrossRef]
 - O’Brien, L.A.; James, P.D.; Othman, M.; Berber, E.; Cameron, C.; Notley, C.R.P.; Hegadorn, C.A.; Sutherland, J.J.; Hough, C.; Rivard, G.E.; et al. Founder von Willebrand factor haplotype associated with type 1 von Willebrand disease. Blood 2003, 102, 549–557. [Google Scholar] [CrossRef]
 - Tjernberg, P.; Van Der Heijden, J.F.; Eikenboom, J.C.J.; Reitsma, P.H. Evaluation of the von Willebrand factor Y1584C polymorphism as a potential risk factor for bleeding in patients receiving anticoagulant treatment with vitamin K antagonists. J. Thromb. Haemost. 2005, 3, 797–798. [Google Scholar] [CrossRef] [PubMed]
 - Hernández-Zamora, E.; Zavala-Hernández, C.; Quintana-González, S.; Reyes-Maldonado, E. von Willebrand disease, molecular biology and diagnosis. Cirugía y Cirujanos (Engl. Ed. ) 2015, 83, 255–264. [Google Scholar] [CrossRef]
 - Leksa, N.C.; Chiu, P.-L.; Bou-Assaf, G.M.; Quan, C.; Liu, Z.; Goodman, A.B.; Chambers, M.G.; Tsutakawa, S.E.; Hammel, M.; Peters, R.T.; et al. The structural basis for the functional comparability of factor VIII and the long-acting variant recombinant factor VIII Fc fusion protein. J. Thromb. Haemost. 2017, 15, 1167–1179. [Google Scholar] [CrossRef]
 - Baronciani, L.; Goodeve, A.; Peyvandi, F. Molecular diagnosis of von Willebrand disease. Haemophilia 2017, 23, 188–197. [Google Scholar] [CrossRef] [PubMed]
 - Nakagawa, M.; Matsusue, A.; Umetsu, K.; Iino, M.; Ishikawa, T.; Yuasa, I. Genotyping of the c.1423C>T (p.P475S) polymorphism in the ADAMTS13 gene by APLP and HRM assays: Northeastern Asian origin of the mutant. Leg. Med. 2016, 21, 1–4. [Google Scholar] [CrossRef] [PubMed]
 - Solimando, M.; Baronciani, L.; La Marca, S.; Cozzi, G.; Asselta, R.; Canciani, M.T.; Federici, A.B.; Peyvandi, F. Molecular characterization, recombinant protein expression, and mRNA analysis of type 3 von Willebrand disease: Studies of an Italian cohort of 10 patients. Am. J. Hematol. 2012, 87, 870–874. [Google Scholar] [CrossRef] [PubMed]
 









| Primer | Sequence | PCR Conditions * | 
|---|---|---|
| VWFE17F VWFE17R  | CGATATTGAAAGGCCAGGCAG CCCAGAAATGAAGGCGATCCT  | 94 °C for 30 s, 56 °C for 45 s, and 72 °C for 90 s. | 
| VWFE18F VWFE18R  | CACAGACTCTAGGGGACCAA GCCTACAAGAAAACTGAAGGGC  | 94 °C for 30 s, 51 °C for 45 s, and 72 °C for 30 s. | 
| VWFE19F VWFE19R  | GAACCCATGTTTGCCAAGCC CTATGCAGGATGGACACAGGT  | 94 °C for 30 s, 51 °C for 45 s, and 72 °C for 90 s. | 
| VWFE20F VWFE20R  | GCTACAGGTCCTCAACTTCCT GAAACCAGACCCCAGAGTTGT  | 94 °C for 30 s, 51 °C for 45 s, and 72 °C for 45 s. | 
| VWFE21F VWFE21R  | ACACACCTGAGGGCATTCAC TCCTCTTTAATGGCTGTGCGT  | 94 °C for 30 s, 58 °C for 45 s, and 72 °C for 45 s. | 
| VWFE22F VWFE22R  | GCCCTTCATCCTCCTGGATTTC GTCCCCAACAAGATGAAGCA  | 94 °C for 30 s, 51 °C for 45 s, and 72 °C for 30 s. | 
| VWFE23/24F VWFE23/24R  | AAGGAAGCTCAGGAATGGGT ACTCTGTGTCCATACCACCA  | 94 °C for 30 s, 55 °C for 45 s, and 72 °C for 90 s. | 
| VWFE25F VWFE25R  | GCCAGCAGCACTGCATTATT CTTGGCCATCCAGTCCCTAC  | 94 °C for 30 s, 51 °C for 45 s, and 72 °C for 45 s. | 
| VWFE28-1F VWFE28-1R  | GCTCAGAAGTGTCCACAGGTT GACGAACGCCACATCCAGAA  | 94 °C for 30 s, 57 °C for 45 s, and 72 °C for 90 s. | 
| VWFE28-2F VWFE28-2R  | TCAAGCAGATCCGCCTCATC GATGCATGTAGCACCAAGGC  | 94 °C for 30 s, 55 °C for 45 s, and 72 °C for 90 s. | 
| FIXE1 + promoterF FIXE1 + promoterR  | CCCATTCTCTTCACTTGTCC CCTAGCTAACAAAGAACCAGT  | 94 °C for 30 s, 50 °C for 45 s, and 72 °C for 90 s. | 
| FIXE2-3F FIXE2-3R  | AGAGATGTAAAATTTTCATGATGTT GCAGAGAAAAAACCCACATAAT  | 95 °C for 30 s, 50 °C for 90 s, and 72 °C for 90 s. | 
| FIXE4F FIXE4R  | GCTGGCTTCCAGGTCAGTAG CCAGTTTCAACTTGTTTCAGAGGG  | 95 °C for 30 s, 51 °C for 30 s, and 72 °C for 90 s. | 
| FIXE5F FIXE5R  | CATGAGTCAGTAGTTCCATGTACTTT TGTAGGTTTGTTAAAATGCTGAAGTT  | 95 °C for 30 s, 60 °C for 30 s, and 72 °C for 90 s. | 
| FIXE6F FIXE6R  | GTGACAAGGATGGGCCTCAA TGGTTAGTGCTGAAACTTGCC  | 95 °C for 30 s, 60 °C for 30 s, and 72 °C for 90 s. | 
| FIXE7F FIXE7R  | ATTTTGTTTTCACAGGTTGTTTTGA TATTCTTTCTGTGTATTTACCTGCG  | 95 °C for 30 s, 58 °C for 45 s, and 72 °C for 90 s. | 
| FIXE8-1F ** FIXE8-1R  | AGGTCAGTGGTCCCAAGTAGT TTCCTCTAGTGGTTCCATTTTCT  | 95 °C for 30 s, 50 °C for 90 s, and 72 °C for 90 s. | 
| FIXE8-2F ** FIXE8-2R  | TGAAAATTAACAGGGCCTCTCAC AGCTCTTAGAATGGCTTATTGCT  | 95 °C for 30 s, 54 °C for 90 s, and 72 °C por 90 s. | 
| FIXE8-3F ** FIXE8-3R  | CTATCAAACCCAGACTTGCTTCC TTTTGTCAGTAGTCCCATGCATCA  | 95 °C for 30 s, 56 °C for 45 s, and 72 °C for 90 s. | 
| Code | Gender | Diagnosis | Genetic Variant * | Exon ** | Genotype | Amino Acid Substitution | Prediction Software Analysis | dbSNP ID/HGMD *** | 
|---|---|---|---|---|---|---|---|---|
| Af1a | Female | Hemophilia A FVIII (%): 24.3 Coagulometric Technique Reference Values 50–150% Referenced her brother’s Values at 1.2%  | c.3690_3691insG | 14D | Heterozygous | p.(Pro1231*) | Mutation Taster: Disease Causing Prob: 1 | Novel | 
| c.5440G > A | 16 | Heterozygous | p.(Asp1814Asn) | Sift: Damaging Score: 0.0 | Novel | |||
| PhD-SNP: Disease | ||||||||
| Polyphen: Benign Score: 0.014 | ||||||||
| Mutation Taster: Polymorphism Prob: 0.999999996251468 | ||||||||
| Ensembl Impact: Moderate | ||||||||
| c.6605A > T | 24 | Heterozygous | p.(Lys2202Ile) | Sift: Damaging Score: 0.02 | Novel | |||
| PhD-SNP: Disease | ||||||||
| Polyphen: Possibly Damaging Score: 0.693 | ||||||||
| Mutation Taster: Polymorphism Prob: 0.9999999407418885 | ||||||||
| Ensembl Impact: Modifier | ||||||||
| Af2a | Female | Hemophilia A FVIII (%): 71.3 Coagulometric Technique Reference Values 50–150%  | c.673A > G | 6 | Homozygous | p.(Lys225Glu) | PhD-SNP: Disease | Novel | 
| Polyphen: Possibly Damaging Score: 0.657 | ||||||||
| Mutation Taster: Disease Causing Prob: 0.999729299879278 | ||||||||
| Ensembl Impact: Modifier | ||||||||
| c.6605A > T | 24 | Heterozygous | p.(Lys2202Ile) | Sift: Damaging Score: 0.02 | Novel | |||
| PhD-SNP: Disease | ||||||||
| Polyphen: Possibly Damaging Score: 0.693 | ||||||||
| Mutation Taster: Polymorphism Prob: 0.9999999407418885 | ||||||||
| Ensembl Impact: Modifier | ||||||||
| Am1A | Male | Hemophilia A FVIII (%): 4 Coagulometric Technique Reference Values 50–150%  | c.5375T > A | 16 | Hemizygous | p.(Val1792Glu) | Sift: Damaging Score: 0 | Novel | 
| PhD-SNP: Disease | ||||||||
| Polyphen: Probably Damaging Score: 1.000 | ||||||||
| Mutation Taster: Disease Causing Prob: 0.999999863121858 | ||||||||
| Ensembl Impact: Modifier | ||||||||
| Am2A | Male | Hemophilia A FVIII (%): 0.9 Coagulometric Technique Reference Values 50–150%  | c.203C > T | 2 | Hemizygous | p.(Thr68Ile) | Sift: Tolerated Score: 0.46 | CM1212705 | 
| PhD-SNP: Neutral | ||||||||
| Polyphen: Probably Damaging Score: 0.94 | ||||||||
| Mutation Taster: Disease Causing Prob: 0.545256099530899 | ||||||||
| Ensembl Impact: Moderate | ||||||||
| Af3A | Female | Hemophilia A FVIII (%): 30.0 Coagulometric Technique Reference Values 50–150% Referenced Her Son’s Values at 0.33%  | c.440T > C | 4 | Homozygous | p.(Val147Ala) | Sift: Damaging Score: 0 | Novel | 
| PhD-SNP: Disease | ||||||||
| Polyphen: Probably Damaging | ||||||||
| Score: 0.973 | ||||||||
| Mutation Taster: Disease Causing Prob: 0.999979328541858 | ||||||||
| Am3A | Male | Hemophilia A  FVIII (%): 1.3 Coagulometric Technique Reference Values 50–150%  | c.789T > C | 7 | Hemizygous | p.(Gly263Gly) | PhD-SNP: Disease | Novel | 
| Mutation Taster: Disease Causing Prob: 0.999999999999972 | ||||||||
| Ensembl Impact: Modifier | ||||||||
| Af4A | Female | Hemophilia A FVIII (%): 83.2 Coagulometric Technique Reference Values 50–150%  | c.440T > C | 4 | Heterozygous | p.(Val147Ala) | Sift: Damaging Score: 0 | Novel | 
| PhD-SNP: Disease | ||||||||
| Polyphen: Probably Damaging | ||||||||
| Score: 0.973 | ||||||||
| Mutation Taster: Disease Causing Prob: 0.999979328541858 | ||||||||
| c.5440G > A | 16 | Homozygous | p.(Asp1814Asn) | Sift: Damaging Score: 0.02 | Novel | |||
| PhD-SNP: Disease | ||||||||
| Polyphen: Benign Score: 0.014 | ||||||||
| Mutation Taster: Polymorphism Prob: 0.999999996251468 | ||||||||
| Ensembl Impact: Moderate | ||||||||
| Am4A | Male | Hemophilia A FVIII (%): 0.4 Coagulometric Technique Reference Values 50–150%  | g.4266C > T | 1 | Hemizygous | 5’UTR variant | Mutation Taster: Polymorphism Prob: 0.999997026960022 | Novel | 
| Ensembl: Modifier | ||||||||
| c.5506T > G | 16 | Hemizygous | p.(Trp1836Gly) | Sift: Damaging Score: 0 | Novel | |||
| PhD-SNP: Disease | ||||||||
| Polyphen: Probably Damaging Score: 1 | ||||||||
| Mutation Taster: Disease Causing Prob: 0.999999201432753 | ||||||||
| Am5A | Male | Hemophilia A FVIII (%): 45.7 Coagulometric Technique Reference Values 50–150%  | c.5535T > A | 16 | Hemizygous | p.(Thr1845Thr) | PhD-SNP: Neutral | Novel | 
| Mutation taster: Polymorphism Prob: 0.99999573313174 | ||||||||
| Ensembl Impact: Modifier | ||||||||
| c.6605A > T | 24 | Hemizygous | p.(Lys2202Ile) | Sift: Damaging Score: 0.02 | Novel | |||
| PhD-SNP: Disease | ||||||||
| Polyphen: Possibly Damaging Score: 0.781 | ||||||||
| Mutation Taster: Polymorphism Prob: 0.999999940741885 | ||||||||
| Ensembl Impact: Moderate | ||||||||
| Am6A | Male | Hemophilia A FVIII (%): 14 Coagulometric Technique Reference Values 50–150%  | c.673A > G | 6 | Hemizygous | p.(Lys225Glu) | Sift: Tolerated Score: 0.12 | Novel | 
| PhD-SNP: Disease | ||||||||
| Polyphen: Possibly Damaging Score: 0.657 | ||||||||
| Mutation Taster: Disease Causing Prob: 0.999729299879278 | ||||||||
| Ensembl Impact: Moderate | ||||||||
| c.6605A > T | 24 | Hemizygous | p.(Lys2202Ile) | Sift: Damaging Score: 0.02 | Novel | |||
| PhD-SNP: Disease | ||||||||
| Polyphen: Possibly Damaging Score: 0.781 | ||||||||
| Mutation Taster: Polymorphism Prob: 0.999999940741885 | ||||||||
| Ensembl Impact: Moderate | ||||||||
| Am7A | Male | Hemophilia A FVIII (%): 0.83 Coagulometric Technique Reference Values 50–150%  | c.673A > G | 6 | Hemizygous | p.(Lys225Glu) | Sift: Tolerated Score: 0.12 | Novel | 
| PhD-SNP: Disease | ||||||||
| Polyphen: Possibly Damaging Score: 0.657 | ||||||||
| Mutation Taster: Disease Causing Prob: 0.999729299879278 | ||||||||
| Ensembl Impact: Moderate | ||||||||
| Am1B | Male | Hemophilia B FIX (%): 0.1 Coagulometric Technique Reference Values 50–150%  | c.1150C > T | 8.1 | Hemizygous | p.Arg384 * | Mutation Taster: Disease Causing Model: complex_aae, prob: 1 | rs137852261 CM940671 | 
| Ensembl Impact: Modifier | ||||||||
| Af1B | Female | Hemophilia B FIX (%): Unknown Coagulometric Technique Reference Values 50–150% Referenced Her Son’s Values at 1.5%  | c.810_811insG | 7 | Heterozygous | p.(Thr271Dfs*4) | Mutation Taster: Disease Causing Model: complex_aae, prob: 1 | Novel | 
| Ensembl impact: Modifier | ||||||||
| g.32185T > C | 8.3 | Heterozygous | Alteration region: 3’UTR | Mutation Taster: Polymorphism Prob: 0,999989953358595 | Novel | |||
| Af2B | Female | Hemophilia B FIX (%): Unknown Coagulometric Technique Reference Values 50–150% Referenced Her Son’s Values at 0.4%  | c.1038_1038delC | 8.1 | Homozygous | p. (Lys347Nfs *) | Mutation Taster: Disease Causing Model: complex_aae, prob: 1 | Novel | 
| Ensembl Impact: Modifier | ||||||||
| Af1VW | Female | von Willebrand Disease von Willebrand Factor (Antigen): 42.9 Technique: Immunocapture Reference Values 50–160%  | c.2454G > T | 19 | Heterozygous | p. (Glu818Asp) | Sift: Tolerated Score: 0.21 | Novel | 
| PhD-SNP: Neutral | ||||||||
| Polyphen: Benign Score: 0.006 | ||||||||
| Mutation Taster: Polymorphism Prob: 0.99792257832411 | ||||||||
| c.2529G > C | 19 | Homozygous | p.(Lys843Asn) | Sift: Tolerated Score: 0.11 | Novel | |||
| PhD-SNP: Neutral | ||||||||
| Polyphen: Benign Score: 0.153 | ||||||||
| Mutation Taster: Polymorphism Prob: 0.997287667014106 | ||||||||
| c.3835G > A | 28A | Heterozygous | p.Val1279Ile | Sift: Damaging Score: 0.04 | rs61749376 CM931400 | |||
| PhD-SNP: Neutral | ||||||||
| Polyphen: Possibly damaging | ||||||||
| Score: 0.735 | ||||||||
| Mutation Taster: Disease causing Prob: 0.99844456886186 | ||||||||
| c.4027A > G | 28A | Heterozygous | p.Ile1343Val | Sift: Tolerated Score: 0.07 | rs150923481 | |||
| PhD-SNP: Neutral | ||||||||
| Polyphen: Benign Score: 0.087 | ||||||||
| Mutation Taster: Polymorphism Prob: 0.982659315673669 | ||||||||
| c.4133C > T | 28A | Heterozygous | p.Ser1378Phe | Sift: Damaging Score: 0.01 | rs61750073 CM070351 | |||
| PhD-SNP: Disease | ||||||||
| Polyphen: Probably damaging | ||||||||
| Score: 1.000 | ||||||||
| Mutation Taster: Polymorphism Prob: 0.999732762130257 | ||||||||
| c.4141A > G | 28A | Homozygous | p.Thr1381Ala | Sift: Tolerated Score: 1 | rs216311 | |||
| PhD-SNP: Neutral | ||||||||
| Polyphen: Benign Score: 0.000 | ||||||||
| Mutation Taster: Polymorphism Prob: 0.999999999999837 | ||||||||
| c.4641T > C | 28B | Homozygous | p.Thr1547Thr | Sift: Tolerated Score: 1 | rs216310 | |||
| PhD-SNP: Neutral | ||||||||
| Mutation Taster: Polymorphism Prob: 0.999466147207589 | ||||||||
| c.4738C > G | 28B | Heterozygous | p. Leu1580Val | Sift: Tolerated Score: 0.56 | rs61750114 CM095110 | |||
| PhD-SNP: Neutral | ||||||||
| Polyphen: Benign Score: 0.197 | ||||||||
| Mutation Taster: Polymorphism Prob: 0.99999993020585 | ||||||||
| Af2VW | Female | von Willebrand Disease von Willebrand Factor (Antigen): 46.2 Technique: Immunocapture Reference Values 50–160%  | c.3368C > G | 25 | Heterozygous | p.(Ala1123Gly) | Sift: Damaging Score: 0.05 | Novel | 
| PhD-SNP: Neutral | ||||||||
| Polyphen: Benign Score: 0.024 | ||||||||
| Mutation Taster: Polymorphism Prob: 0.99999999966864 | ||||||||
| c.4141A > T | 28A | Heterozygous | p.(Thr1381Ser) | Sift: Damaging Score: 0.01 | Novel | |||
| PhD-SNP: Neutral | ||||||||
| Polyphen: Benign Score: 0.030 | ||||||||
| Mutation Taster: Polymorphism Prob: 0.999999999999947 | ||||||||
| c.4751A > G | 28B | Heterozygous | p.Tyr1584Cys | Sift: Damaging Score: 0 | rs1800386 CM031758 | |||
| PhD-SNP: Disease | ||||||||
| Polyphen: Probably damaging Score: 0.987 | ||||||||
| Mutation Taster: Polymorphism Prob: 0.999999120870778 | ||||||||
| Af3VW | Female | von Willebrand Disease von Willebrand Factor (Antigen): 34.5 Technique: Immunocapture Reference Values 50–160%  | c.2479T > A | 19 | Heterozygous | p.(Cys827Ser) | Sift: Damaging Score: 0 | Novel | 
| PhD-SNP: Disease | ||||||||
| Polyphen: Possibly Damaging Score: 1.000 | ||||||||
| Mutation Taster: Disease causing Prob: 0.999999938099734 | ||||||||
| c.2482C > A | 19 | Heterozygous | p.(Pro828Thr) | Sift: Damaging Score: 0 | Novel | |||
| PhD-SNP: Neutral | ||||||||
| Polyphen: Possibly Damaging Score: 1.000 | ||||||||
| Mutation Taster: Disease Causing Prob: 0.999999953987469 | ||||||||
| c.2529G > C | 19 | Heterozygous | p.(Lys843Asn) | Sift: Tolerated Score: 0.11 | Novel | |||
| PhD-SNP: Neutral | ||||||||
| Polyphen: Benign Score: 0.153 | ||||||||
| Mutation Taster: Polymorphism Prob: 0.997287667014106 | ||||||||
| c.2770C > A | 21 | Heterozygous | p.(Arg924Arg) | Sift: Tolerated Score: 1 | Novel | |||
| PhD-SNP: Neutral | ||||||||
| Mutation Taster: Disease Causing Prob: 0.999999860094315 | ||||||||
| c.3291C > G | 25 | Heterozygous | p.(Cys1097Trp) | Sift: Damaging Score: 0 | Novel | |||
| PhD-SNP: Neutral | ||||||||
| Polyphen: Possibly Damaging Score. 0.641 | ||||||||
| Mutation Taster: Disease Causing Prob: 0.999997683583057 | ||||||||
| c.3350T > G | 25 | Heterozygous | p.(Val1117Gly) | Sift: Damaging Score: 0 | Novel | |||
| PhD-SNP: Disease | ||||||||
| Polyphen: Possibly Damaging Score. 0.642 | ||||||||
| Mutation Taster: Disease Causing Prob: 0.881353491915509 | ||||||||
| c.3951C > T | 28A | Heterozygous | p.Ala1317Ala | Sift: Tolerated Score: 1 | rs561155315 | |||
| PhD-SNP: Neutral | ||||||||
| Mutation Taster: Disease Causing Prob: 0.999999999983201 | ||||||||
| c.4141A > G | 28A | Homozygous | p.Thr1381Ala | Sift: Tolerated Score: 1 | rs216311 | |||
| PhD-SNP: Neutral | ||||||||
| Polyphen: Benign Score: 0.000 | ||||||||
| Mutation Taster: Polymorphism Prob: 0.999999999999837 | ||||||||
| c.4641T > C | 28B | Homozygous | p.Thr1547Thr | Sift: Tolerated Score: 1 | rs216310 | |||
| PhD-SNP: Neutral | ||||||||
| Mutation Taster: Polymorphism Prob: 0.999466147207589 | ||||||||
| c.4738C > G | 28B | Heterozygous | p.Leu1580Val | Sift: Tolerated Score: 0.59 | rs61750114 | |||
| PhD-SNP: Neutral | ||||||||
| Polyphen: Benign Score: 0.197 | ||||||||
| Mutation Taster: Polymorphism Prob: 0.99999993020585 | ||||||||
| Am1VW | Male | von Willebrand Disease von Willebrand Factor (Antigen): 56 Technique: Immunocapture Reference Values 50–160%  | c.2535C > A | 19 | Homozygous | p.(Gly845Gly) | Sift: Tolerated Score: 0.52 | Novel | 
| PhD-SNP: Neutral | ||||||||
| Mutation Taster: Disease Causing Prob: 1 | ||||||||
| c.4141A > G | 28A | Homozygous | p.Thr1381Ala | Sift: Tolerated Score: 1 | rs216311 | |||
| PhD-SNP: Neutral | ||||||||
| Polyphen: Benign Score: 0.000 | ||||||||
| Mutation Taster: Polymorphism Prob: 0.999999999999837 | ||||||||
| c.4641T > C | 28B | Homozygous | p.Thr1547Thr | Sift: Tolerated Score: 1 | rs216310 | |||
| PhD-SNP: Neutral | ||||||||
| Mutation Taster: Polymorphism Prob: 0.999466147207589 | ||||||||
| Af4VW | Female | von Willebrand Disease von Willebrand Factor (Antigen): Unknown Technique: Immunocapture Reference Values 50–160%  | c.3252C > G | 25 | Heterozygous | p.(Cys1084Trp) | Sift: Damaging Score: 0 | Novel | 
| PhD-SNP: Disease | ||||||||
| Polyphen: Possibly Damaging Score: 1.000 | ||||||||
| Mutation Taster: Disease Causing Prob: 0.999999999989141 | ||||||||
| c.3297C > G | 25 | Heterozygous | p.(Cys1099Trp) | Sift: Damaging Score: 0 | Novel | |||
| PhD-SNP: Disease | ||||||||
| Polyphen: Possibly Damaging Score: 1.000 | ||||||||
| Mutation Taster: Disease Causing Prob: 0.999999999413986 | ||||||||
| c.3350T > G | 25 | Heterozygous | p.(Val1117Gly) | Sift: Damaging Score: 0 | Novel | |||
| PhD-SNP: Disease | ||||||||
| Polyphen: Possibly Damaging Score: 0.642 | ||||||||
| Mutation Taster: Disease Causing Prob: 0.881353491915509 | ||||||||
| c.4141A > G | 28A | Homozygous | p.Thr1381A | Sift: Tolerated Score: 1 | rs216311 | |||
| PhD-SNP: Neutral | ||||||||
| Polyphen: Benign Score: 0.000 | ||||||||
| Mutation Taster: Polymorphism Prob: 0.999999999999837 | ||||||||
| c.4641T > C | 28B | Homozygous | p.Thr1547Thr | Sift: Tolerated Score: 1 | rs216310 | |||
| PhD-SNP: Neutral | ||||||||
| Mutation Taster: Polymorphism Prob: 0.999466147207589 | 
| F8 Variations | SNP Position | Variation Effect | Reported  Variations (Human Gene Variation Database ID or rs ID)  | Total: 11 | 
|---|---|---|---|---|
| Variant with uncertain significance | c.3690_3691insG | p.(Pro1231 *) | novel | 11 | 
| c.5440G > A | p.(Asp1814Asn) | novel | ||
| c.6605A > T | p.(Lys2202Ile) | novel | ||
| c.673A > G | p.(Lys225Glu) | novel | ||
| c.5375T > A | p.(Val1792Glu) | novel | ||
| c.203C > T | p.(Thr68Ile) | CM1212705 | ||
| c.440T > C | p.Val147Ala | novel | ||
| c.789T > C | p.(Gly263Gly) | novel | ||
| c.5506T > G | p.(Trp1836Gly) | novel | ||
| c.5535T > A | p.(Thr1845Thr) | novel | ||
| g.4266C > T | 5’UTR variant | novel | ||
| F9variations (HB) | SNP position | Variation effect | Reported Variations | Total: 4 | 
| Pathogenic variant | c.1150C > T | p.Arg384 * | rs137852261/CM940671 | 1 | 
| Variant with uncertain significance | c.810_811insG | p.(Thr271Dfs*4) | novel | 3 | 
| g.32185T > C | 3’UTR variant | novel | ||
| c.1038_1038delC | p. (Lys347Nfs *) | novel | ||
| VWF variations (VWD) | SNP position | Variation effect | Reported Variations | Total: 19 | 
| Likely pathogenic variant | c.4751A > G | p.Tyr1584Cys | rs1800386/CM031758 | 1 | 
| Likely benign variant | c.4141A > G | p.Thr1381Ala | rs216311 | 2 | 
| c.4641T > C | p.Thr1547Thr | rs216310 | ||
| Variant with uncertain significance | c.4027A > G | p.Ile1343Val | rs150923481 | 17 | 
| c.4133C > T | p.Ser1378Phe | rs61750073/CM070351 | ||
| c.4738C > G | p.Leu1580Val | rs61750114/CM095110 | ||
| c.3951C > T | p.Ala1317Ala | rs561155315 | ||
| c.2454G > T | p. (Glu818Asp) | novel | ||
| c.2529G > C | p.(Lys843Asn) | novel | ||
| c.3835G > A | p.Val1279Ile | rs61749376 CM931400 | ||
| c.3368C > G | p.(Ala1123Gly) | novel | ||
| c.2479T > A | p.(Cys827Ser) | novel | ||
| c.2482C > A | p.(Pro828Thr) | novel | ||
| c.2770C > A | p.(Arg924Arg) | novel | ||
| c.3291C > G | p.(Cys1097Trp) | novel | ||
| c.2535C > A | p.(Gly845Gly) | novel | ||
| c.3252C > G | p.(Cys1084Trp) | novel | ||
| c.3350T > G | p.(Val1117Gly) | novel | ||
| c.3297C > G | p.(Cys1099Trp) | novel | 
| Exon | Patient | Patient Diagnosis | Variation | HRM Validation * | 
|---|---|---|---|---|
| 1 | Am4a | HA | g.4266C > T | V | 
| 2 | Am2a | HA | c.203C > T | V | 
| 4 | Af3a | HA | c.440T > C | V | 
| 4 | Af4a | HA | c.440T > C | V | 
| 6 | Af2a | HA | c.673A > G | N | 
| 6 | Am6a | HA | c.673A > G | V | 
| 6 | Am7a | HA | c.673A > G | V | 
| 7 | Am3a | HA | c.789T > C | V | 
| 16 | Af1a | HA | c.5440G > A | V | 
| 16 | Af4a | HA | c.5440G > A | V | 
| 16 | Am1a | HA | c.5375T > A | V | 
| 16 | Am4a | HA | c.5506T > G | V | 
| 16 | Am5a | HA | c.5535T > A | V | 
| 24 | Af1a | HA | c.6605A > T | V | 
| 24 | Af2a | HA | c.6605A > T | V | 
| 24 | Am5a | HA | c.6605A > T | V | 
| 24 | Am6a | HA | c.6605A > T | V | 
| 7 | Af1b | HB | c.810_811insG | V | 
| 8.1 | Af2b | HB | c.1038_1038delC | V | 
| 8.1 | Am1b | HB | c.1150C > T | V | 
| 8.3 | Af1b | HB | g.32185T > C | V | 
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.  | 
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lago, J.; Groot, H.; Navas, D.; Lago, P.; Gamboa, M.; Calderón, D.; Polanía-Villanueva, D.C. Genetic and Bioinformatic Strategies to Improve Diagnosis in Three Inherited Bleeding Disorders in Bogotá, Colombia. Genes 2021, 12, 1807. https://doi.org/10.3390/genes12111807
Lago J, Groot H, Navas D, Lago P, Gamboa M, Calderón D, Polanía-Villanueva DC. Genetic and Bioinformatic Strategies to Improve Diagnosis in Three Inherited Bleeding Disorders in Bogotá, Colombia. Genes. 2021; 12(11):1807. https://doi.org/10.3390/genes12111807
Chicago/Turabian StyleLago, Juliana, Helena Groot, Diego Navas, Paula Lago, María Gamboa, Dayana Calderón, and Diana C. Polanía-Villanueva. 2021. "Genetic and Bioinformatic Strategies to Improve Diagnosis in Three Inherited Bleeding Disorders in Bogotá, Colombia" Genes 12, no. 11: 1807. https://doi.org/10.3390/genes12111807
APA StyleLago, J., Groot, H., Navas, D., Lago, P., Gamboa, M., Calderón, D., & Polanía-Villanueva, D. C. (2021). Genetic and Bioinformatic Strategies to Improve Diagnosis in Three Inherited Bleeding Disorders in Bogotá, Colombia. Genes, 12(11), 1807. https://doi.org/10.3390/genes12111807
        
                                                
