Molecular Mechanisms of Skatole-Induced Inflammatory Responses in Intestinal Epithelial Caco-2 Cells: Implications for Colorectal Cancer and Inflammatory Bowel Disease
Abstract
:1. Introduction
2. Materials and Methods
2.1. Materials
2.2. Cell Culture
2.3. Cell Viability
2.4. Transfection and Luciferase Assays
2.5. Quantitative Real-Time PCR
2.6. Immunoblotting
2.7. Statistical Analysis
3. Results
3.1. Skatole Induces Cell Death in Caco-2 Intestinal Epithelial Cells and Plays a Role in Regulating TNF-α Expression, Aligning with Previous Findings
3.2. Skatole Elevates the Promoter Activity of IL-6 as Well as TNF-α and Increases IL-6 mRNA and Protein Expression
3.3. NF-κB Activation Is Induced by Skatole and Contributes to Intestinal Epithelial Caco-2 Cell Survival and Increased IL-6 and TNF-α Expression
3.4. Activation of AhR Partially Mitigates the Increase in IL-6 Expression Caused by Skatole by Attenuating the Activation of NF-κB
3.5. Activation of ERK and p38 Involved in the NF-κB/IL-6 Pathway by Skatole, but Not JNK
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Bray, F. Transitions in human development and the global cancer burden. In World Cancer Report 2014; Stewart, B.W., Wild, C.P., Eds.; IARC Press: Lyon, France, 2014; pp. 42–55. [Google Scholar]
- Maryam, S.; Krukiewicz, K.; Haq, I.U.; Khan, A.A.; Yahya, G.; Cavalu, S. Interleukins (Cytokines) as Biomarkers in Colorectal Cancer: Progression, Detection, and Monitoring. J. Clin. Med. 2023, 12, 3127. [Google Scholar] [CrossRef] [PubMed]
- Arnold, M.; Sierra, M.S.; Laversanne, M.; Soerjomataram, I.; Jemal, A.; Bray, F. Global patterns and trends in colorectal cancer incidence and mortality. Gut 2017, 66, 683–691. [Google Scholar] [CrossRef] [PubMed]
- Fidler, M.M.; Soerjomataram, I.; Bray, F. A global view on cancer incidence and national levels of the human development index. Int. J. Cancer 2016, 139, 2436–2446. [Google Scholar] [CrossRef]
- Bray, F.; Ferlay, J.; Soerjomataram, I.; Siegel, R.L.; Torre, L.A.; Jemal, A. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J. Clin. 2018, 68, 394–424. [Google Scholar] [CrossRef]
- Bergström, A.; Pisani, P.; Tenet, V.; Wolk, A.; Adami, H.O. Overweight as an avoidable cause of cancer in Europe. Int. J. Cancer 2001, 91, 421–430. [Google Scholar] [CrossRef]
- Islami, F.; Goding Sauer, A.; Miller, K.D.; Siegel, R.L.; Fedewa, S.A.; Jacobs, E.J.; McCullough, M.L.; Patel, A.V.; Ma, J.; Soerjomataram, I.; et al. Proportion and number of cancer cases and deaths attributable to potentially modifiable risk factors in the United States. CA Cancer J. Clin. 2018, 68, 31–54. [Google Scholar] [CrossRef] [PubMed]
- Lee, C.; Lee, S.; Yoo, W. Metabolic Interaction Between Host and the Gut Microbiota During High-Fat Diet-Induced Colorectal Cancer. J. Microbiol. 2024, 62, 153–165. [Google Scholar] [CrossRef]
- Litvak, Y.; Byndloss, M.X.; Bäumler, A.J. Colonocyte metabolism shapes the gut microbiota. Science 2018, 362, eaat9076. [Google Scholar] [CrossRef] [PubMed]
- Loke, Y.L.; Chew, M.T.; Ngeow, Y.F.; Lim, W.W.D.; Peh, S.C. Colon Carcinogenesis: The Interplay Between Diet and Gut Microbiota. Front. Cell. Infect. Microbiol. 2020, 10, 603086. [Google Scholar] [CrossRef]
- Shelton, C.D.; Byndloss, M.X. Gut Epithelial Metabolism as a Key Driver of Intestinal Dysbiosis Associated with Noncommunicable Diseases. Infect. Immun. 2020, 88, e00939-19. [Google Scholar] [CrossRef]
- Ullman, T.A.; Itzkowitz, S.H. Intestinal inflammation and cancer. Gastroenterology 2011, 140, 1807–1816. [Google Scholar] [CrossRef] [PubMed]
- Jess, T.; Rungoe, C.; Peyrin-Biroulet, L. Risk of colorectal cancer in patients with ulcerative colitis: A meta-analysis of population-based cohort studies. Clin. Gastroenterol. Hepatol. 2012, 10, 639–645. [Google Scholar] [CrossRef] [PubMed]
- Molodecky, N.A.; Soon, I.S.; Rabi, D.M.; Ghali, W.A.; Ferris, M.; Chernoff, G.; Benchimol, E.I.; Panaccione, R.; Ghosh, S.; Barkema, H.W.; et al. Increasing incidence and prevalence of the inflammatory bowel diseases with time, based on systematic review. Gastroenterology 2012, 142, 46–54.e42; quiz e30. [Google Scholar] [CrossRef] [PubMed]
- Beaugerie, L.; Itzkowitz, S.H. Cancers complicating inflammatory bowel disease. N. Engl. J. Med. 2015, 372, 1441–1452. [Google Scholar] [CrossRef]
- Axelrad, J.E.; Lichtiger, S.; Yajnik, V. Inflammatory bowel disease and cancer: The role of inflammation, immunosuppression, and cancer treatment. World J. Gastroenterol. 2016, 22, 4794–4801. [Google Scholar] [CrossRef]
- Keum, N.; Giovannucci, E. Global burden of colorectal cancer: Emerging trends, risk factors and prevention strategies. Nat. Rev. Gastroenterol. Hepatol. 2019, 16, 713–732. [Google Scholar] [CrossRef]
- Montalban-Arques, A.; Scharl, M. Intestinal microbiota and colorectal carcinoma: Implications for pathogenesis, diagnosis, and therapy. EBioMedicine 2019, 48, 648–655. [Google Scholar] [CrossRef] [PubMed]
- Lin, Y.; He, Z.; Ye, J.; Liu, Z.; She, X.; Gao, X.; Liang, R. Progress in Understanding the IL-6/STAT3 Pathway in Colorectal Cancer. OncoTargets Ther. 2020, 13, 13023–13032. [Google Scholar] [CrossRef]
- Shahini, A.; Shahini, A. Role of interleukin-6-mediated inflammation in the pathogenesis of inflammatory bowel disease: Focus on the available therapeutic approaches and gut microbiome. J. Cell Commun. Signal. 2023, 17, 55–74. [Google Scholar] [CrossRef]
- Alhendi, A.; Naser, S.A. The dual role of interleukin-6 in Crohn’s disease pathophysiology. Front. Immunol. 2023, 14, 1295230. [Google Scholar] [CrossRef]
- Nikolaus, S.; Waetzig, G.H.; Butzin, S.; Ziolkiewicz, M.; Al-Massad, N.; Thieme, F.; Lövgren, U.; Rasmussen, B.B.; Reinheimer, T.M.; Seegert, D.; et al. Evaluation of interleukin-6 and its soluble receptor components sIL-6R and sgp130 as markers of inflammation in inflammatory bowel diseases. Int. J. Color. Dis. 2018, 33, 927–936. [Google Scholar] [CrossRef] [PubMed]
- Keewan, E.; Naser, S.A. MiR-146a rs2910164 G > C polymorphism modulates Notch-1/IL-6 signaling during infection: A possible risk factor for Crohn’s disease. Gut Pathog. 2020, 12, 48. [Google Scholar] [CrossRef]
- Guo, Y.; Wang, B.; Wang, T.; Gao, L.; Yang, Z.J.; Wang, F.F.; Shang, H.W.; Hua, R.; Xu, J.D. Biological characteristics of IL-6 and related intestinal diseases. Int. J. Biol. Sci. 2021, 17, 204–219. [Google Scholar] [CrossRef]
- Alhendi, A.; Naser, S.A. In vitro neutralization of IL-6 receptor exacerbates damage to intestinal epithelial cells during Mycobacterium avium paratuberculosis infection. Front. Immunol. 2024, 15, 1412800. [Google Scholar] [CrossRef]
- Suzuki, T.; Yoshinaga, N.; Tanabe, S. Interleukin-6 (IL-6) regulates claudin-2 expression and tight junction permeability in intestinal epithelium. J. Biol. Chem. 2011, 286, 31263–231271. [Google Scholar] [CrossRef] [PubMed]
- Al-Sadi, R.; Ye, D.; Boivin, M.; Guo, S.; Hashimi, M.; Ereifej, L.; Ma, T.Y. Interleukin-6 modulation of intestinal epithelial tight junction permeability is mediated by JNK pathway activation of claudin-2 gene. PLoS ONE 2014, 9, e85345. [Google Scholar] [CrossRef]
- Tang, Y.; Forsyth, C.B.; Keshavarzian, A. New molecular insights into inflammatory bowel disease-induced diarrhea. Expert Rev. Gastroenterol. Hepatol. 2011, 5, 615–625. [Google Scholar] [CrossRef]
- Pawłowska-Kamieniak, A.; Krawiec, P.; Pac-Kożuchowska, E. Interleukin 6: Biological significance and role in inflammatory bowel diseases. Adv. Clin. Exp. Med. 2021, 30, 465–469. [Google Scholar] [CrossRef] [PubMed]
- Grivennikov, S.; Karin, E.; Terzic, J.; Mucida, D.; Yu, G.Y.; Vallabhapurapu, S.; Scheller, J.; Rose-John, S.; Cheroutre, H.; Eckmann, L.; et al. IL-6 and Stat3 are required for survival of intestinal epithelial cells and development of colitis-associated cancer. Cancer Cell 2009, 15, 103–113. [Google Scholar] [CrossRef]
- Li, Y.; de Haar, C.; Chen, M.; Deuring, J.; Gerrits, M.M.; Smits, R.; Xia, B.; Kuipers, E.J.; van der Woude, C.J. Disease-related expression of the IL6/STAT3/SOCS3 signalling pathway in ulcerative colitis and ulcerative colitis-related carcinogenesis. Gut 2010, 59, 227–235. [Google Scholar] [CrossRef]
- Komoda, H.; Tanaka, Y.; Honda, M.; Matsuo, Y.; Hazama, K.; Takao, T. Interleukin-6 levels in colorectal cancer tissues. World J. Surg. 1998, 22, 895–898. [Google Scholar] [CrossRef] [PubMed]
- Maihofner, C.; Charalambous, M.P.; Bhambra, U.; Lightfoot, T.; Geisslinger, G.; Gooderham, N.J.; Colorectal Cancer Group. Expression of cyclooxygenase-2 parallels expression of interleukin-1β, interleukin-6 and NF-κB in human colorectal cancer. Carcinogenesis 2003, 24, 665–671. [Google Scholar] [CrossRef] [PubMed]
- Nikiteas, N.I.; Tzanakis, N.; Gazouli, M.; Rallis, G.; Daniilidis, K.; Theodoropoulos, G.; Kostakis, A.; Peros, G. Serum IL-6, TNFα and CRP levels in Greek colorectal cancer patients: Prognostic implications. World J. Gastroenterol. 2005, 11, 1639–1643. [Google Scholar] [CrossRef]
- Mager, L.F.; Wasmer, M.H.; Rau, T.T.; Krebs, P. Cytokine-Induced Modulation of Colorectal Cancer. Front. Oncol. 2016, 6, 96. [Google Scholar] [CrossRef] [PubMed]
- Cui, G.; Yuan, A.; Sun, Z.; Zheng, W.; Pang, Z. IL-1β/IL-6 network in the tumor microenvironment of human colorectal cancer. Pathol. Res. Pract. 2018, 214, 986–992. [Google Scholar] [CrossRef]
- Świerczyński, M.; Szymaszkiewicz, A.; Fichna, J.; Zielińska, M. New insights into molecular pathways in colorectal cancer: Adiponectin, interleukin-6 and opioid signaling. Biochim. Biophys. Acta Rev. Cancer 2021, 1875, 188460. [Google Scholar] [CrossRef]
- Chung, Y.C.; Chang, Y.F. Serum interleukin-6 levels reflect the disease status of colorectal cancer. J. Surg. Oncol. 2003, 83, 222–226. [Google Scholar] [CrossRef]
- Esfandi, F.; Mohammadzadeh Ghobadloo, S.; Basati, G. Interleukin-6 level in patients with colorectal cancer. Cancer Lett. 2006, 244, 76–78. [Google Scholar] [CrossRef] [PubMed]
- Zeng, J.; Tang, Z.H.; Liu, S.; Guo, S.S. Clinicopathological significance of overexpression of interleukin-6 in colorectal cancer. World J. Gastroenterol. 2017, 23, 1780–1786. [Google Scholar] [CrossRef]
- Belluco, C.; Nitti, D.; Frantz, M.; Toppan, P.; Basso, D.; Plebani, M.; Lise, M.; Jessup, J.M. Interleukin-6 Blood Level Is Associated with Circulating Carcinoembryonic Antigen and Prognosis in Patients with Colorectal Cancer. Ann. Surg. Oncol. 2000, 7, 133–138. [Google Scholar] [CrossRef]
- Goodla, L.; Xue, X. The Role of Inflammatory Mediators in Colorectal Cancer Hepatic Metastasis. Cells 2022, 11, 2313. [Google Scholar] [CrossRef] [PubMed]
- Toyoshima, Y.; Kitamura, H.; Xiang, H.; Ohno, Y.; Homma, S.; Kawamura, H.; Takahashi, N.; Kamiyama, T.; Tanino, M.; Taketomi, A. IL6 Modulates the Immune Status of the Tumor Microenvironment to Facilitate Metastatic Colonization of Colorectal Cancer Cells. Cancer Immunol. Res. 2019, 7, 1944–1957. [Google Scholar] [CrossRef] [PubMed]
- Olsen, J.; Kirkeby, L.T.; Olsen, J.; Eiholm, S.; Jess, P.; Gögenur, I.; Troelsen, J.T. High interleukin-6 mRNA expression is a predictor of relapse in colon cancer. Anticancer Res. 2015, 35, 2235–2240. [Google Scholar] [PubMed]
- Kontoyiannis, D.; Pasparakis, M.; Pizarro, T.T.; Cominelli, F.; Kollias, G. Impaired on/off regulation of TNF biosynthesis in mice lacking TNF AU-rich elements: Implications for joint and gut-associated immunopathologies. Immunity 1999, 10, 387–398. [Google Scholar] [CrossRef]
- Komatsu, M.; Kobayashi, D.; Saito, K.; Furuya, D.; Yagihashi, A.; Araake, H.; Tsuji, N.; Sakamaki, S.; Niitsu, Y.; Watanabe, N. Tumor necrosis factor-alpha in serum of patients with inflammatory bowel disease as measured by a highly sensitive immuno-PCR. Clin. Chem. 2001, 47, 1297–1301. [Google Scholar] [CrossRef]
- Wang, J.; Fu, Y.X. Tumor necrosis factor family members and inflammatory bowel disease. Immunol. Rev. 2005, 204, 144–155. [Google Scholar] [CrossRef] [PubMed]
- Targan, S.R.; Hanauer, S.B.; van Deventer, S.J.; Mayer, L.; Present, D.H.; Braakman, T.; DeWoody, K.L.; Schaible, T.F.; Rutgeerts, P.J. A short-term study of chimeric monoclonal antibody cA2 to tumor necrosis factor alpha for Crohn’s disease. Crohn’s Disease cA2 Study Group. N. Engl. J. Med. 1997, 337, 1029–1035. [Google Scholar] [CrossRef]
- Hanauer, S.B.; Feagan, B.G.; Lichtenstein, G.R.; Mayer, L.F.; Schreiber, S.; Colombel, J.F.; Rachmilewitz, D.; Wolf, D.C.; Olson, A.; Bao, W.; et al. ACCENT I Study Group. Maintenance infliximab for Crohn’s disease: The ACCENT I randomised trial. Lancet 2002, 359, 1541–1549. [Google Scholar] [CrossRef]
- Järnerot, G.; Hertervig, E.; Friis-Liby, I.; Blomquist, L.; Karlén, P.; Grännö, C.; Vilien, M.; Ström, M.; Danielsson, A.; Verbaan, H.; et al. Infliximab as rescue therapy in severe to moderately severe ulcerative colitis: A randomized, placebo-controlled study. Gastroenterology 2005, 128, 1805–1811. [Google Scholar] [CrossRef]
- Nielsen, O.H.; Ainsworth, M.A. Tumor necrosis factor inhibitors for inflammatory bowel disease. N. Engl. J. Med. 2013, 369, 754–762. [Google Scholar] [CrossRef]
- Zidi, I.; Mestiri, S.; Bartegi, A.; Amor, N.B. TNF-α and its inhibitors in cancer. Med. Oncol. 2010, 27, 185–198. [Google Scholar] [CrossRef] [PubMed]
- Wang, H.; Wang, H.S.; Zhou, B.H.; Li, C.L.; Zhang, F.; Wang, X.F.; Zhang, G.; Bu, X.Z.; Cai, S.H.; Du, J. Epithelial-mesenchymal transition (EMT) induced by TNF-α requires AKT/GSK-3β-mediated stabilization of snail in colorectal cancer. PLoS ONE 2013, 8, e56664. [Google Scholar] [CrossRef] [PubMed]
- Al Obeed, O.A.; Alkhayal, K.A.; Al Sheikh, A.; Zubaidi, A.M.; Vaali-Mohammed, M.A.; Boushey, R.; Mckerrow, J.H.; Abdulla, M.H. Increased expression of tumor necrosis factor-α is associated with advanced colorectal cancer stages. World J. Gastroenterol. 2014, 20, 18390–18396. [Google Scholar] [CrossRef] [PubMed]
- Grimm, M.; Lazariotou, M.; Kircher, S.; Höfelmayr, A.; Germer, C.T.; von Rahden, B.H.; Waaga-Gasser, A.M.; Gasser, M. Tumor necrosis factor-α is associated with positive lymph node status in patients with recurrence of colorectal cancer-indications for anti-TNF-α agents in cancer treatment. Cell. Oncol. 2011, 34, 315–326. [Google Scholar] [CrossRef]
- Cahill, C.M.; Rogers, J.T. Interleukin (IL) 1β Induction of IL-6 Is Mediated by a Novel Phosphatidylinositol 3-Kinase-dependent AKT/IκB Kinase α Pathway Targeting Activator Protein-1. J. Biol. Chem. 2008, 283, 25900–25912. [Google Scholar] [CrossRef]
- Zhou, W.; Cao, Q.; Peng, Y.; Zhang, Q.J.; Castrillon, D.H.; DePinho, R.A.; Liu, Z.P. FoxO4 inhibits NF-κB and protects mice against colonic injury and inflammation. Gastroenterology 2009, 137, 1403–1414. [Google Scholar] [CrossRef]
- Trede, N.S.; Tsytsykova, A.V.; Chatila, T.; Goldfeld, A.E.; Geha, R.S. Transcriptional activation of the human TNF-α promoter by superantigen in human monocytic cells: Role of NF-κB. J. Immunol. 1995, 155, 902–908. [Google Scholar] [CrossRef]
- Simmen, S.; Cosin-Roger, J.; Melhem, H.; Maliachovas, N.; Maane, M.; Baebler, K.; Weder, B.; Maeyashiki, C.; Spanaus, K.; Scharl, M.; et al. Iron Prevents Hypoxia-Associated Inflammation Through the Regulation of Nuclear Factor-κB in the Intestinal Epithelium. Cell. Mol. Gastroenterol. Hepatol. 2019, 7, 339–355. [Google Scholar] [CrossRef]
- Okazaki, T.; Sakon, S.; Sasazuki, T.; Sakurai, H.; Doi, T.; Yagita, H.; Okumura, K.; Nakano, H. Phosphorylation of serine 276 is essential for p65 NF-κB subunit-dependent cellular responses. Biochem. Biophys. Res. Commun. 2003, 300, 807–812. [Google Scholar] [CrossRef]
- Vanden Berghe, W.; De Bosscher, K.; Boone, E.; Plaisance, S.; Haegeman, G. The nuclear factor-κB engages CBP/p300 and histone acetyltransferase activity for transcriptional activation of the interleukin-6 gene promoter. J. Biol. Chem. 1999, 274, 32091–32098. [Google Scholar] [CrossRef]
- Zhong, H.; Voll, R.E.; Ghosh, S. Phosphorylation of NF-κB p65 by PKA stimulates transcriptional activity by promoting a novel bivalent interaction with the coactivator CBP/p300. Mol. Cell 1998, 1, 661–671. [Google Scholar] [CrossRef] [PubMed]
- Vermeulen, L.; De Wilde, G.; Van Damme, P.; Vanden Berghe, W.; Haegeman, G. Transcriptional activation of the NF-κB p65 subunit by mitogen- and stress-activated protein kinase-1 (MSK1). EMBO J. 2003, 22, 1313–1324. [Google Scholar] [CrossRef] [PubMed]
- Gupta, S.K.; Vyavahare, S.; Duchesne Blanes, I.L.; Berger, F.; Isales, C.; Fulzele, S. Microbiota-derived tryptophan metabolism: Impacts on health, aging, and disease. Exp. Gerontol. 2023, 183, 112319. [Google Scholar] [CrossRef]
- Bolati, D.; Shimizu, H.; Higashiyama, Y.; Nishijima, F.; Niwa, T. Indoxyl sulfate induces epithelial-to-mesenchymal transition in rat kidneys and human proximal tubular cells. Am. J. Nephrol. 2011, 34, 318–323. [Google Scholar] [CrossRef]
- Adelibieke, Y.; Shimizu, H.; Muteliefu, G.; Bolati, D.; Niwa, T. Indoxyl sulfate induces endothelial cell senescence by increasing reactive oxygen species production and p53 activity. J. Ren. Nutr. 2012, 22, 86–89. [Google Scholar] [CrossRef]
- Shimizu, H.; Yisireyili, M.; Nishijima, F.; Niwa, T. Stat3 contributes to indoxyl sulfate-induced inflammatory and fibrotic gene expression and cellular senescence. Am. J. Nephrol. 2012, 36, 184–189. [Google Scholar] [CrossRef]
- Ichisaka, Y.; Yano, S.; Nishimura, K.; Niwa, T.; Shimizu, H. Indoxyl sulfate contributes to colorectal cancer cell proliferation and increased EGFR expression by activating AhR and Akt. Biomed. Res. 2024, 45, 57–66. [Google Scholar] [CrossRef]
- Chowdhury, M.M.I.; Tomii, A.; Ishii, K.; Tahara, M.; Hitsuda, Y.; Koto, Y.; Kurata, K.; Yuasa, K.; Nishimura, K.; Shimizu, H. TLR4 may be a novel indole-3-acetic acid receptor that is implicated in the regulation of CYP1A1 and TNFα expression depending on the culture stage of Caco-2 cells. Biosci. Biotechnol. Biochem. 2021, 85, 2011–2021. [Google Scholar] [CrossRef] [PubMed]
- Tomii, A.; Higa, M.; Naito, K.; Kurata, K.; Kobayashi, J.; Takei, C.; Yuasa, K.; Koto, Y.; Shimizu, H. Activation of the TLR4-JNK but not the TLR4-ERK pathway induced by indole-3-acetic acid exerts anti-proliferative effects on Caco-2 cells. Biosci. Biotechnol. Biochem. 2023, 87, 839–849. [Google Scholar] [CrossRef]
- Chowdhury, M.M.I.; Kurata, K.; Yuasa, K.; Koto, Y.; Nishimura, K.; Shimizu, H. Suppression of TNFα expression induced by indole-3-acetic acid is not mediated by AhR activation in Caco-2 cells. Biosci. Biotechnol. Biochem. 2021, 85, 902–906. [Google Scholar] [CrossRef]
- Karlin, D.A.; Mastromarino, A.J.; Jones, R.D.; Stroehlein, J.R.; Lorentz, O. Fecal skatole and indole and breath methane and hydrogen in patients with large bowel polyps or cancer. J. Cancer Res. Clin. Oncol. 1985, 109, 135–141. [Google Scholar] [CrossRef] [PubMed]
- Zgarbová, E.; Vrzal, R. Skatole: A thin red line between its benefits and toxicity. Biochimie 2023, 208, 1–12. [Google Scholar] [CrossRef] [PubMed]
- Yokoyama, M.T.; Carlson, J.R. Microbial metabolites of tryptophan in the intestinal tract with special reference to skatole. Am. J. Clin. Nutr. 1979, 32, 173–178. [Google Scholar] [CrossRef]
- Jantchou, P.; Morois, S.; Clavel-Chapelon, F.; Boutron-Ruault, M.C.; Carbonnel, F. Animal protein intake and risk of inflammatory bowel disease: The E3N prospective study. Am. J. Gastroenterol. 2010, 105, 2195–2201. [Google Scholar] [CrossRef]
- Maconi, G.; Ardizzone, S.; Cucino, C.; Bezzio, C.; Russo, A.G.; Bianchi Porro, G. Pre-illness changes in dietary habits and diet as a risk factor for inflammatory bowel disease: A case-control study. World J. Gastroenterol. 2010, 16, 4297–4304. [Google Scholar] [CrossRef]
- Takachi, R.; Tsubono, Y.; Baba, K.; Inoue, M.; Sasazuki, S.; Iwasaki, M.; Tsugane, S.; Japan Public Health Center-Based Prospective Study Group. Red meat intake may increase the risk of colon cancer in Japanese, a population with relatively low red meat consumption. Asia Pac. J. Clin. Nutr. 2011, 20, 603–612. [Google Scholar] [PubMed]
- Kurata, K.; Kawahara, H.; Nishimura, K.; Jisaka, M.; Yokota, K.; Shimizu, H. Skatole regulates intestinal epithelial cellular functions through activating aryl hydrocarbon receptors and p38. Biochem. Biophys. Res. Commun. 2019, 510, 649–655. [Google Scholar] [CrossRef]
- Kurata, K.; Ishii, K.; Koto, Y.; Naito, K.; Yuasa, K.; Shimizu, H. Skatole-induced p38 and JNK activation coordinately upregulates, whereas AhR activation partially attenuates TNFα expression in intestinal epithelial cells. Biosci. Biotechnol. Biochem. 2023, 87, 611–619. [Google Scholar] [CrossRef]
- Hitsuda, Y.; Koto, Y.; Kawahara, H.; Kurata, K.; Yoshikiyo, K.; Nishimura, K.; Hashiguchi, A.; Maseda, H.; Okano, K.; Sugiura, N.; et al. Increased Prorenin Expression in the Kidneys May Be Involved in the Abnormal Renal Function Caused by Prolonged Environmental Exposure to Microcystin-LR. Toxics 2024, 12, 547. [Google Scholar] [CrossRef]
- Ohgane, K.; Yoshioka, H. Quantification of gel bands by an image J macro, band/peak quantification tool. Protoc. IO 2019. [Google Scholar] [CrossRef]
- Penn, R.; Ward, B.J.; Strande, L.; Maurer, M. Review of synthetic human faeces and faecal sludge for sanitation and wastewater research. Water Res. 2018, 132, 222–240. [Google Scholar] [CrossRef] [PubMed]
- Hegyi, P.; Maléth, J.; Walters, J.R.; Hofmann, A.F.; Keely, S.J. Guts and Gall: Bile Acids in Regulation of Intestinal Epithelial Function in Health and Disease. Physiol. Rev. 2018, 98, 1983–2023. [Google Scholar] [CrossRef] [PubMed]
- Lai, L.; Liu, Y.; Zhang, Y.; Cao, Z.; Yin, Y.; Chen, X.; Jin, J.; Wu, S. Long-term spatiotemporal mapping in lacustrine environment by remote sensing: Review with case study, challenges, and future directions. Water Res. 2024, 267, 122457. [Google Scholar] [CrossRef] [PubMed]
- Fiorucci, S.; Carino, A.; Baldoni, M.; Santucci, L.; Costanzi, E.; Graziosi, L.; Distrutti, E.; Biagioli, M. Bile Acid Signaling in Inflammatory Bowel Diseases. Dig. Dis. Sci. 2021, 66, 674–693. [Google Scholar] [CrossRef]
- Hagio, M.; Shimizu, H.; Joe, G.H.; Takatsuki, M.; Shiwaku, M.; Xu, H.; Lee, J.Y.; Fujii, N.; Fukiya, S.; Hara, H.; et al. Diet supplementation with cholic acid promotes intestinal epithelial proliferation in rats exposed to γ-radiation. Toxicol. Lett. 2015, 232, 246–252. [Google Scholar] [CrossRef]
- Pucci, S.; Mazzarelli, P.; Sesti, F.; Boothman, D.A.; Spagnoli, L.G. Interleukin-6 affects cell death escaping mechanisms acting on Bax-Ku70-Clusterin interactions in human colon cancer progression. Cell Cycle 2009, 8, 473–481. [Google Scholar] [CrossRef]
- Monteleone, I.; Rizzo, A.; Sarra, M.; Sica, G.; Sileri, P.; Biancone, L.; MacDonald, T.T.; Pallone, F.; Monteleone, G. Aryl hydrocarbon receptor-induced signals up-regulate IL-22 production and inhibit inflammation in the gastrointestinal tract. Gastroenterology 2011, 141, 237–248, 248.e1. [Google Scholar] [CrossRef]
- Ikuta, T.; Kurosumi, M.; Yatsuoka, T.; Nishimura, Y. Tissue distribution of aryl hydrocarbon receptor in the intestine: Implication of putative roles in tumor suppression. Exp. Cell Res. 2016, 343, 126–134. [Google Scholar] [CrossRef]
- Yin, J.; Sheng, B.; Pu, A.; Han, B.; Yang, K.; Wang, Q.; Sun, L.; Yang, H. Keratinocyte Growth Factor Regulation of Aryl Hydrocarbon Receptor Activation in Colorectal Cancer Cells. Dig. Dis. Sci. 2016, 61, 444–452. [Google Scholar] [CrossRef]
- Venkateswaran, N.; Lafita-Navarro, M.C.; Hao, Y.H.; Kilgore, J.A.; Perez-Castro, L.; Braverman, J.; Borenstein-Auerbach, N.; Kim, M.; Lesner, N.P.; Mishra, P.; et al. MYC promotes tryptophan uptake and metabolism by the kynurenine pathway in colon cancer. Genes Dev. 2019, 33, 1236–1251. [Google Scholar] [CrossRef]
- Karasovám, M.; Procházková, J.; Tylichová, Z.; Fedr, R.; Ciganek, M.; Machala, M.; Dvořák, Z.; Vyhlídalová, B.; Zůvalová, I.; Ehrmann, J.; et al. Inhibition of Aryl Hydrocarbon Receptor (AhR) Expression Disrupts Cell Proliferation and Alters Energy Metabolism and Fatty Acid Synthesis in Colon Cancer Cells. Cancers 2022, 14, 4245. [Google Scholar] [CrossRef] [PubMed]
- Postal, B.G.; Ghezzal, S.; Aguanno, D.; André, S.; Garbin, K.; Genser, L.; Brot-Laroche, E.; Poitou, C.; Soula, H.; Leturque, A.; et al. AhR activation defends gut barrier integrity against damage occurring in obesity. Mol. Metab. 2020, 39, 101007. [Google Scholar] [CrossRef] [PubMed]
- Mann, K.K.; Matulka, R.A.; Lawrence, B.P.; Kerkvliet, N.I.; Sherr, D.H. The role of polycyclic aromatic hydrocarbon metabolism in dimethylbenz[a]anthracene-induced pre-B lymphocyte apoptosis. Toxicol. Appl. Pharmacol. 1999, 161, 10–22. [Google Scholar] [CrossRef]
- Yamaguchi, K.; Near, R.I.; Matulka, R.A.; Shneider, A.; Toselli, P.; Trombino, A.F.; Sherr, D.H. Activation of the aryl hydrocarbon receptor/transcription factor and stromal cell-dependent pre-B cell apoptosis. J. Immunol. 1997, 158, 2165–2173. [Google Scholar] [CrossRef]
- Jensen, B.A.; Leeman, R.J.; Schlezinger, J.J.; Sherr, D.H. Aryl hydrocarbon receptor (AhR) agonists suppress interleukin-6 expression by bone marrow stromal cells: An immunotoxicology study. Environ. Health 2003, 2, 16. [Google Scholar] [CrossRef] [PubMed]
- Adelibieke, Y.; Yisireyili, M.; Ng, H.Y.; Saito, S.; Nishijima, F.; Niwa, T. Indoxyl sulfate induces IL-6 expression in vascular endothelial and smooth muscle cells through OAT3-mediated uptake and activation of AhR/NF-κB pathway. Nephron Exp. Nephrol. 2014, 128, 1–8. [Google Scholar] [CrossRef]
- Henning, B.; Meerarani, P.; Slim, R.; Toberek, M.; Daugherty, A.; Silverstone, A.E.; Robertson, L.W. Proinflammatory properties of coplanar PCBs: In vitro and in vivo evidence. Toxicol. Appl. Pharmacol. 2002, 181, 174–183. [Google Scholar] [CrossRef]
- Nguyen, C.; Edgley, A.J.; Kelly, D.J.; Kompa, A.R. Aryl Hydrocarbon Receptor Inhibition Restores Indoxyl Sulfate-Mediated Endothelial Dysfunction in Rat Aortic Rings. Toxins 2022, 14, 100. [Google Scholar] [CrossRef]
- Zhang, Y.; Duan, C.; Wu, S.; Ma, J.; Liu, Y.; Li, W.; Wang, T.; Yang, L.; Cheng, K.; Zhuang, R. Knockout of IL-6 mitigates cold water-immersion restraint stress-induced intestinal epithelial injury and apoptosis. Front. Immunol. 2022, 13, 936689. [Google Scholar] [CrossRef]
- Taguchi, R.; Tanaka, S.; Joe, G.H.; Maseda, H.; Nomura, N.; Ohnishi, J.; Ishizuka, S.; Shimizu, H.; Miyazaki, H. Mucin 3 is involved in intestinal epithelial cell apoptosis via N-(3-oxododecanoyl)-L-homoserine lactone-induced suppression of Akt phosphorylation. Am. J. Physiol. Cell Physiol. 2014, 307, C162–C168. [Google Scholar] [CrossRef]
- Shimizu, H.; Baba, N.; Nose, T.; Taguchi, R.; Tanaka, S.; Joe, G.H.; Maseda, H.; Nomura, N.; Hagio, M.; Lee, J.Y.; et al. Activity of ERK regulates mucin 3 expression and is involved in undifferentiated Caco-2 cell death induced by 3-oxo-C12-homoserine lactone. Biosci. Biotechnol. Biochem. 2015, 79, 937–942. [Google Scholar] [CrossRef] [PubMed]
- Liu, D.; Wei, Y.; Liu, X.; Zhou, Y.; Jiang, L.; Yin, J.; Wang, F.; Hu, Y.; Nanjaraj Urs, A.N.; Liu, Y.; et al. Indoleacetate decarboxylase is a glycyl radical enzyme catalysing the formation of malodorant skatole. Nat. Commun. 2018, 9, 4224. [Google Scholar] [CrossRef] [PubMed]
Target Genes | GenBank Accession No. | Primers (5→3′) | Length (bp) | Product Length (bp) |
---|---|---|---|---|
IL-6 | NM_000600.5 | Fw: CCTGAACCTTCCAAAGATGGC | 21 | 75 |
Rv: TTCACCAGGCAAGTCTCCTCA | 21 | |||
TNF-α | NM_000594 | Fw: GAGGCCAAGCCCTGGTATG | 19 | 91 |
Rv: CGGGCCGATTGATCTCAGC | 19 | |||
CYP1A1 | NM_000499.5 | Fw: TTCTGAACTGCAAGTGCTGCAT | 20 | 94 |
Rv: ATCTGCTGCATCTGCTTG | 20 | |||
RPLP0 | NM_001002.4 | Fw: CGACCTGGAAGTCCAACTAC | 20 | 108 |
Rv: ATCTGCTGCATCTGCTTG | 18 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ishii, K.; Naito, K.; Tanaka, D.; Koto, Y.; Kurata, K.; Shimizu, H. Molecular Mechanisms of Skatole-Induced Inflammatory Responses in Intestinal Epithelial Caco-2 Cells: Implications for Colorectal Cancer and Inflammatory Bowel Disease. Cells 2024, 13, 1730. https://doi.org/10.3390/cells13201730
Ishii K, Naito K, Tanaka D, Koto Y, Kurata K, Shimizu H. Molecular Mechanisms of Skatole-Induced Inflammatory Responses in Intestinal Epithelial Caco-2 Cells: Implications for Colorectal Cancer and Inflammatory Bowel Disease. Cells. 2024; 13(20):1730. https://doi.org/10.3390/cells13201730
Chicago/Turabian StyleIshii, Katsunori, Kazuma Naito, Dai Tanaka, Yoshihito Koto, Koichi Kurata, and Hidehisa Shimizu. 2024. "Molecular Mechanisms of Skatole-Induced Inflammatory Responses in Intestinal Epithelial Caco-2 Cells: Implications for Colorectal Cancer and Inflammatory Bowel Disease" Cells 13, no. 20: 1730. https://doi.org/10.3390/cells13201730
APA StyleIshii, K., Naito, K., Tanaka, D., Koto, Y., Kurata, K., & Shimizu, H. (2024). Molecular Mechanisms of Skatole-Induced Inflammatory Responses in Intestinal Epithelial Caco-2 Cells: Implications for Colorectal Cancer and Inflammatory Bowel Disease. Cells, 13(20), 1730. https://doi.org/10.3390/cells13201730