Functional Characterization of Rare Variants in OAT1/SLC22A6 and OAT3/SLC22A8 Urate Transporters Identified in a Gout and Hyperuricemia Cohort
Abstract
:1. Introduction
2. Materials and Methods
2.1. Subject
2.2. Clinical Investigations
2.3. PCR Amplification and Sequencing Analysis
2.4. Materials
2.5. Site-Directed Mutagenesis
2.6. Cell Maintenance and Lipofection
2.7. Uptake Studies
2.8. Microscopy
2.9. Immunoblotting
2.10. Statistical Analysis
3. Results
3.1. Subjects
3.2. Sequencing Analysis
3.3. Uptake Studies
3.4. Microscopy
3.5. Immunoblotting
3.6. Evolutionary Comparison
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
ABCG2 | ATP-binding cassette subfamily G, member 2 |
BMI | Body mass index |
FEUA | fractional excretion of uric acid |
IQR | Interquartile range |
NKT | Novel kidney transporter |
OAT1, OAT3 | Organic anion transporter |
SUA | Serum uric acid level |
URAT1 | Novel urate transporter 1 |
WT | Wild type |
HM | Homozygous mutation |
HT | Heterozygous mutation |
SNP | Single nucleotide polymorphism |
MAF | Minor allele frequency |
CDS | Coding DNA sequence |
References
- Enomoto, A.; Kimura, H.; Chairoungdua, A.; Shigeta, Y.; Jutabha, P.; Ho Cha, S.; Endou, H. Molecular identification of a renal urate–anion exchanger that regulates blood urate levels. Nature 2002, 417, 447–452. [Google Scholar] [CrossRef]
- Vitart, V.; Rudan, I.; Hayward, C.; Gray, N.K.; Floyd, J.; Palmer, C.N.; Wright, A.F. SLC2A9 is a newly identified urate transporter influencing serum urate concentration, urate excretion and gout. Nat. Genet. 2008, 40, 437. [Google Scholar] [CrossRef] [PubMed]
- Woodward, O.M.; Köttgen, A.; Coresh, J.; Boerwinkle, E.; Guggino, W.B.; Köttgen, M. Identification of a urate transporter, ABCG2, with a common functional polymorphism causing gout. Proc. Natl. Acad. Sci. USA 2009, 106, 10338–10342. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mancikova, A.; Krylov, V.; Hurba, O.; Sebesta, I.; Nakamura, M.; Ichida, K.; Stiburkova, B. Functional analysis of novel allelic variants in URAT1 and GLUT9 causing renal hypouricemia type 1 and 2. Clin. Exp. Nephrol. 2016, 20, 578–584. [Google Scholar] [CrossRef] [PubMed]
- Ichida, K.; Hosoyamada, M.; Kamatani, N.; Kamitsuji, S.; Hisatome, I.; Shibasaki, T.; Hosoya, T. Age and origin of the G774A mutation in SLC22A12 causing renal hypouricemia in Japanese. Clin. Genet. 2008, 74, 243–251. [Google Scholar] [CrossRef]
- Claverie-Martin, F.; Trujillo-Suarez, J.; Gonzalez-Acosta, H.; Aparicio, C.; Roldan ML, J.; Stiburkova, B.; Garcia-Nieto, V.M. URAT1 and GLUT9 mutations in Spanish patients with renal hypouricemia. Clin. Chim. Acta 2018, 481, 83–89. [Google Scholar] [CrossRef]
- Stiburkova, B.; Bohatá, J.; Pavelcová, K.; Tasic, V.; Plaseska-Karanfilska, D.; Cho, S.K.; Šaligová, J. Renal hypouricemia 1: Rare disorder as common disease in Eastern Slovakia roma population. Biomedicines 2021, 9, 1607. [Google Scholar] [CrossRef]
- Toyoda, Y.; Mančíková, A.; Krylov, V.; Morimoto, K.; Pavelcová, K.; Bohatá, J.; Stiburkova, B. Functional Characterization of Clinically-Relevant Rare Variants in ABCG2 Identified in a Gout and Hyperuricemia Cohort. Cells 2019, 8, 363. [Google Scholar] [CrossRef] [Green Version]
- Wang, Z.; Cui, T.; Ci, X.; Zhao, F.; Sun, Y.; Li, Y.; Liu, C. The effect of polymorphism of uric acid transporters on uric acid transport. J. Nephrol. 2019, 32, 177–187. [Google Scholar] [CrossRef]
- Eraly, S.A.; Vallon, V.; Rieg, T.; Gangoiti, A.J. Multiple organic anion transporters contribute to net renal excretion of uric acid. Physiol. Genom. 2008, 128, 180–191. [Google Scholar] [CrossRef] [Green Version]
- Cha, S.H.; Sekine, T.; Fukushima, J.I.; Kanai, Y.; Kobayashi, Y.; Goya, T.; Endou, H. Identification and characterization of human organic anion transporter 3 expressing predominantly in the kidney. Mol. Pharmacol. 2001, 59, 1277–1286. [Google Scholar] [CrossRef] [PubMed]
- Lopez-nieto, C.E.; You, G.; Bush, K.T.; Barros, E.J.G.; Beier, D.R.; Nigam, S.K. Molecular Cloning and Characterization of NKT, a Gene Product Related to the Organic Cation Transporter Family That Is Almost Exclusively Expressed in the Kidney. J. Biol. Chem. 1997, 272, 6471–6478. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sweet, D.H.; Wolff, N.A.; Pritchard, J.B. Expression cloning and characterization of ROAT1. The basolateral organic anion transporter in rat kidney. J. Biol. Chem. 1997, 272, 30088–30095. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hosoyamada, M.; Sekine, T.; Kanai, Y.; Endou, H. Molecular cloning and functional expression of a multispecific organic anion transporter from human kidney. Am. J. Physiol. Physiol. 1999, 276, F122–F128. [Google Scholar] [CrossRef]
- Eraly, S.A.; Vallon, V.; Vaughn, D.A.; Gangoiti, J.A.; Richter, K.; Nagle, M.; Nigam, S.K. Decreased renal organic anion secretion and plasma accumulation of endogenous organic anions in OAT1 knock-out mice. J. Biol. Chem. 2006, 281, 5072–5083. [Google Scholar] [CrossRef] [Green Version]
- Kaler, G.; Truong, D.M.; Khandelwal, A.; Nagle, M.; Eraly, S.A.; Swaan, P.W.; Nigam, S.K. Structural Variation Governs Substrate Specificity for Organic Anion Transporter (OAT) Homologs. J. Biol. Chem. 2007, 282, 23841–23853. [Google Scholar] [CrossRef] [Green Version]
- Ichida, K.; Hosoyamada, M.; Kimura, H.; Takeda, M.; Utsunomiya, Y.; Hosoya, T.; Endou, H. Urate transport via human PAH transporter hOAT1 and its gene structure. Kidney Int. 2003, 63, 143–155. [Google Scholar] [CrossRef] [Green Version]
- Hong, M.; Xu, W.; Yoshida, T.; Tanaka, K.; Wolff, D.J.; Zhou, F.; You, G. Human organic anion transporter hOAT1 forms homooligomers. J. Biol. Chem. 2005, 280, 32285–32290. [Google Scholar] [CrossRef] [Green Version]
- Omasits, U.; Ahrens, C.; Müller, S.; Wollscheid, B. Protter: Interactive protein feature visualization and integration with experimental proteomic data. Bioinformatics 2014, 30, 884–886. [Google Scholar] [CrossRef] [Green Version]
- Tanaka, K.; Xu, W.; Zhou, F.; You, G. Role of Glycosylation in the Organic Anion Transporter OAT1. J. Biol. Chem. 2004, 279, 14961–14966. [Google Scholar] [CrossRef] [Green Version]
- You, G.; Kuze, K.; Kohanski, R.A.; Amsler, K.; Henderson, S. Regulation of mOAT-mediated organic anion transport by okadaic acid and protein kinase C in LLC-PK1 cells. J. Biol. Chem. 2000, 275, 10278–10284. [Google Scholar] [CrossRef] [Green Version]
- Brady, K.P.; Dushkin, H.; Förnzler, D.; Koike, T.; Magner, F.; Her, H.; Beier, D.R. A novel putative transporter maps to the osteosclerosis (oc) mutation and is not expressed in the oc mutant mouse. Genomics 1999, 56, 254–261. [Google Scholar] [CrossRef] [PubMed]
- Sweet, D.H.; Miller, D.S.; Pritchard, J.B.; Fujiwara, Y.; Beier, D.R.; Nigam, S.K. Impaired organic anion transport in kidney and choroid plexus of organic anion transporter 3 (Oat3 (Slc22a8)) knockout mice. J. Biol. Chem. 2002, 277, 26934–26943. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hosoya, K.I.; Makihara, A.; Tsujikawa, Y.; Yoneyama, D.; Mori, S.; Terasaki, T.; Tachikawa, M. Roles of inner blood-retinal barrier organic anion transporter 3 in the vitreous/retina-to-blood efflux transport of p-aminohippuric acid, benzylpenicillin, and 6-mercaptopurine. J. Pharmacol. Exp. Ther. 2009, 329, 87–93. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Truong, D.M.; Kaler, G.; Khandelwal, A.; Swaan, P.W.; Nigam, S.K. Multi-level analysis of organic anion transporters 1, 3, and 6 reveals major differences in structural determinants of antiviral discrimination. J. Biol. Chem. 2008, 283, 8654–8663. [Google Scholar] [CrossRef] [Green Version]
- Sweet, D.H.; Chan, L.M.S.; Walden, R.; Yang, X.P.; Miller, D.S.; Pritchard, J.B. Organic anion transporter 3 (Slc22a8) is a dicarboxylate exchanger indirectly coupled to the Na+ gradient. Am. J. Physiol.-Ren. Physiol. 2003, 284, 763–769. [Google Scholar] [CrossRef] [Green Version]
- Bakhiya, N.; Bahn, A.; Burckhardt, G.; Wolff, N.A. Human organic anion transporter 3 (hOAT3) can operate as an exchanger and mediate secretory urate flux. Cell. Physiol. Biochem. 2003, 13, 249–256. [Google Scholar] [CrossRef]
- Kojima, R.; Sekine, T.; Kawachi, M.; Cha, S.H.O.; Suzuki, Y.; Endou, H. Immunolocalization of Multispecific Organic Anion Transporters, OAT1, OAT2, and OAT3, in Rat Kidney. J. Am. Soc. Nephrol. 2002, 13, 848–857. [Google Scholar] [CrossRef]
- Srimaroeng, C.; Cecile, J.P.; Walden, R.; Pritchard, J.B. Regulation of Renal Organic Anion Transporter 3 (SLC22A8) Expression and Function by the Integrity of Lipid Raft Domains and their Associated Cytoskeleton. Cell Physiol. Biochem. 2013, 31, 565–578. [Google Scholar] [CrossRef]
- Stiburkova, B.; Pavelcova, K.; Pavlikova, M.; Ješina, P.; Pavelka, K. The impact of dysfunctional variants of ABCG2 on hyperuricemia and gout in pediatric-onset patients. Arthritis Res. Ther. 2019, 21, 77. [Google Scholar] [CrossRef] [Green Version]
- Wallace, S.L.; Robinson, H.; Masi, A.T.; Decker, J.L.; Mccarty, D.J.; Yü, T.F. Preliminary criteria for the classification of the acute arthritis of primary gout. Arthritis Rheum. 1977, 20, 895–900. [Google Scholar] [CrossRef] [PubMed]
- Stiburkova, B.; Krijt, J.; Vyletal, P.; Bartl, J.; Gerhatova, E.; Korinek, M.; Sebesta, I. Novel mutations in xanthine dehydrogenase/oxidase cause severe hypouricemia: Biochemical and molecular genetic analysis in two Czech families with xanthinuria type I. Clin. Chim. Acta 2012, 413, 93–99. [Google Scholar] [CrossRef] [PubMed]
- Pavelcova, K.; Bohata, J.; Pavlikova, M.; Bubenikova, E.; Pavelka, K.; Stiburkova, B. Evaluation of the influence of genetic variants of slc2a9 (Glut9) and slc22a12 (urat1) on the development of hyperuricemia and gout. J. Clin. Med. 2020, 9, 2510. [Google Scholar] [CrossRef]
- Howe, K.L.; Achuthan, P.; Allen, J.; Allen, J.; Alvarez-Jarreta, J.; Amode, M.R.; Flicek, P. Ensembl 2021. Nucleic Acids Res. 2021, 49, D884–D891. [Google Scholar] [CrossRef] [PubMed]
- The UniProt Consortium. UniProt: The universal protein knowledgebase in 2021. Nucleic Acids Res. 2021, 49, D480–D489. [Google Scholar] [CrossRef] [PubMed]
- Bleasby, K.; Hall, L.A.; Perry, J.L.; Mohrenweiser, H.W.; Pritchard, J.B. Functional consequences of single nucleotide polymorphisms in the human organic anion transporter hOAT1 (SLC22A6). J. Pharmacol. Exp. Ther. 2005, 314, 923–931. [Google Scholar] [CrossRef] [Green Version]
- Wright, S.H.; Dantzler, W.H. Molecular and cellular physiology of organic cation transporter. Physiol. Rev. 2004, 84, 987–1049. [Google Scholar] [CrossRef]
- Fujita, T.; Brown, C.; Carlson, E.J.; Taylor, T.; de la Cruz, M.; Johns, S.J.; Giacomini, K.M. Functional analysis of polymorphisms in the organic anion transporter, SLC22A6 (OAT1). Pharmacogenet. Genom. 2005, 15, 201–209. [Google Scholar] [CrossRef]
- Erdman, A.R.; Mangravite, L.M.; Urban, T.J.; Lagpacan, L.L.; Castro, R.A.; de la Cruz, M.; Giacomini, K.M. The human organic anion transporter 3 (OAT3; SLC22A8): Genetic variation and functional genomics. Am. J. Physiol.-Ren. Physiol. 2006, 290, 905–912. [Google Scholar] [CrossRef] [Green Version]
- Horváthová, V.; Bohatá, J.; Pavlíková, M.; Pavelcová, K.; Pavelka, K.; Šenolt, L.; Stibůrková, B. Interaction of the p.Q141K variant of the ABCG2 gene with clinical data and cytokine levels in primary hyperuricemia and gout. J. Clin. Med. 2019, 8, 1965. [Google Scholar] [CrossRef] [Green Version]
- Stiburkova, B.; Pavelcova, K.; Zavada, J.; Petru, L.; Simek, P.; Cepek, P.; Pavelka, K. Functional non-synonymous variants of ABCG2 and gout risk. Rheumatology 2017, 56, 1982–1992. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Toyoda, Y.; Pavelcová, K.; Klein, M.; Suzuki, H.; Takada, T.; Stiburkova, B. Familial early-onset hyperuricemia and gout associated with a newly identified dysfunctional variant in urate transporter ABCG2. Arthritis Res. Ther. 2019, 21, 19–21. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hurba, O.; Mancikova, A.; Krylov, V.; Pavlikova, M.; Pavelka, K.; Stiburková, B. Complex analysis of urate transporters SLC2A9, SLC22A12 and functional characterization of non-synonymous allelic variants of GLUT9 in the Czech population: No evidence of effect on hyperuricemia and gout. PLoS ONE 2014, 9, e107902. [Google Scholar] [CrossRef] [PubMed]
- Chiba, T.; Matsuo, H.; Kawamura, Y.; Nagamori, S.; Nishiyama, T.; Wei, L.; Shinomiya, N. NPT1/SLC17A1 is a renal urate exporter in humans and its common gain-of-function variant decreases the risk of renal underexcretion gout. Arthritis Rheumatol. 2015, 67, 281–287. [Google Scholar] [CrossRef] [PubMed]
- Jutabha, P.; Anzai, N.; Kimura, T.; Taniguchi, A.; Urano, W.; Yamanaka, H.; Sakurai, H. Functional analysis of human sodium-phosphate transporter 4 (NPT4/SLC17A3) polymorphisms. J. Pharmacol. Sci. 2011, 115, 249–253. [Google Scholar] [CrossRef] [Green Version]
- Stiburkova, B.; Bleyer, A.J. Changes in Serum Urate and Urate Excretion with Age. Adv. Chronic Kidney Dis. 2012, 19, 372–376. [Google Scholar] [CrossRef]
Allelic Variant | Forward (5′ to 3′) | Reverse (5′ to 3′) |
---|---|---|
OAT1 p.P104L | GGGCCACAGAGCTCTGCACCGATGGCTGGATC | GATCCAGCCATCGGTGCAGAGCTCTGTGGCCC |
OAT1 p.A190T | CCCATCTACTGCACCTTCCGGCTCCTCTCGG | CCGAGAGGAGCCGGAAGGTGCAGTAGATGGG |
OAT3 p.V448I | CAAACAGGTATGGGCATAAGTAACCTGTGGAC | GTCCACAGGTTACTTATGCCCATACCTGTTTG |
OAT3 p.R513Q | GAAAACTGGTCCCTGCAGGCAAAGAAGCCAAAG | CTTTGGCTTCTTTGCCTGCAGGGACCAGTTTTC |
OAT3 p.R149C | GTCTGACAGGTTTGGCTGCAGGCCCATCCTGAC | GTCAGGATGGGCCTGCAGCCAAACCTGTCAGAC |
Characteristic | All Patients | Gout Patients | Hyperuricemia Patients | p-Value | |||||||
---|---|---|---|---|---|---|---|---|---|---|---|
(N = 150) | (N = 114) | (N = 36) | # | ||||||||
N | % | N | % | N | % | ||||||
Gender | Male | 121 | 80.7 | 100 | 87.7 | 21 | 58.3 | 0.0004 | |||
Female | 29 | 19.3 | 14 | 12.3 | 15 | 41.7 | |||||
Familial occurrence | 42 | 28 | 35 | 30.7 | 7 | 19.4 | 0.2097 | ||||
(29 *) | (22.6 *) | ||||||||||
Characteristic | N | Median | Range | N | Median | Range | N | Median | Range | p-Value | |
(IQR) | (IQR) | (IQR) | † | ||||||||
Age at examination [years] | 150 | 59 | 3–80 | 114 | 59 | 30–80 | 36 | 55.5 | 3–78 | 0.13335 | |
21 | 19 | 34.3 | |||||||||
BMI at examination | 108 | 29.1 | 16–43.4 | 80 | 29 | 20.6–43.4 | 28 | 30.1 | 16–37.5 | 0.7391 | |
5.3 | 5.4 | 5.1 | |||||||||
Gout/hyperuricemia onset [years] | 125 | 45 | 13–77 | 112 | 45 | 18–77 | 13 | 48 | 13–70 | 0.4025 | |
23 | 21.3 | 36 | |||||||||
SUA at examination, with medication [µmol/L, (mg/dL)] | 137 | 373(6.2) | 163–725 (2.7–12.1) | 107 | 371(6.2) | 163–725 (2.7–12.1) | 30 | 411(6.9) | 240–628 (4.0–10.5) | 0.1197 | |
123(2.1) | 118(1.9) | 155.3(2.5) | |||||||||
FEUA at examination, with medication | 135 | 3.4 | 0.9–11.8 | 107 | 3.4 | 0.9–11.8 | 28 | 3.5 | 1.3–8.4 | 0.974 | |
2.1 | 2 | 2.2 |
Gene | Reference SNP Number | Position CDS | Position aa | Variant Allele Hetero/Homozygotes | Allelic Variant MAF | Normo-Uricemia Control MAF | European MAF |
---|---|---|---|---|---|---|---|
SLC22A6 | rs11568627 | c.311C>T | p.P104L | 2/0 | 0.007 | 0.01 | 0.005 |
SLC22A6 | rs146282438 | c.568G>A | p.A190T | 1/0 | 0.004 | 0 | 0 |
SLC22A8 | rs45566039 | c.445C>T | p.R149C | 1/0 | 0.003 | 0 | 0 |
SLC22A8 | rs11568486 | c.1342G>A | p.V448I | 2/0 | 0.007 | 0.005 | 0.015 |
SLC22A8 | rs145474422 | c.1538G>A | p.R513Q | 2/0 | 0.007 | 0.01 | 0.003 |
Variants in SLC22A6/SLC22A8 (Patient Identification) | Gender | Diagnosis | Familial Occurrence | Age at Examination [years] | Gout/ Hyper- Uricemia Onset [years] | BMI at Examination | SUA without Medi- cation [µmol/L] | SUA with Medi- cation [µmol/L] | FEUA without Medi- cation | FEUA with Medi- cation | GFR (mL/ min/ 1.73 m2) |
---|---|---|---|---|---|---|---|---|---|---|---|
p.P104L (patient 1) | male | gout | no | 60 | 60 | N/A | N/A | 451 | N/A | 7.4 | N/A |
p.P104L (patient 2) | male | hyperuricemia | yes | 59 | 18 | 30.4 | 492 | 419 | 5.2 | 5.5 | 72 |
p.A190T (patient 3) | male | hyperuricemia | yes | 11 | 10 | 20 | N/A | 367 | N/A | 4.9 | N/A |
p.R149C (patient 4) | female | gout | no | 73 | 73 | 32.3 | 683 | N/A | 0.8 | N/A | 47 |
p.V448I (patient 5) | male | gout | no | 30 | 30 | 30.8 | 587 | 406 | 3 | 2.1 | 102 |
p.V448I (patient 6) | male | hyperuricemia | N/A | 48 | N/A | N/A | N/A | 426 | N/A | 3.3 | N/A |
p.V448I (patient 7) | male | hyperuricemia | yes | 14 | 13 | 24.3 | N/A | 435 | N/A | 3.7 | N/A |
p.R513Q (patient 8) | male | gout | no | 74 | 41 | 29.7 | 484 | 373 | 4.2 | 3.4 | 79 |
p.R513Q (patient 9) | female | hyperuricemia | yes | 11 | 6 | 25.5 | 433 | N/A | 4.6 | 2.1 | 146 |
p.R513Q (patient 10) | male | hyperuricemia | yes | 14 | 14 | 21.8 | 371 | N/A | 3.6 | N/A | 150 |
p.R513Q (patient 11) | male | gout | no | 34 | 25 | N/A | N/A | 284 | N/A | 2.3 | N/A |
Variants in Other Genes | Gene | ABCG2 | SLC2A9 | SLC2A9 | SLC2A9 | SLC2A9 | SLC2A9 | SLC22A13 |
---|---|---|---|---|---|---|---|---|
Reference SNP Number | rs2231142 | rs2276961 | rs16890979 | rs73225891 | rs2280205 | rs6820230 | rs72542450 | |
AA Change | p.Q141K | p.G25R | p.V282I | p.D281H | p.P350L | p.A17T | p.R16H | |
variants in SLC22A6/ SLC22A8 | p.P104L (patient 1) | HT | wt | HT | HT | wt | wt | wt |
p.P104L (patient 2) | HT | HT | wt | wt | HT | wt | wt | |
p.A190T (patient 3) | wt | HM | wt | wt | HT | wt | wt | |
p.R149C (patient 4) | wt | HM | wt | wt | HM | wt | HT | |
p.V448I (patient 5) | wt | HT | HT | wt | HT | wt | wt | |
p.V448I (patient 6) | wt | HT | HT | wt | wt | wt | wt | |
p.V448I (patient 7) | wt | HM | wt | wt | HM | wt | wt | |
p.R513Q (patient 8) | wt | wt | wt | wt | wt | HM | wt | |
p.R513Q (patient 9) | HT | HM | wt | wt | HM | wt | wt | |
p.R513Q (patient 10) | wt | HM | wt | wt | HM | wt | wt | |
p.R513Q (patient 11) | HT | HT | wt | wt | HT | wt | wt | |
variants in other genes | Gene | SLC17A1 | SLC17A3 | SLC17A3 | SLC17A3 | ABCC4 | ABCC4 | ABCC4 |
Reference SNP Number | rs1165196 | rs56027330 | rs1165165 | rs56027330 | rs2274406 | rs1678339 | rs1751034 | |
AA Change | p.T269I | p.G70R | p.A100T | p.G279R | p.R317S | p.L904F | p.K1116N | |
variants in SLC22A6/ SLC22A8 | p.P104L (patient 1) | HT | wt | HT | HT | HT | wt | HM |
p.P104L (patient 2) | wt | wt | HM | HM | HT | HM | wt | |
p.A190T (patient 3) | HM | HT | wt | wt | HM | HM | wt | |
p.R149C (patient 4) | HT | wt | wt | wt | HT | HM | wt | |
p.V448I (patient 5) | wt | wt | HM | HT | wt | HM | wt | |
p.V448I (patient 6) | HT | wt | wt | wt | HM | wt | HM | |
p.V448I (patient 7) | HM | HT | wt | wt | HM | HM | wt | |
p.R513Q (patient 8) | HT | wt | HT | wt | HT | HM | wt | |
p.R513Q (patient 9) | wt | wt | wt | wt | HM | HM | wt | |
p.R513Q (patient 10) | HT | HT | HT | wt | wt | HM | wt | |
p.R513Q (patient 11) | wt | wt | wt | wt | HT | wt | HT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Vávra, J.; Mančíková, A.; Pavelcová, K.; Hasíková, L.; Bohatá, J.; Stibůrková, B. Functional Characterization of Rare Variants in OAT1/SLC22A6 and OAT3/SLC22A8 Urate Transporters Identified in a Gout and Hyperuricemia Cohort. Cells 2022, 11, 1063. https://doi.org/10.3390/cells11071063
Vávra J, Mančíková A, Pavelcová K, Hasíková L, Bohatá J, Stibůrková B. Functional Characterization of Rare Variants in OAT1/SLC22A6 and OAT3/SLC22A8 Urate Transporters Identified in a Gout and Hyperuricemia Cohort. Cells. 2022; 11(7):1063. https://doi.org/10.3390/cells11071063
Chicago/Turabian StyleVávra, Jiří, Andrea Mančíková, Kateřina Pavelcová, Lenka Hasíková, Jana Bohatá, and Blanka Stibůrková. 2022. "Functional Characterization of Rare Variants in OAT1/SLC22A6 and OAT3/SLC22A8 Urate Transporters Identified in a Gout and Hyperuricemia Cohort" Cells 11, no. 7: 1063. https://doi.org/10.3390/cells11071063
APA StyleVávra, J., Mančíková, A., Pavelcová, K., Hasíková, L., Bohatá, J., & Stibůrková, B. (2022). Functional Characterization of Rare Variants in OAT1/SLC22A6 and OAT3/SLC22A8 Urate Transporters Identified in a Gout and Hyperuricemia Cohort. Cells, 11(7), 1063. https://doi.org/10.3390/cells11071063