Synergistic Steatosis Induction in Mice: Exploring the Interactions and Underlying Mechanisms between PFOA and Tributyltin
Abstract
1. Introduction
2. Materials and Methods
2.1. Animal Experiment
2.2. Histology
2.3. Liver Neutral Lipid Analysis
2.4. Plasma Analysis
2.5. Gene Expression Studies
2.6. Combinatorial Effects and Statistical Analysis
3. Results
3.1. Potentiation Effect on Steatosis Induction by Tributyltin and PFOA
3.2. Combined Effects of Tributyltin and PFOA on Lipid Accumulation in the Liver
3.3. Changes in Plasmatic Biochemical Profiles
3.4. Multiple Nuclear Receptor Modulations
3.5. The Cocktail Effect of PFOA and TBT on Genes Involved in Steatogenesis in the Liver
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Riazi, K.; Azhari, H.; Charette, J.H.; Underwood, F.E.; King, J.A.; Afshar, E.E.; Swain, M.G.; Congly, S.E.; Kaplan, G.G.; Shaheen, A.-A. The Prevalence and Incidence of NAFLD Worldwide: A Systematic Review and Meta-Analysis. Lancet Gastroenterol. Hepatol. 2022, 7, 851–861. [Google Scholar] [CrossRef] [PubMed]
- Kabbany, M.N.; Selvakumar, P.K.C.; Watt, K.; Lopez, R.; Akras, Z.; Zein, N.; Carey, W.; Alkhouri, N. Prevalence of Nonalcoholic Steatohepatitis-Associated Cirrhosis in the United States: An Analysis of National Health and Nutrition Examination Survey Data. Off. J. Am. Coll. Gastroenterol. ACG 2017, 112, 581–587. [Google Scholar] [CrossRef] [PubMed]
- Younossi, Z.M.; Golabi, P.; Paik, J.M.; Henry, A.; Van Dongen, C.; Henry, L. The Global Epidemiology of Nonalcoholic Fatty Liver Disease (NAFLD) and Nonalcoholic Steatohepatitis (NASH): A Systematic Review. Hepatology 2023, 77, 1335–1347. [Google Scholar] [CrossRef] [PubMed]
- Younossi, Z.M.; Golabi, P.; De Avila, L.; Paik, J.M.; Srishord, M.; Fukui, N.; Qiu, Y.; Burns, L.; Afendy, A.; Nader, F. The Global Epidemiology of NAFLD and NASH in Patients with Type 2 Diabetes: A Systematic Review and Meta-Analysis. J. Hepatol. 2019, 71, 793–801. [Google Scholar] [CrossRef] [PubMed]
- Younossi, Z.M.; Koenig, A.B.; Abdelatif, D.; Fazel, Y.; Henry, L.; Wymer, M. Global Epidemiology of Nonalcoholic Fatty Liver Disease—Meta-Analytic Assessment of Prevalence, Incidence, and Outcomes. Hepatology 2016, 64, 73–84. [Google Scholar] [CrossRef]
- Liebe, R.; Esposito, I.; Bock, H.H.; vom Dahl, S.; Stindt, J.; Baumann, U.; Luedde, T.; Keitel, V. Diagnosis and Management of Secondary Causes of Steatohepatitis. J. Hepatol. 2021, 74, 1455–1471. [Google Scholar] [CrossRef] [PubMed]
- Limei, E.; Zhang, S.; Jiang, X. Association between Perfluoroalkyl Substances Exposure and the Prevalence of Nonalcoholic Fatty Liver Disease in the Different Sexes: A Study from the National Health and Nutrition Examination Survey 2005–2018. Environ. Sci. Pollut. Res. Int. 2023, 30, 44292–44303. [Google Scholar] [CrossRef] [PubMed]
- Liu, Q.; Fan, G.; Bi, J.; Qin, X.; Fang, Q.; Wu, M.; Mei, S.; Wan, Z.; Lv, Y.; Song, L.; et al. Associations of Polychlorinated Biphenyls and Organochlorine Pesticides with Metabolic Dysfunction-Associated Fatty Liver Disease among Chinese Adults: Effect Modification by Lifestyle. Environ. Res. 2024, 240, 117507. [Google Scholar] [CrossRef]
- Rinella, M.E.; Lazarus, J.V.; Ratziu, V.; Francque, S.M.; Sanyal, A.J.; Kanwal, F.; Romero, D.; Abdelmalek, M.F.; Anstee, Q.M.; Arab, J.P.; et al. A Multisociety Delphi Consensus Statement on New Fatty Liver Disease Nomenclature. J. Hepatol. 2023, 79, 1542–1556. [Google Scholar] [CrossRef]
- Wahlang, B.; Beier, J.I.; Clair, H.B.; Bellis-Jones, H.J.; Falkner, K.C.; McClain, C.J.; Cave, M.C. Toxicant-Associated Steatohepatitis. Toxicol. Pathol. 2013, 41, 343–360. [Google Scholar] [CrossRef]
- Das, K.P.; Wood, C.R.; Lin, M.T.; Starkov, A.A.; Lau, C.; Wallace, K.B.; Corton, J.C.; Abbott, B.D. Perfluoroalkyl Acids-Induced Liver Steatosis: Effects on Genes Controlling Lipid Homeostasis. Toxicology 2017, 378, 37–52. [Google Scholar] [CrossRef] [PubMed]
- Armstrong, L.E.; Guo, G.L. Understanding Environmental Contaminants’ Direct Effects on Non-Alcoholic Fatty Liver Disease Progression. Curr. Environ. Health Rep. 2019, 6, 95–104. [Google Scholar] [CrossRef] [PubMed]
- Zuo, Z.; Chen, S.; Wu, T.; Zhang, J.; Su, Y.; Chen, Y.; Wang, C. Tributyltin Causes Obesity and Hepatic Steatosis in Male Mice. Environ. Toxicol. 2011, 26, 79–85. [Google Scholar] [CrossRef] [PubMed]
- Peng, S.; Yan, L.; Zhang, J.; Wang, Z.; Tian, M.; Shen, H. An Integrated Metabonomics and Transcriptomics Approach to Understanding Metabolic Pathway Disturbance Induced by Perfluorooctanoic Acid. J. Pharm. Biomed. Anal. 2013, 86, 56–64. [Google Scholar] [CrossRef] [PubMed]
- Lyssimachou, A.; Santos, J.G.; André, A.; Soares, J.; Lima, D.; Guimarães, L.; Almeida, C.M.R.; Teixeira, C.; Castro, L.F.C.; Santos, M.M. The Mammalian “Obesogen” Tributyltin Targets Hepatic Triglyceride Accumulation and the Transcriptional Regulation of Lipid Metabolism in the Liver and Brain of Zebrafish. PLoS ONE 2015, 10, e0143911. [Google Scholar] [CrossRef] [PubMed]
- Bertuloso, B.D.; Podratz, P.L.; Merlo, E.; de Araújo, J.F.P.; Lima, L.C.F.; de Miguel, E.C.; de Souza, L.N.; Gava, A.L.; de Oliveira, M.; Miranda-Alves, L.; et al. Tributyltin Chloride Leads to Adiposity and Impairs Metabolic Functions in the Rat Liver and Pancreas. Toxicol. Lett. 2015, 235, 45–59. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.; Sun, P.; Kong, T.; Yang, F.; Guan, W. Tributyltin Promoted Hepatic Steatosis in Zebrafish (Danio Rerio) and the Molecular Pathogenesis Involved. Aquat. Toxicol. 2016, 170, 208–215. [Google Scholar] [CrossRef] [PubMed]
- Cousins, I.T.; DeWitt, J.C.; Glüge, J.; Goldenman, G.; Herzke, D.; Lohmann, R.; Ng, C.A.; Scheringer, M.; Wang, Z. The High Persistence of PFAS Is Sufficient for Their Management as a Chemical Class. Environ. Sci. Process. Impacts 2020, 22, 2307–2312. [Google Scholar] [CrossRef] [PubMed]
- Cave, M.C.; Clair, H.B.; Hardesty, J.E.; Falkner, K.C.; Feng, W.; Clark, B.J.; Sidey, J.; Shi, H.; Aqel, B.A.; McClain, C.J.; et al. Nuclear Receptors and Nonalcoholic Fatty Liver Disease. Biochim. Biophys. Acta 2016, 1859, 1083–1099. [Google Scholar] [CrossRef]
- Ballestri, S.; Nascimbeni, F.; Romagnoli, D.; Baldelli, E.; Lonardo, A. The Role of Nuclear Receptors in the Pathophysiology, Natural Course, and Drug Treatment of NAFLD in Humans. Adv. Ther. 2016, 33, 291–319. [Google Scholar] [CrossRef]
- Delfosse, V.; Dendele, B.; Huet, T.; Grimaldi, M.; Boulahtouf, A.; Gerbal-Chaloin, S.; Beucher, B.; Roecklin, D.; Muller, C.; Rahmani, R.; et al. Synergistic Activation of Human Pregnane X Receptor by Binary Cocktails of Pharmaceutical and Environmental Compounds. Nat. Commun. 2015, 6, 8089. [Google Scholar] [CrossRef] [PubMed]
- Delfosse, V.; Huet, T.; Harrus, D.; Granell, M.; Bourguet, M.; Gardia-Parège, C.; Chiavarina, B.; Grimaldi, M.; Le Mével, S.; Blanc, P.; et al. Mechanistic Insights into the Synergistic Activation of the RXR-PXR Heterodimer by Endocrine Disruptor Mixtures. Proc. Natl. Acad. Sci. USA 2021, 118, e2020551118. [Google Scholar] [CrossRef] [PubMed]
- Dauwe, Y.; Mary, L.; Oliviero, F.; Grimaldi, M.; Balaguer, P.; Gayrard, V.; Mselli-Lakhal, L. Steatosis and Metabolic Disorders Associated with Synergistic Activation of the CAR/RXR Heterodimer by Pesticides. Cells 2023, 12, 1201. [Google Scholar] [CrossRef] [PubMed]
- Abe, T.; Takahashi, M.; Kano, M.; Amaike, Y.; Ishii, C.; Maeda, K.; Kudoh, Y.; Morishita, T.; Hosaka, T.; Sasaki, T.; et al. Activation of Nuclear Receptor CAR by an Environmental Pollutant Perfluorooctanoic Acid. Arch. Toxicol. 2017, 91, 2365–2374. [Google Scholar] [CrossRef] [PubMed]
- Murase, W.; Kubota, A.; Ikeda-Araki, A.; Terasaki, M.; Nakagawa, K.; Shizu, R.; Yoshinari, K.; Kojima, H. Effects of Perfluorooctanoic Acid (PFOA) on Gene Expression Profiles via Nuclear Receptors in HepaRG Cells: Comparative Study with in Vitro Transactivation Assays. Toxicology 2023, 494, 153577. [Google Scholar] [CrossRef] [PubMed]
- Bjork, J.A.; Butenhoff, J.L.; Wallace, K.B. Multiplicity of Nuclear Receptor Activation by PFOA and PFOS in Primary Human and Rodent Hepatocytes. Toxicology 2011, 288, 8–17. [Google Scholar] [CrossRef]
- Activation of RXR–PPAR Heterodimers by Organotin Environmental Endocrine Disruptors. Available online: https://www.embopress.org/doi/epdf/10.1038/embor.2009.8?src=getftr& (accessed on 27 November 2023).
- Lukowicz, C.; Ellero-Simatos, S.; Régnier, M.; Polizzi, A.; Lasserre, F.; Montagner, A.; Lippi, Y.; Jamin, E.L.; Martin, J.-F.; Naylies, C.; et al. Metabolic Effects of a Chronic Dietary Exposure to a Low-Dose Pesticide Cocktail in Mice: Sexual Dimorphism and Role of the Constitutive Androstane Receptor. Environ. Health Perspect. 2018, 126, 067007. [Google Scholar] [CrossRef] [PubMed]
- Foucquier, J.; Guedj, M. Analysis of Drug Combinations: Current Methodological Landscape. Pharmacol. Res. Perspect. 2015, 3, e00149. [Google Scholar] [CrossRef]
- Rizzati, V.; Briand, O.; Guillou, H.; Gamet-Payrastre, L. Effects of Pesticide Mixtures in Human and Animal Models: An Update of the Recent Literature. Chem. Biol. Interact. 2016, 254, 231–246. [Google Scholar] [CrossRef]
- Attema, B.; Janssen, A.W.F.; Rijkers, D.; van Schothorst, E.M.; Hooiveld, G.J.E.J.; Kersten, S. Exposure to Low-Dose Perfluorooctanoic Acid Promotes Hepatic Steatosis and Disrupts the Hepatic Transcriptome in Mice. Mol. Metab. 2022, 66, 101602. [Google Scholar] [CrossRef]
- Hui, Z.; Li, R.; Chen, L. The Impact of Exposure to Environmental Contaminant on Hepatocellular Lipid Metabolism. Gene 2017, 622, 67–71. [Google Scholar] [CrossRef] [PubMed]
- Louisse, J.; Rijkers, D.; Stoopen, G.; Janssen, A.; Staats, M.; Hoogenboom, R.; Kersten, S.; Peijnenburg, A. Perfluorooctanoic Acid (PFOA), Perfluorooctane Sulfonic Acid (PFOS), and Perfluorononanoic Acid (PFNA) Increase Triglyceride Levels and Decrease Cholesterogenic Gene Expression in Human HepaRG Liver Cells. Arch. Toxicol. 2020, 94, 3137–3155. [Google Scholar] [CrossRef] [PubMed]
- Li, R.; Zhang, Z.; Xuan, Y.; Wang, Y.; Zhong, Y.; Zhang, L.; Zhang, J.; Chen, Q.; Yu, S.; Yuan, J. HNF4A as a Potential Target of PFOA and PFOS Leading to Hepatic Steatosis: Integrated Molecular Docking, Molecular Dynamic and Transcriptomic Analyses. Chem. Biol. Interact. 2024, 390, 110867. [Google Scholar] [CrossRef] [PubMed]
- Schlezinger, J.J.; Puckett, H.; Oliver, J.; Nielsen, G.; Heiger-Bernays, W.; Webster, T.F. Perfluorooctanoic Acid Activates Multiple Nuclear Receptor Pathways and Skews Expression of Genes Regulating Cholesterol Homeostasis in Liver of Humanized PPARα Mice Fed an American Diet. Toxicol. Appl. Pharmacol. 2020, 405, 115204. [Google Scholar] [CrossRef] [PubMed]
- Schlezinger, J.J.; Hyötyläinen, T.; Sinioja, T.; Boston, C.; Puckett, H.; Oliver, J.; Heiger-Bernays, W.; Webster, T.F. Perfluorooctanoic Acid Induces Liver and Serum Dyslipidemia in Humanized PPARα Mice Fed an American Diet. Toxicol. Appl. Pharmacol. 2021, 426, 115644. [Google Scholar] [CrossRef] [PubMed]
- Nielsen, G.; Heiger-Bernays, W.J.; Schlezinger, J.J.; Webster, T.F. Predicting the Effects of Per- and Polyfluoroalkyl Substance Mixtures on Peroxisome Proliferator-Activated Receptor Alpha Activity In Vitro. Toxicology 2022, 465, 153024. [Google Scholar] [CrossRef] [PubMed]
- Xu, R.X.; Lambert, M.H.; Wisely, B.B.; Warren, E.N.; Weinert, E.E.; Waitt, G.M.; Williams, J.D.; Collins, J.L.; Moore, L.B.; Willson, T.M.; et al. A Structural Basis for Constitutive Activity in the Human CAR/RXRalpha Heterodimer. Mol. Cell 2004, 16, 919–928. [Google Scholar] [CrossRef] [PubMed]
- Yan, J.; Chen, B.; Lu, J.; Xie, W. Deciphering the Roles of the Constitutive Androstane Receptor in Energy Metabolism. Acta Pharmacol. Sin. 2015, 36, 62–70. [Google Scholar] [CrossRef] [PubMed]
- Zhou, J.; Febbraio, M.; Wada, T.; Zhai, Y.; Kuruba, R.; He, J.; Lee, J.H.; Khadem, S.; Ren, S.; Li, S.; et al. Hepatic Fatty Acid Transporter Cd36 Is a Common Target of LXR, PXR, and PPARγ in Promoting Steatosis. Gastroenterology 2008, 134, 556–567.e1. [Google Scholar] [CrossRef]
- Huang, Y.-Q.; Tang, Y.-X.; Qiu, B.-H.; Talukder, M.; Li, X.-N.; Li, J.-L. Di-2-Ethylhexyl Phthalate (DEHP) Induced Lipid Metabolism Disorder in Liver via Activating the LXR/SREBP-1c/PPARα/γ and NF-κB Signaling Pathway. Food Chem. Toxicol. 2022, 165, 113119. [Google Scholar] [CrossRef]
- Kojetin, D.J.; Matta-Camacho, E.; Hughes, T.S.; Srinivasan, S.; Nwachukwu, J.C.; Cavett, V.; Nowak, J.; Chalmers, M.J.; Marciano, D.P.; Kamenecka, T.M.; et al. Structural Mechanism for Signal Transduction in RXR Nuclear Receptor Heterodimers. Nat. Commun. 2015, 6, 8013. [Google Scholar] [CrossRef]
- Aranda, A.; Pascual, A. Nuclear Hormone Receptors and Gene Expression. Physiol. Rev. 2001, 81, 1269–1304. [Google Scholar] [CrossRef]
- Dawson, M.I.; Xia, Z. The Retinoid X Receptors and Their Ligands. Biochim. Biophys. Acta 2012, 1821, 21–56. [Google Scholar] [CrossRef]
- Vanden Heuvel, J.P.; Thompson, J.T.; Frame, S.R.; Gillies, P.J. Differential Activation of Nuclear Receptors by Perfluorinated Fatty Acid Analogs and Natural Fatty Acids: A Comparison of Human, Mouse, and Rat Peroxisome Proliferator-Activated Receptor-α, -β, and -γ, Liver X Receptor-β, and Retinoid X Receptor-α. Toxicol. Sci. 2006, 92, 476–489. [Google Scholar] [CrossRef]
- Peet, D.J.; Turley, S.D.; Ma, W.; Janowski, B.A.; Lobaccaro, J.-M.A.; Hammer, R.E.; Mangelsdorf, D.J. Cholesterol and Bile Acid Metabolism Are Impaired in Mice Lacking the Nuclear Oxysterol Receptor LXRα. Cell 1998, 93, 693–704. [Google Scholar] [CrossRef]
- Grefhorst, A.; Oosterveer, M.H.; Brufau, G.; Boesjes, M.; Kuipers, F.; Groen, A.K. Pharmacological LXR Activation Reduces Presence of SR-B1 in Liver Membranes Contributing to LXR-Mediated Induction of HDL-Cholesterol. Atherosclerosis 2012, 222, 382–389. [Google Scholar] [CrossRef]
- Mellor, C.L.; Steinmetz, F.P.; Cronin, M.T.D. The Identification of Nuclear Receptors Associated with Hepatic Steatosis to Develop and Extend Adverse Outcome Pathways. Crit. Rev. Toxicol. 2016, 46, 138–152. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Lambert, M.H.; Xu, H.E. Activation of Nuclear Receptors: A Perspective from Structural Genomics. Structure 2003, 11, 741–746. [Google Scholar] [CrossRef] [PubMed]



| Gene | Primer Sequence F | Primer Sequence R |
|---|---|---|
| Abcb11 | ACTTCTGTGGGAGAGCTCAATTC | GTCGGCAATGGCTTCATCAATTT |
| Acly | AAAGCTTGGCCTCGTCGG | GGGACGAAGGGTTCAATGAGA |
| Acox1 | AGACCCTGAAGAAATCATGTGG | AGGAACATGCCCAAGTGAAG |
| Agpat6 | CAGCTGTACAAGCCCTACACCA | AGCTTTACTACTACCACTTCGACGAAT |
| Cd36 | GTTAAACAAAGAGGTCCTTACACATACAG | AGTGAAGGCTCAAAGATGGC |
| Cpt1a | GAAGAAGAAGTTCATCCGATTCAAG | GATATCACACCCACCACCACG |
| Cyp2b10 | TTTCTGCCCTTCTCAACAGGAA | TGGACGTGAAGAAAAGGAACAAC |
| Cyp2c29 | GCTCAAAGCCTACTGTCA | CATGAGTGTAAATCGTCTCA |
| Cyp3a11 | TCACACACACAGTTGTAGGCAGAA | GTTTACGAGTCCCATATCGGTAGAG |
| Cyp4a10 | ATTAGTGAGAGTGAGGACAGCAACAG | CCAACCCGATTTGCAGACA |
| Cyp4a14 | TCAGTCTATTTCTGGTGCTGTTC | GAGCTCCTTGTCCTTCAGATGGT |
| Cyp7a1 | AGCAACTAAACAACCTGCCAGTACTA | GCCGCAGAGCCTCCTTG |
| Eci | GTTCACCATCAGCCTGGAGAAG | AGAAGATACCCGGGCATTCC |
| Elovl3 | GCCTCTCATCCTCTGGTCCT | TGCCATAAACTTCCACATCCT |
| Elovl6 | TCTGATGAACAAGCGAGCCA | TGGTCATCAGAATGTACAGCATGT |
| Fasn | AGTCAGCTATGAAGCAATTGTGGA | CACCCAGACGCCAGTGTTC |
| Lpl | ATGGCAAGCAACACAACCAG | TGTGGAAACCTCGGGCAG |
| Mttp | TCAGGAAGCTGTGTCAGAATGAAG | TTTCAAGTCCTCCCAGGATCA |
| Plin2 | CCATTTCTCAGCTCCACTCCAC | GTGTCGTCGTAGCCGATGC |
| Pnpla3 | ACGCGGTCACCTTCGTGT | AGCCCGTCTCTGATGCACTT |
| Pparg1 | GACCAACAGCCTGACGGG | TGAATATCAGTGGTTCACCGCTT |
| Scarb1 | TCCCTCATCAAGCAGCAGGT | ACCTCGTTTGGGTTGACCAC |
| Scd1 | CAGTGCCGCGCATCTCTAT | CAGCGGTACTCACTGGCAGA |
| Tbp | ACTTCGTGCAAGAAATGCTGAA | GCAGTTGTCCGTGGCTCTCT |
| Treatment | Body Weight (g) | Liver/Body Weight |
|---|---|---|
| DMSO | 24.80 ± 0.48 | 1.00 ± 0.027 |
| TBT | 24.22 ± 0.45 | 1.08 ± 0.050 |
| PFOA | 24.43 ± 0.40 | 1.28 ± 0.028 * |
| TBT + PFOA | 25.10 ± 0.54 | 1.39 ± 0.021 * |
| Triglycerides | Cholesteryl Esters | Cholesterol | ||||
|---|---|---|---|---|---|---|
| Treatment | Abundance% | Fold Change | Abundance% | Fold Change | Abundance% | Fold Change |
| DMSO | 3.3 ± 0.42 | 1.00 ± 0.128 | 0.078 ± 0.0069 | 1.00 ± 0.08 | 0.36 ± 0.024 | 1.00 ± 0.08 |
| TBT | 4.6 ± 0.97 | 1.39 ± 0.29 | 0.073 ± 0.0069 | 0.93 ± 0.08 | 0.34 ± 0.036 | 0.93 ± 0.10 |
| PFOA | 7.1 ± 0.62 | 2.17 ± 0.18 | 0.078 ± 0.0081 | 0.99 ± 0.10 | 0.37 ± 0.029 | 1.03 ± 0.08 |
| TBT + PFOA | 11.9 ± 1.99 *TP | 3.64 ± 0.60 *TP | 0.046 ± 0.0028 *TP | 0.58 ± 0.03*TP | 0.30 ± 0.02 | 0.84 ± 0.06 |
| Treatment | TBT | PFOA | TBT + PFOA |
|---|---|---|---|
| ALAT | 1.49 ± 0.218 | 2.09 ± 0.316 | 3.09 ± 0.576 * |
| ASAT | 1.04 ± 0.042 | 1.37 ± 0.222 | 1.18 ± 0.099 |
| TG | 0.77 ± 0.075 | 0.58 ± 0.047 * | 0.53 ± 0.013 * |
| FFA | 1.49 ± 0.210 | 1.56 ± 0.226 | 1.19 ± 0.056 |
| Cholesterol | 1.00 ± 0.075 | 0.88 ± 0.038 | 0.82 ± 0.025 |
| HDL | 1.06 ± 0.087 | 0.98 ± 0.043 | 0.96 ± 0.025 |
| LDL | 1.36 ± 0.064 * | 0.92 ± 0.106 | 0.77 ± 0.043 |
| Function | Gene | Protein |
|---|---|---|
| Lipogenesis | Fasn | Fatty acid synthase |
| Acly | ATP Citrate Lyase | |
| Scd1 | Stearoyl-CoA desaturase 1 | |
| Elovl3 | Fatty Acid Elongase 3 | |
| Elovl6 | Fatty Acid Elongase 6 | |
| Agpat6 | 1-acylglycerol-3-phosphate O-acyltransferase 6 | |
| Pnpla3 | Patatin-like phospholipase domain containing 3 | |
| Plin2 | Perilipin 2 | |
| β-oxydation | Acox1 | Peroxisomal acyl-coenzyme A oxidase 1 |
| Cpt1a | Carnitine palmitoyltransferase 1a | |
| Eci | Enoyl-CoA Delta Isomerase | |
| Lipid transport | Cd36 | Fatty acid translocase |
| Mttp | Microsomal triglyceride transfer protein | |
| Lpl | Lipoprotein lipase | |
| Cholesteryl ester import | Scarb1 | Scavenger receptor class B member 1 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Dauwe, Y.; Mary, L.; Oliviero, F.; Dubois, L.; Rousseau-Bacquie, E.; Gomez, J.; Gayrard, V.; Mselli-Lakhal, L. Synergistic Steatosis Induction in Mice: Exploring the Interactions and Underlying Mechanisms between PFOA and Tributyltin. Cells 2024, 13, 940. https://doi.org/10.3390/cells13110940
Dauwe Y, Mary L, Oliviero F, Dubois L, Rousseau-Bacquie E, Gomez J, Gayrard V, Mselli-Lakhal L. Synergistic Steatosis Induction in Mice: Exploring the Interactions and Underlying Mechanisms between PFOA and Tributyltin. Cells. 2024; 13(11):940. https://doi.org/10.3390/cells13110940
Chicago/Turabian StyleDauwe, Yannick, Lucile Mary, Fabiana Oliviero, Louise Dubois, Elodie Rousseau-Bacquie, Jelskey Gomez, Véronique Gayrard, and Laïla Mselli-Lakhal. 2024. "Synergistic Steatosis Induction in Mice: Exploring the Interactions and Underlying Mechanisms between PFOA and Tributyltin" Cells 13, no. 11: 940. https://doi.org/10.3390/cells13110940
APA StyleDauwe, Y., Mary, L., Oliviero, F., Dubois, L., Rousseau-Bacquie, E., Gomez, J., Gayrard, V., & Mselli-Lakhal, L. (2024). Synergistic Steatosis Induction in Mice: Exploring the Interactions and Underlying Mechanisms between PFOA and Tributyltin. Cells, 13(11), 940. https://doi.org/10.3390/cells13110940
