Next Article in Journal
A Study on the Infrageneric Classification of Hordeum Using Multiple Methods: Based on Morphological Data
Previous Article in Journal
Regulation of Pear Fruit Quality: A Review Based on Chinese Pear Varieties
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Effects of Soil Disinfection Using Chlorine Dioxide on Soil Fungal Communities in Apple Replant Fields and the Growth of Malus hupehensis Rehd. Seedlings

1
College of Agricultural Science and Technology, Shandong Agriculture and Engineering University, Jinan 251100, China
2
College of Horticultural Science and Engineering, Shandong Agricultural University, Tai’an 271018, China
*
Authors to whom correspondence should be addressed.
Agronomy 2025, 15(1), 59; https://doi.org/10.3390/agronomy15010059
Submission received: 3 December 2024 / Revised: 23 December 2024 / Accepted: 27 December 2024 / Published: 29 December 2024
(This article belongs to the Special Issue Disease Management in Orchards)

Abstract

:
The effectiveness of chlorine dioxide as a soil disinfectant for the prevention and control of apple replant disease (ARD) remains largely unexplored. This study aimed to determine the optimal concentration of chlorine dioxide for soil disinfection and to evaluate its impact on the prevention and control of ARD. The experimental results indicated that a high concentration of 600 mg·L−1 chlorine dioxide exhibited a potent lethal effect on both the hyphae and spores of pathogenic Fusarium. Results from pot experiments demonstrated that, compared with the replant control, the height, ground diameter, fresh weight, and dry weight of Malus hupehensis Rehd. seedlings treated with 600 mg·L−1 chlorine dioxide increased by 27.20%, 15.95%, 100.70%, and 76.28%, respectively. Additionally, the root length, surface area, volume, and number of root tips of the seedlings increased by 31.74%, 96.54%, 257.29%, and 85.29%, respectively. The activities of root-protective enzymes, including superoxide dismutase (SOD), catalase (CAT), and peroxidase (POD), also increased to varying degrees, whereas the malondialdehyde (MDA) content was significantly reduced compared with the control treatment. Furthermore, the number of soil fungi treated with chlorine dioxide and the concentration of phenolic acid compounds in replant soil were significantly reduced. Treatment with 600 mg·L−1 chlorine dioxide significantly decreased the detected copy number of genes associated with soil-borne pathogenic Fusarium, optimized the soil microbial community structure, and reduced the relative abundance of pathogenic fungi. In summary, disinfection of replant soil using 600 mg·L−1 chlorine dioxide can enhance the growth of M. hupehensis Rehd. seedlings, inhibit the growth and reproduction of pathogenic Fusarium fungi, improve the soil environment, and effectively prevent and control ARD.

1. Introduction

In recent years, the rapid development of the fruit industry in China has led to an increase in the annual planting of fruit trees and the renewal of old orchards, resulting in more severe soil replant diseases [1]. Apple trees, which occupy the largest planting area in northern China, are significantly affected by apple replant disease (ARD), leading to reduced yield and low quality. Trees afflicted with this disease exhibit stunted growth, low survival rates, and increased susceptibility to other diseases [2]. Therefore, it is crucial to explore effective methods and strategies for preventing and controlling soil plant diseases in apples. The increase in pathogenic fungi in soil [3], imbalance of microbial community structure, secretion of autotoxic allelopathic substances by plant roots, such as phenols and alkaloids [4], and imbalance of soil nutrients are all significant contributors to ARD. Fusarium is the primary pathogen responsible for ARD in China and its abundance has increased significantly during ARD outbreaks in the main apple-producing regions of China [5]. Multiple strains of Fusarium isolated from areas severely affected by ARD exhibit strong pathogenic effects on apples [6]. Among these, F. proliferatum MR5 has been identified as a specific ARD pathogen that infects apple rootstocks [7]. In addition, an abnormal increase in the concentration of soil phenolic acids, such as phloridzin, phloretin, and benzoic acid, in replant soil can contribute to the development of ARD, and a reduction in the levels of phenolic acids, particularly phloridzin, can effectively mitigate the symptoms of ARD [8,9]. Therefore, the primary cause of ARD is the increased abundance of harmful pathogens and autotoxic substances in the soil. Current research explores various methods for the prevention and control of ARD. Soil disinfection and biological control strategies have been shown to effectively alleviate ARD [9,10]. The soil fumigant, methyl bromide, is highly effective in eradicating soil microorganisms and reducing the incidence of ARD. However, it is banned worldwide because of environmental pollution, carcinogenic properties, and other concerns. Consequently, it is crucial to develop new, highly efficient, and low-toxicity soil chemical fumigants to replace methyl bromide [11,12].
Chlorine dioxide is an internationally recognized environment-friendly disinfectant that offers high efficiency, a broad spectrum of activity, no pollution, and no residue. It has long been classified as a Class A1 high-efficiency and safe disinfectant by the World Health Organization [13]. Chlorine dioxide is widely used because of its fungicidal and disinfecting properties, which are attributed to its exceptional oxidizing properties [14]. Importantly, it does not interfere with the normal physiological processes of plants and animals, which are structurally distinct from those of bacteria [15]. Recent research has identified alterations in the structure of soil microbial communities, a decline in the relative abundance of beneficial bacteria, and an increase in the relative abundance of pathogenic fungi as the primary contributors to ARD [16]. Changes in the relative abundance of microorganisms and pathogens, which are advantageous to soil health, can disrupt the structure and function of protist communities, ultimately reducing plant resistance [17]. Chlorine dioxide is a highly effective disinfectant, known for its strong oxidizing properties. It plays a crucial role in various applications, including medicine, health, food preservation, disinfection, and sterilization of tap water [17], paper, and equipment. The mechanism of action of chlorine dioxide primarily involves protein denaturation [18]. It can undergo reduction reactions with specific amino acids, such as proline, tryptophan, and methionine, altering the activity of key enzymes in the pentose phosphate pathway and disrupting the normal sugar metabolism of microorganisms, which leads to sterilization [19]. Additionally, chlorine dioxide disinfectants can affect cellular structures by increasing the permeability of cell membranes [20]. When cell membrane permeability increases, small molecules, such as ions and ATP, can leak out in significant quantities, altering the osmotic pressure within the cells and ultimately resulting in cell death.
In actual production, chlorine dioxide is primarily used for air and surface disinfection; however, there are limited studies on its application in soil sterilization and disinfection. Currently, no reports have indicated whether chlorine dioxide can enhance replant soil, promote seedling growth, or alleviate ARD. This study examined the inhibitory effect of chlorine dioxide on the growth and spore germination of Fusarium, explored the optimal bactericidal concentration, and conducted both potted and field experiments to investigate the effect of chlorine dioxide on the growth of Malus hupehensis Rehd. seedlings and the structure of the soil microbial communities.

2. Materials and Methods

2.1. Experimental Materials

This experiment was conducted at the College of Horticultural Science and Engineering of Shandong Agricultural University, the National Apple Engineering Technology Research Center, and the State Key Laboratory of Crop Biology. The soil used in this study was obtained from a 32-year-old apple orchard located in Manzhuang Town, Tai’an City, Shandong Province (36.1° N, 117.1° E). A soil layer between 10 cm and 40 cm was randomly sampled at multiple points, and the samples were subsequently mixed. M. hupehensis Rehd. seedlings with six true leaves were used as experimental materials. Clay pots had a top diameter 25 cm, bottom diameter 17 cm, and height 18 cm, containing 6.5 kg of soil from different treatments.
The chlorine dioxide disinfectant powder used in this study was obtained from Shandong Province Wucheng YaJie Disinfection Products Co., Ltd. (Dezhou, China), with an active ingredient content of >10%.

2.2. Pot Experiment

The experimental design consisted of three treatments: a replant soil control (CK), 600 mg·L1 chlorine dioxide (R1), and methyl bromide-fumigated replant soil (CK1). Chlorine dioxide powder was prepared in solutions with the required concentrations (prepared and used immediately), and the chlorine dioxide solution was irrigated once seven days before planting the seedlings to irrigate the soil thoroughly (the mass ratio of chlorine dioxide solution to soil was 1:10); the concentration of chlorine dioxide used was 600 mg·L1. Subsequently, healthy seedlings with six true leaves and similar growth status were transplanted into pots for different treatments, with two seedlings planted in each pot. Common nitro water-soluble fertilizer was used for unified water and fertilizer management, with 5 g applied to each pot at a time, topdressing was performed once a month, and ten replicate pots were set up for each treatment. The remaining cultivation procedures were uniformly managed in the field. Sampling was conducted during the growing seasons of July and August, and relevant indices were measured. When the soil was sampled, the surface layer was removed, and the soil close to the root system <10 cm was collected. After the fresh soil was retrieved, it was sieved and packaged immediately. One soil sample was stored in a refrigerator at 4 °C as fresh soil for soil microorganism counts using the coating method. Another soil sample was placed in a ventilated area and air-dried for 2–3 days to determine the phenolic acid substances in the soil and other indices. A third soil sample was stored in a refrigerator at −80 °C for soil DNA extraction.

2.3. Field Experiment

In April 2022, field trials were conducted in Shilibu Village, Xicheng Town, Qixia City, Yantai City, Shandong Province (35°02′ N, 118°36′ E). The average annual temperature is 11.4 °C, the average annual sunshine duration is 2659.9 h, the average frost-free period is 209 days, and the average ground temperature is 13.6 °C. The average annual precipitation ranges from 640 mm to 846 mm in Liujiagou Town, Penglai District, Yantai City, Shandong Province (37°77′ N, 120°89′ E). The annual average temperature is 12.5 °C. The extreme maximum temperature is 38.8 °C and the extreme minimum temperature is −14.9 °C. The average annual precipitation is 664 mm, the average annual sunshine is 2826 h, and the average frost-free period is 206 days. Two treatment groups were established: a replant soil control (CK) and a 600 mg·L1 chlorine dioxide treatment (R1). Each group included ten trees, and the dosage and application method of the chlorine dioxide solution were consistent with those used in the pot experiment. Before the experiment, old fruit trees that had been growing in the orchard for several years were removed. In April 2022, two-year-old grafted apple saplings with strong growth were planted. ‘Fushixin 2001’ was planted in the Qixia orchard, whereas ‘Yanfu 10’ was planted in the Penglai orchard, both using M9T337 as the rootstock. Nitro fertilizer was used for normal fertilization management of orchards in all treatments, and unified irrigation and pesticide spraying were carried out to ensure the healthy growth of trees. Samples were collected in August to measure the plant height, ground diameter, and new shoot growth.

2.4. Determination of Indices and Methods

2.4.1. Determination of the Inhibitory Effect of Chlorine Dioxide on Pathogenic Fungi

The test strains Fusarium oxysporum, Fusarium proliferatum, Fusarium moniliforme, Fusarium solani had been preserved in the laboratory.
Measurement of inhibitory activity: a 0.5 cm punch was used to collect fungal pellets from four different Fusarium culture media, which were then inoculated into solidified potato dextrose agar (PDA) media. After incubation at 28 °C for 1–2 days, 10 mL of chlorine dioxide solution with concentrations of 0 mg·L1, 50 mg·L1, 100 mg·L1, 150 mg·L1, 200 mg·L1, 400 mg·L1, 600 mg·L1 was added to each of Fusarium medium, with sterile water serving as the control. After a 30 min soaking period, the liquid was discarded, and the cultures were sealed with plastic wrap for subculturing in an inverted position. After approximately seven days, colony diameter was measured using the cross-multiplication method [3].
Antifungal rate (%) = [(control colony diameter − treated colony diameter)/control colony diameter] × 100.
Preparation of Fusarium spore suspension: PDA medium (200 mL) was placed in a conical flask and sterilized at 120 °C. After cooling, pellets of the four Fusarium species were added and incubated on a shaker for 2–3 days. The resulting solution was filtered through four layers of gauze and diluted with sterile water to obtain a spore suspension with a final concentration of 1 × 106 CFU·mL1 (measured using a microscopic blood cell counting plate).
Measurement of the germination inhibition rate of Fusarium spores: a concave glass slide was sterilized with alcohol and placed in a culture dish. An aliquot of 50 μL of the spore suspension was loaded onto a concave glass slide and mixed with 50 μL of chlorine dioxide solution at varying concentrations (0 mg·L1, 50 mg·L1, 100 mg·L1, 150 mg·L1, 200 mg·L1, 400 mg·L1, 600 mg·L1), with 50 μL of sterile water serving as a blank control. The concave glass slide was then placed in a sealed culture dish and incubated at 28 °C for 7–12 h in the dark. Spore germination was observed and recorded under a microscope, and each treatment was repeated thrice.
Spore germination rate (%) = number of germinated spores/total number of spores × 100.
Spore germination inhibition rate (%) = (control germination rate − treatment germination rate)/control germination rate × 100.

2.4.2. Determination of Biomass

In the pot experiment, a ruler was used to measure the height of the seedlings, a Vernier caliper to measure their ground diameter, and an electronic balance to measure their fresh and dry weights. In the field experiment, the height of young trees was measured by meter ruler, their stem diameter was measured by vernier caliper, the growth of new shoots was measured by meter ruler, and the average length of new shoots of three trees was taken.

2.4.3. Determination of Root System Architecture Parameters

The WinRHIZO Professional Edition (2007) root analysis system was used to analyze and process sample root images, and the root length, total volume, total surface area, and number of root tips of the seedlings were measured.

2.4.4. Determination of Antioxidant Enzyme Activity in Roots

Catalase (CAT) activity, peroxidase (POD) activity, superoxide dismutase (SOD) activity, and malondialdehyde (MDA) content were determined according to previously described methods [21].

2.4.5. Determination of Soil Microorganisms

The dilution plate counting method was used [22]. Bacteria were cultured in LB medium at 37 °C for one day, fungi were cultured in PDA medium at 28 °C for two days, and actinomycetes were cultured in modified Gould’s medium at 28 °C for seven days.

2.4.6. Determination of Soil Phenolic Acid Content

The phenolic acid content in the soil was determined according to a previously described method [9], and the phenolic acids in the soil were extracted using an ASE-HPLC350 rapid solvent extractor. The sample analysis was performed using a high-performance liquid chromatograph Ultimate3000 (Dionex, Sunnyvale, USA).

2.4.7. Determination of Chloride Ion Content in Soil

The Mohr method was used, and the method described in a previous study was used as a reference [23].

2.4.8. Real-Time Quantitative Analysis (RT-qPCR)

The CFX96 Touch RT-qPCR Detection System (BIO-RAD, Hercules, CA, USA) was used to quantitatively detect the presence of four pathogenic Fusarium species in the extracted soil fungal DNA. The primers used for the experimental strains F. oxysporum, F. solani, F. proliferatum, and F. moniliforme were identical to those used in our previous study [3]. The primer sequences used are listed in Table 1. For each PCR reaction, 1 μL of target DNA, 12.5 μL of SYBR Green premixed Ex Taq, 1 μL of each primer, and 9.5 μL of sterile distilled water were added. Three replicate reactions were performed for each sample. The results, along with the Cq value designated as y, were substituted into the PCR standard curve to determine the logarithm of the gene copy number in the soil sample.

2.4.9. Analysis of Soil Microbial Community Structure

High-throughput sequencing of soil fungi and bacteria was performed by the Shanghai Meiji Biopharmaceutical Technology Co., Ltd., Shanghai, China. Soil fungi were amplified and sequenced using universal primers ITS1F and ITS2R.
Soil microbial community structure analysis was performed according to the methods described by Amanda et al. and Xiaoqi et al. [24,25].

2.5. Data Analysis

The experimental data were calculated using Microsoft Excel 2016 and the experimental results were plotted using Origin 2022. The results were subjected to a one-way analysis of variance and an independent t-test using IBM SPSS Statistics 26. Analysis of the rhizosphere fungal community composition and principal coordinate analysis were performed using the Majorbio Cloud Platform (www.majorbio.com, accessed on 1 December 2023). The analysis of the rhizosphere bacterial community composition and Principal Co-ordinates Analysis (PCoA) were performed using Majorbio Cloud Platform.

3. Results

3.1. Effects of Chlorine Dioxide on Mycelial Growth and Spore Germination of Pathogenic Fungi

Chlorine dioxide solutions at varying concentrations effectively inhibited the growth of the four Fusarium species, and the antifungal efficacy increased as the concentration of chlorine dioxide increased (Table 2). At the low concentration of 200 mg·L1, the inhibitory effect on Fusarium mycelia was moderate, with inhibition rates against different pathogenic Fusarium species ranging from 23% to 37%. The most significant effect was observed against F. oxysporum; in this case, the revealed antifungal activity was 36.35%. In contrast, treatment with a high concentration of 600 mg·L1 chlorine dioxide demonstrated the most significant inhibitory effects on Fusarium fungi, yielding inhibition rates of 65.32%, 57.53%, 44.72%, and 56.01% for F. oxysporum, F. solani, F. laminarum, and F. moniliformis, respectively. These results indicated that high-concentration chlorine dioxide had a significant inhibitory effect on Fusarium species, with the most significant effect occurring at a concentration of 600 mg·L1 (Figure 1).
Chlorine dioxide significantly inhibited spore germination of the four pathogenic Fusarium species and reduced their germination rates, thereby enhancing the inhibitory effect on these fungi (Table 3). At a low concentration of 200 mg·L1, chlorine dioxide treatment nearly eradicated the spores of the four Fusarium species, with spore germination inhibition rates of 91.44%, 98.44%, 98.25%, and 72.11% for F. oxysporum, F. solani, F. laminarum, and F. moniliformis, respectively. When the concentration was increased to 600 mg·L1, the inhibitory effect on the spore germination of pathogenic Fusarium reached 100%.

3.2. Effect of Chlorine Dioxide on the Growth of Grafted Seedlings in the Field Experiment

The phenotypes of M. hupehensis Rehd. seedlings subjected to the various treatments are shown in Figure 2. Compared with the replant treatment, disinfection of the soil with chlorine dioxide significantly enhanced the growth of M. hupehensis Rehd. seedlings (Table 4). In July 2022, the height and stem diameter of the M. hupehensis Rehd. seedlings in the 600 mg·L1 chlorine dioxide treatment group (R1) increased by 26.26% and 26.18%, respectively, compared with that of the replant control (CK). In contrast, the height and ground diameter under methyl bromide fumigation treatment (CK1) increased by 41.40% and 45.67%, respectively. In August, relative to the replant treatment, the plant height, stem diameter, fresh weight, and dry weight of the 600 mg·L1 chlorine dioxide treatment group (R1) increased by 27.20%, 15.95%, 100.70%, and 76.28%, respectively (Figure 2c). These results indicate that disinfecting soil with a high-concentration chlorine dioxide solution (i.e., 600 mg·L1) can enhance the growth of M. hupehensis Rehd. seedlings and alleviate ARD without negatively affecting the plant growth.

3.3. Effects of Different Treatments on the Root Architecture of M. hupehensis Rehd. Seedlings

Potted M. hupehensis Rehd. seedlings were collected for root-scanning analysis. The results indicated that both chlorine dioxide (R1) and methyl bromide fumigation (CK1) significantly enhanced the root growth of M. hupehensis Rehd. seedlings (Figure 2a). In the 2022 experiment, the overall performance of the root system architecture was ranked as follows: replant soil control (CK) < 600 mg·L1 chlorine dioxide (R1) < methyl bromide fumigation (CK1). Compared with the control treatment (CK), the root length of seedlings treated with 600 mg·L1 chlorine dioxide (R1) increased by 31.74%, the root surface area increased by 96.54%, the root volume increased by 257.29%, and the number of root tips increased by 85.29%. Soil treated with chlorine dioxide significantly promoted the growth of the root systems of apple seedlings.

3.4. Effects of Different Treatments on Antioxidant Enzyme Activity and MDA Content in Roots of M. hupehensis Rehd. Seedlings

The antioxidant enzyme activity in the roots of seedlings treated with chlorine dioxide was significantly increased, whereas the MDA content was significantly reduced compared with that of M. hupehensis Rehd. seedlings in the replant soil (Figure 2d). In August, the activities of antioxidant enzymes CAT, SOD, and POD in the roots of M. hupehensis Rehd. seedlings treated with 600 mg·L1 chlorine dioxide (R1) increased by 93.75%, 16.24%, and 110.01%, respectively, compared with the replant treatment (CK1). Concurrently, MDA content decreased by 34.69%. These experimental results indicate that treating the replant soil with chlorine dioxide can significantly enhance the activity of antioxidant enzymes in apple roots, improve the root resistance of apple seedlings, and reduce the incidence of ARD.

3.5. Effects of Different Treatments on the Number of Soil Microorganisms

In the 2022 experiment, the numbers of soil bacteria and fungi in the 600 mg·L−1 chlorine dioxide (R1) and methyl bromide fumigation (CK1) treatments were significantly lower than those in the control (CK), with significant differences between the treatments (Figure 3c,b). The number of soil bacteria in the 600 mg·L1 chlorine dioxide (R1) treatment was 39.26% lower than that in the replant control (CK), whereas the number of fungi decreased by 34.25%. These results indicate that disinfecting the soil with 600 mg·L1 chlorine dioxide significantly affected the population of soil microorganisms, leading to a significant reduction in soil fungi and a slowdown in the growth of soil microorganisms.

3.6. Effects of Different Treatments on the Number of Pathogenic Fungi in Soil

Real-time fluorescence-based quantitative PCR analysis demonstrated that disinfecting the replant soil with chlorine dioxide significantly inhibited the growth of four pathogenic Fusarium species, reduced their gene copy numbers, and hindered the reproduction of Fusarium (Figure 3a). The effectiveness of the different treatments was ranked as follows: replant soil control (CK) > 600 mg·L1 chlorine dioxide (R1) > methyl bromide fumigation (CK1). Compared with the replant control (CK), treatment with 600 mg·L1 chlorine dioxide (R1) resulted in reductions in gene copy numbers for F. oxysporum, F. solani, F. proliferatum, and F. moniliformis by 58.33%, 83.14%, 35.06%, and 52.84%, respectively, indicating that the growth of Fusarium in the soil was significantly inhibited.

3.7. Effects of Different Treatments on Soil Chloride Content

After soil disinfection with chlorine dioxide, the soil exhibited residual chloride ions, resulting in a significant increase in the chloride ion content and subsequent soil pollution (Figure 3d). Assays conducted in July and August revealed that the chloride ion content in soil treated with 600 mg·L1 chlorine dioxide (R1) was 2.21 and 2.54 times higher than that of the replant soil (CK), respectively. The overall chloride ion content was approximately 40 mg·kg1, which is below the national safety standard for soil chloride ions (100 mg·kg1) and does not exceed the soil safety limit.

3.8. Effects of Different Treatments on Soil Phenolic Acid Content

Through the analysis of soil phenolic acids, including vanillic acid, syringic acid, vanillin, ferulic acid, benzoic acid, coumarin, and phloretin, it was determined that the levels of these compounds in soil treated with chlorine dioxide and methyl bromide sterilization were significantly lower than those in replant soil (Table 5). Compared with the replant control (CK), the concentrations of vanillic acid, syringic acid, vanillin, ferulic acid, benzoic acid, coumarin, and phloretin in the soil treated with 600 mg·L−1 chlorine dioxide (R1) were 0.94, 0.73, 0.90, 0.57, 0.31, 0.85, and 0.40 times, respectively, those in the control treatment. Compared with the planting of M. hupehensis Rehd. seedlings in replant soil, disinfecting the soil with a high concentration of chlorine dioxide solution (i.e., 600 mg·L1) (R1) before planting M. hupehensis Rehd. resulted in reduced phenolic acid levels in the soil.

3.9. Effects of Chlorine Dioxide Application on Soil Microbial Community Structure

The fungal community was thoroughly analyzed using Principal Co-ordinates Analysis (PCoA, Figure 4a). PC1 and PC2 accounted for 65.11% and 21.93% of the variance in fungal community structure among the treatments, respectively. The three treatments were distinctly separated and positioned in different quadrants, indicating that the differences between treatments were statistically significant. Notably, the fungal community in the soil treated with chlorine dioxide was significantly different from that in the replant soil and soil treated with methyl bromide fumigation. This suggests that the microbial community structure in the soil after chlorine dioxide treatment differed from that observed after methyl bromide fumigation.
The α-diversity of the soil fungi changed significantly after the application of chlorine dioxide for disinfection. As illustrated in Figure 4d, the Shannon index under the 600 mg·L1 chlorine dioxide (R1) treatment was significantly higher than those under the CK1 and CK treatments. The Chao and Ace indices of soil fungi treated with chlorine dioxide (R1) were slightly lower than those of the replant control (CK) but significantly higher than those of the methyl bromide fumigation (CK1). Conversely, the Simpson index exhibited the opposite trend to that of the other indices. This suggests that although chlorine dioxide fumigation can effectively alter the abundance of soil microbial communities, it does not induce changes as significant as those observed with the CK1 treatment. Overall, the chlorine dioxide treatment positively influenced the structure of soil microbial communities, significantly enhancing the diversity of soil fungal communities without affecting their overall abundance of soil microbial communities.
At the phylum level of soil fungi, Ascomycota, Basidiomycota, and Chytridiomycota were the most abundant fungal groups identified in all the soil samples (Figure 4b). There was no significant difference in the relative abundance of Ascomycota among the treatments; however, the abundance of Chytridiomycota was significantly higher in the chlorine dioxide treatment compared with the CK treatment. At the genus level, the relative abundances of Mortierella, Trichoderma, and Mortierellomycota under the chlorine dioxide treatment were significantly greater than those observed under CK treatment, with increases of 64.30%, 77.00%, and 74.89%, respectively. Conversely, the relative abundances of Neocosmospora, Lophotrichus, and Fusarium under R1 treatment were significantly lower than those under CK treatment, with decreases of 47.95%, 34.68%, and 60.52%, respectively, compared with the CK treatment.

3.10. Effects of Chlorine Dioxide Treatment on Apple Sapling Biomass

The results indicated that after the application of chlorine dioxide soil disinfectant in Qixia and Penglai, the height, diameter, and new shoot growth of apple saplings were significantly greater than those in the untreated replant soil, demonstrating the significant promoting effect of chlorine dioxide (Figure 5). In Qixia, compared with the replant control (CK) treatment, the height of the plants increased by 25.68%, stem diameter by 10.70%, and new shoot growth by 77.00% under 600 mg·L1 chlorine dioxide (R1) treatment. In Penglai, the height, stem diameter, and new shoot growth under the same 600 mg·L1 chlorine dioxide (R1) treatment increased by 24.63%, 23.13%, and 78.23%, respectively, compared with that of the replant control (CK) treatment. The overall results of the chlorine dioxide soil treatment were consistent with those of the pot experiment. The biomass of apple saplings in the orchards of both regions increased to varying degrees after the soil was treated with chlorine dioxide compared with the untreated condition (Figure 5).

4. Discussion

Soil disinfection is an effective strategy for preventing and controlling ARD, and its effect on ARD management is significant [8]. Replant soil treated with various strong oxidants, such as lime sulfur and potassium permanganate, can effectively reduce the incidence of ARD and enhance the biomass of M. hupehensis Rehd. seedlings [21,26]. Chlorine dioxide, an internationally recognized and safe disinfectant, is highly effective in inactivating bacteria, fungi, and viruses [20]. In this study, measurements of replant apple seedlings at different intervals revealed that treating the soil with a chlorine dioxide solution influenced the physiological indicators of M. hupehensis Rehd. seedlings. The treatment resulted in increased plant height, stem diameter, fresh weight, dry weight of seedlings, and biomass of apple saplings. A concentration of 600 mg·L⁻1 of chlorine dioxide had a particularly significant effect, promoting root growth and increasing root length, root surface area, root volume, and the number of root tips in M. hupehensis Rehd. seedlings. These findings are consistent with those of previous experiments demonstrating the efficacy of strong oxidants in disinfecting soils to mitigate ARD.
Excessive use of strong oxidants can often damage the vitality of plant roots and impair the activity of related enzymes Consequently, root enzyme activity generally serves as an indicator of stress resistance and overall health status of the roots [27,28]. Root antioxidant enzyme activity is a crucial measure of plant stress tolerance, and reflects the ability of plants to withstand adverse conditions [29]. MDA is another important indicator of plant stress resistance; as a byproduct of membrane lipid peroxidation, changes in MDA levels signify the extent of peroxidative damage to cellular membranes Adverse conditions typically lead to an increase in the MDA content, which can subsequently halt plant growth. In this study, the application of 600 mg·L1 chlorine dioxide effectively reduced MDA levels in plant roots and promoted root growth. Antioxidant enzymes such as CAT and POD function synergistically to eliminate excess reactive oxygen species in plants, thereby maintaining the balance of free radicals and enhancing plant resilience [21]. Our findings indicate that soil disinfection with chlorine dioxide solution increased the activity of root-protective enzymes in M. hupehensis Rehd. seedlings. The activities of CAT, POD, and SOD in plants treated with 600 mg·L1 chlorine dioxide showed a significant increase, greatly enhancing plant resistance. These results suggest that soil disinfection with chlorine dioxide not only promotes protective enzyme activity in roots but also reduces free radicals and MDA content. Consequently, root damage was minimized and plant stress resistance was improved, thereby alleviating the effects of ARD.
Chlorine dioxide decomposes chloride ions after disinfection. Chloride ions are essential trace nutrients for plants and play crucial roles in hormone synthesis and growth promotion. Colmenero-Flores et al. [30] found that the application of chlorine-containing fertilizers significantly increased the yield of sweet oranges while enhancing their flavor and juice content. Chloride ions help maintain cell turgor, influence enzyme activity in plants, and improve stress resistance [31]. However, excessive chlorine can be toxic to plants, hindering growth and reducing both yield and quality [32,33]. The experimental results indicated that soil disinfection with chlorine dioxide solution increased the chloride ion content. The greater the amount of chlorine dioxide applied, the more chloride ions decomposed, resulting in a higher chloride ion concentration in the soil. The maximum chloride ion content in the soil treated with 600 mg·L1 chlorine dioxide was approximately 40 mg·kg 1, which did not exceed the safety limit for the normal growth of apple seedlings, allowing the plants to thrive.
Phenolic acids in the soil are allelopathic substances that often exhibit inhibitory effects on plant growth at high concentrations [34]. The production of various phenolic acids can also indirectly impede the growth and development of plants by influencing soil microorganisms, nutrients, and enzyme activity, ultimately leading to ARD [35]. An increase in the concentration of five phenolic acids, including gallic acid and salicylic acid, has been associated with alterations in the structure of soil fungal communities, an increase in pathogenic fungi, exacerbation of ginseng root rot, and restricted plant growth [36]. Previous studies have found that a variety of rhizosphere microorganisms can effectively oxidize and decompose soil allelochemicals to prevent soil-borne plant diseases [9,37]. The application of biochar to the soil in apple orchards significantly enhances the activity of root-protective enzymes, reduces the concentration of phloridzin, and promotes the growth of apple seedlings [38]. The results of this study demonstrated that irrigating the soil of replant apple trees with a 600 mg·L1 chlorine dioxide solution significantly decreased the levels of phenolic acids, such as vanillic acid, syringic acid, vanillin, ferulic acid, benzoic acid, and phloretin. This process accelerated their decomposition and mitigated their toxic effects, further promoting the growth of M. hupehensis Rehd. seedlings.
Fusarium, Pythium, and Cylindrocarpon spp. are recognized as the pathogens that cause ARD [7,39,40]. Among these, F. proliferatum, F. solani, F. oxysporum, and F. moniliforme, which belong to the genus Fusarium, are prevalent in the soil of replant orchards in China [6] and exhibit a strong inhibitory effect on the growth of M. hupehensis Rehd. seedlings. The primary function of disinfecting soil with chlorine dioxide is to eliminate pathogenic microorganisms by decomposing amino acids using strong oxidizing agents, altering protein configurations, and disrupting cell membranes [18]. This process reduces pathogen populations, enhances the soil environment, and promotes plant growth. In this study, chlorine dioxide solutions at varying concentrations inhibited the mycelial growth and spore germination of F. proliferatum, F. solani, F. oxysporum, and F. moniliforme to a certain degree. Notably, a concentration of 600 mg·L1 chlorine dioxide demonstrated a more significant sterilizing effect on the four Fusarium species. RT-qPCR analysis indicated that this concentration significantly reduced the gene copy number of Fusarium in soil. These findings suggest that the surface application of chlorine dioxide for soil disinfection can effectively reduce the relative abundance of pathogenic fungi, optimize the microbial community structure, and alleviate the incidence of ARD.

5. Conclusions

In this study, soil disinfection with 600 mg·L1 chlorine dioxide significantly enhanced the biomass, root architecture parameters, root-protective enzyme activity, and soil chloride ion content of M. hupehensis Rehd. seedlings. It also reduced the population of soil microorganisms, phenolic acid content, and the gene copy number of pathogenic Fusarium while optimizing the soil microbial community structure. Therefore, as a low-toxicity soil disinfectant, chlorine dioxide can effectively prevent and control ARD. This study offers mechanistic insights into and practical guidance for safe soil disinfection to protect plants from pathogens.

Author Contributions

Conceptualization, C.Y. and Z.M.; Methodology, Y.X. and S.Z.; Software, S.Z.; Formal analysis, S.Z.; Investigation, J.L.; Resources, C.Y., Y.L. and Z.M.; Data curation, Y.X. and J.L.; Writing—original draft, J.L.; Writing—review and editing, G.W.; Visualization, Y.X.; Supervision, Y.L.; Project administration, G.W.; Funding acquisition, C.Y., Y.L. and Z.M. All authors have read and agreed to the published version of the manuscript.

Funding

This work was funded by Natural Science Foundation of Shandong Province (ZR2024QC036); National Key Research and Development Program (2023YFD2301000, 2023YFD2301003); Key R&D program of Shandong Province (2022TZXD0037); Taishan Scholar Funded Project (NO. ts20190923, NO. tsqn202408119); China Agriculture Research System of MOF and MARA (CARS-27).

Data Availability Statement

The original contributions presented in this study are included in the article. Further inquiries can be directed to the corresponding authors.

Conflicts of Interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

References

  1. Mao, Z.; Wang, Y. Apple replant disease: Causes and management. In Integrated management of Diseases and Insect Pests of Tree Fruit; Burleigh Dodds Science Publishing: Cambridge, UK, 2019; pp. 39–58. [Google Scholar]
  2. Traud, W.; Felix, M.-D. Apple replant disease—new insights into an old problem. In XXXI International Horticultural Congress (IHC2022): International Symposium on Innovative Perennial Crops Management 1366; International Society for Horticultural Science (ISHS): Korbeek-Lo, Belgium, 2023; pp. 369–376. [Google Scholar]
  3. Wang, H.; Tang, W.; Mao, Y.; Ma, S.; Chen, X.; Shen, X.; Yin, C.; Mao, Z. Isolation of Trichoderma virens 6PS-2 and its effects on Fusarium proliferatum f. sp. Malus domestica MR5 related to apple replant disease (ARD) in China. Hortic. Plant J. 2022, 10, 1291–1308. [Google Scholar] [CrossRef]
  4. Annmarie-Deetja, R.; Jannika, S.; Katharina, C.; Annabel, F.; Michaela, S.; Traud, W. Split-root approach reveals localized root responses towards apple replant disease (ARD) in terms of ARD biomarker gene expression and content of phenolic compounds. Sci. Hortic. 2021, 286, 110117. [Google Scholar]
  5. Tang, W.; Wang, G.; Chen, R.; Liu, X.; Chen, X.; Shen, X.; Yin, C.; Mao, Z. Allium fistulosum L. Alleviates Apple Replant Disease by Suppressing Fusarium solani. J. Fungi 2022, 8, 1071. [Google Scholar] [CrossRef]
  6. Wang, G.; Yin, C.; Pan, F.; Wang, X.; Xiang, L.; Wang, Y.; Wang, J.; Tian, C.; Chen, J.; Mao, Z. Analysis of the Fungal Community in Apple Replanted Soil Around Bohai Gulf. Hortic. Plant J. 2018, 4, 175–181. [Google Scholar] [CrossRef]
  7. Duan, Y.N.; Jiang, W.T.; Zhang, R.; Chen, R.; Chen, X.S.; Yin, C.M.; Mao, Z.Q. Discovery of Fusarium proliferatumf. sp.malus domestica Causing Apple Replant Disease in China. Plant Dis. 2022, 106, 2958–2966. [Google Scholar] [CrossRef] [PubMed]
  8. Jiang, W.; Chen, R.; Zhao, L.; Qin, L.; Fan, H.; Chen, X.; Wang, Y.; Yin, C.; Mao, Z. Chemical fumigants control apple replant disease: Microbial community structure-mediated inhibition of Fusarium and degradation of phenolic acids. J. Hazard. Mater. 2022, 440, 129786. [Google Scholar] [CrossRef] [PubMed]
  9. Jiang, W.; Chen, R.; Zhao, L.; Duan, Y.; Wang, H.; Yan, Z.; Shen, X.; Chen, X.; Yin, C.; Mao, Z. Isolation of phloridzin-degrading, IAA-producing bacterium Ochrobactrum haematophilum and its effects on the apple replant soil environment. Hortic. Plant J. 2023, 9, 199–208. [Google Scholar] [CrossRef]
  10. Geng, W.; Lv, Y.; Duan, Y.; Wang, H.; Jiang, W.; Zhang, R.; Chen, R.; Chen, X.; Shen, X.; Yin, C.; et al. Preparation of composite microbial culture and its biocontrol effect on apple replant disease. Sci. Hortic. 2022, 303, 111236. [Google Scholar] [CrossRef]
  11. Larry, R.B.; Charles, A.P.; Mario, E.T.; Brian, J.R.; Alan, J.S. Lethality of chlorine, chlorine dioxide, and a commercial fruit and vegetable sanitizer to vegetative cells and spores of Bacillus cereus and spores of Bacillus thuringiensis. J. Ind. Microbiol. Biotechnol. 2005, 67, 1702–1708. [Google Scholar]
  12. Vipin, K.R.; Shawn, R.; Lalena, W.; Lisa, S.S.; Saumil, S.S.; Gérard, B.M. Systematic Evaluation of the Efficacy of Chlorine Dioxide in Decontamination of Building Interior Surfaces Contaminated with Anthrax Spores. Appl. Environ. Microbiol. 2010, 76, 3343–3351. [Google Scholar]
  13. Sun, W.; Hu, K.; Wang, H.; Wang, J.; Yang, G.; Wang, K.; Guo, L.; Zhang, F.; Lin, G.; Yi, H.; et al. Advances in Research on Sustained-Release Chlorine Dioxide Solid Preparations. In Advances in Graphic Communication, Printing and Packaging Technology and Materials: Proceedings of 2020 11th China Academic Conference on Printing and Packaging; Springer: Singapore, 2021; pp. 822–829. [Google Scholar]
  14. Zhang, Y.X.; Xiang, J.L.; Wang, J.J.; Du, H.S.; Wang, T.T.; Huo, Z.Y.; Wang, W.L.; Liu, M.; Du, Y. Ultraviolet-based synergistic processes for wastewater disinfection: A review. J. Hazard. Mater. 2023, 453, 131393. [Google Scholar] [CrossRef]
  15. Qu, W.; Zheng, W.; Wang, S.; Wang, Y. China’s new national standard for drinking water takes effect. Lancet 2012, 380, e8. [Google Scholar] [CrossRef] [PubMed]
  16. Wang, H.; Zhang, R.; Mao, Y.; Jiang, W.; Chen, X.; Shen, X.; Yin, C.; Mao, Z. Effects of Trichoderma asperellum 6S-2 on Apple Tree Growth and Replanted Soil Microbial Environment. J. Fungi 2022, 8, 63. [Google Scholar] [CrossRef]
  17. Xiong, W.; Li, R.; Guo, S.; Karlsson, I.; Jiao, Z.; Xun, W.; Kowalchuk, G.A.; Shen, Q.; Geisen, S. Microbial amendments alter protist communities within the soil microbiome. Soil Biol. Biochem. 2019, 135, 379–382. [Google Scholar] [CrossRef]
  18. Norio, O. Denaturation of Protein by Chlorine Dioxide: Oxidative Modification of Tryptophan and Tyrosine Residues. Biochemistry 2007, 46, 4898–4911. [Google Scholar]
  19. Kacper, K.; Grzegorz, B.; Izabela, S.-B. Denaturation and Digestion Increase the Antioxidant Capacity of Proteins. Processes 2023, 11, 1362. [Google Scholar] [CrossRef]
  20. Isaac Kwesi, O.; Suresh, M.; Jianping, L.; Sreekantha, B.J. Chlorine dioxide oxidation of Escherichia coli in water—A study of the disinfection kinetics and mechanism. J. Environ. Sci. Health 2017, 52, 598–606. [Google Scholar]
  21. Xia, Q.; Jiang, W.; Liu, S.; Qin, L.; Zhao, G.; Li, Z.; Yin, C.; Mao, Z.; Wang, Y. Effects of Crystal Lime Sulfur Fumigation and Application of Root-Growth-Promoting Agents on the Control of Apple Replant Disease. Horticulturae 2023, 9, 901. [Google Scholar] [CrossRef]
  22. Tang, W.; Zhang, R.; Wang, M.; Wang, H.; Ding, F.; Chen, X.; Shen, X.; Yin, C.; Mao, Z. Effects of two apple rootstocks on the soil microecology of replanted apple orchard soil. Sci. Hortic. 2024, 324, 112640. [Google Scholar] [CrossRef]
  23. Yu, L.; Chu, H.; Zhu, Z.; Jiang, L.; Dong, H. Determination of the chloride ion content in concrete under simultaneous chloride and sulphate ion attack. J. Build. Eng. 2023, 72, 106579. [Google Scholar] [CrossRef]
  24. Amanda, J.B.; Gary, D.B.; David, C.; Sally, H.; Peter, R.M. Meeting the demand for crop production: The challenge of yield decline in crops grown in short rotations. Biol. Rev. 2011, 87, 52–71. [Google Scholar]
  25. Wang, X.; Yao, Y.; Wang, G.; Lu, H.; Ma, J.; Zhang, M.; Chen, X.; Yin, C.; Mao, Z. Controlled-Release Diammonium Phosphate Alleviates Apple Replant Disease: An Integrated Analysis of Soil Properties, Plant Growth, and the Soil Microbiome. J. Agric. Food Chem. 2022, 70, 8942–8954. [Google Scholar] [CrossRef] [PubMed]
  26. Chen, R.; Jiang, W.; Wang, H.; Pan, F.; Fan, H.; Chen, X.; Shen, X.; Yin, C.; Mao, Z. Effects of Different Fumigants on the Replanted Soil Environment and Growth of Malus hupehensis Rehd. Seedlings. Hortscience 2021, 56, 491–499. [Google Scholar] [CrossRef]
  27. Pan, L.; Zhao, L.; Jiang, W.; Wang, M.; Chen, X.; Shen, X.; Yin, C.; Mao, Z. Effect of Zinc Oxide Nanoparticles on the Growth of Malus hupehensis Rehd. Seedlings. Front. Environ. Sci. 2022, 10, 835–994. [Google Scholar] [CrossRef]
  28. Wang, Y.; Pan, F.; Wang, G.; Zhang, G.; Wang, Y.; Chen, X.; Mao, Z. Effects of biochar on photosynthesis and antioxidative system of Malus hupehensis Rehd. seedlings under replant conditions. Sci. Hortic. 2014, 175, 9–15. [Google Scholar] [CrossRef]
  29. Liu, L.; Li, J.; Wu, G.; Shen, H.; Fu, G.; Wang, Y. Combined effects of biochar and chicken manure on maize (Zea mays L.) growth, lead uptake and soil enzyme activities under lead stress. PeerJ 2021, 9, e11754. [Google Scholar] [CrossRef]
  30. Colmenero-Flores, J.M.; Franco-Navarro, J.D.; Cubero-Font, P.; Peinado-Torrubia, P.; Rosales, M.A. Chloride as a Beneficial Macronutrient in Higher Plants: New Roles and Regulation. Int. J. Mol. Sci. 2019, 20, 4686. [Google Scholar] [CrossRef] [PubMed]
  31. Christoph-Martin, G. Chloride in soil: From nutrient to soil pollutant. Environ. Exp. Bot. 2019, 157, 299–309. [Google Scholar]
  32. Tavakkoli, E.; Rengasamy, P.; McDonald, G.K. High concentrations of Na+ and Cl ions in soil solution have simultaneous detrimental effects on growth of faba bean under salinity stress. J. Exp. Bot. 2010, 61, 4449–4459. [Google Scholar] [CrossRef] [PubMed]
  33. Christoph-Martin, G. Chloride: From Nutrient to Toxicant. Plant Cell Physiol. 2018, 59, 877–886. [Google Scholar]
  34. Duan, Y.; Zhao, L.; Jiang, W.; Chen, R.; Zhang, R.; Chen, X.; Yin, C.; Mao, Z. The Phlorizin-Degrading Bacillus licheniformis XNRB-3 Mediates Soil Microorganisms to Alleviate Apple Replant Disease. Front. Microbiol. 2022, 13, 839484. [Google Scholar] [CrossRef] [PubMed]
  35. Chen, R.; Jiang, W.; Liu, Y.; Wang, Y.; Fan, H.; Chen, X.; Shen, X.; Yin, C.; Mao, Z. Amygdalin and Benzoic Acid on the Influences of the Soil Environment and Growth of Malus hupehensis Rehd. Seedlings. ACS Omega 2021, 6, 12522–12529. [Google Scholar] [CrossRef]
  36. Zibo, L.; Junfan, F.; Rujun, Z.; Dan, W. Effects of phenolic acids from ginseng rhizosphere on soil fungi structure, richness and diversity in consecutive monoculturing of ginseng. Saudi J. Biol. Sci. 2018, 25, 1788–1794. [Google Scholar]
  37. Gniazdowska, A.; Krasuska, U.; Andrzejczak, O.; Soltys, D. Allelopathic compounds as oxidative stress agents: YES or NO. React. Oxyg. Nitrogen Species Signal. Commun. Plants 2015, 155–176. [Google Scholar]
  38. Liu, Y.; Wang, C.; Chen, R.; Jiang, W.; Li, Y.; Yin, C.; Wang, Y.; Mao, Z. Biochar alleviates apple replant disease by reducing the growth of Fusarium oxysporum and regulating microbial communities. Hortic. Plant J. 2023, 10, 657–671. [Google Scholar] [CrossRef]
  39. Zhu, Y.; Shin, S.; Mazzola, M. Genotype responses of two apple rootstocks to infection by Pythium ultimum causing apple replant disease. Can. J. Plant Pathol. 2016, 38, 483–491. [Google Scholar] [CrossRef]
  40. Tilston, E.L.; Deakin, G.; Bennett, J.; Passey, T.; Harrison, N.; O’Brien, F.; Fernández-Fernández, F.; Xu, X. Candidate Causal Organisms for Apple Replant Disease in the United Kingdom. Phytobiomes J. 2018, 2, 261–274. [Google Scholar] [CrossRef]
Figure 1. Inhibitory effects of chlorine dioxide on four Fusariums. Note: the treatment from left to right in turn: F. oxysporum, F. solani, F. proliferatum, F. moniliforme; CK, water control; R1, chlorine dioxide, 600 mg/L−1.
Figure 1. Inhibitory effects of chlorine dioxide on four Fusariums. Note: the treatment from left to right in turn: F. oxysporum, F. solani, F. proliferatum, F. moniliforme; CK, water control; R1, chlorine dioxide, 600 mg/L−1.
Agronomy 15 00059 g001
Figure 2. Root structure and vitality of Malus hupehensis Rehd. seedlings under different treatments. Note: CK, replanted soil control; R1, 600 mg·L−1 chlorine dioxide; CK1, methyl bromide sterilized replanted soil. (a) Effect of chlorine dioxide on plant root structure; (b) Photos of potted plants; (c) Dry and fresh weights of potted plants; (d) Root protection enzyme activity. The same sampling time and different lowercase letters represent significant differences among different treatments (p < 0.05); the same below.
Figure 2. Root structure and vitality of Malus hupehensis Rehd. seedlings under different treatments. Note: CK, replanted soil control; R1, 600 mg·L−1 chlorine dioxide; CK1, methyl bromide sterilized replanted soil. (a) Effect of chlorine dioxide on plant root structure; (b) Photos of potted plants; (c) Dry and fresh weights of potted plants; (d) Root protection enzyme activity. The same sampling time and different lowercase letters represent significant differences among different treatments (p < 0.05); the same below.
Agronomy 15 00059 g002
Figure 3. Effect of chlorine dioxide treatment on the number of microorganisms and the gene copy number of pathogenic Fusarium fungi in soil. (a) Gene copy number of Fusarium; (b) The number of bacteria that can be cultured in the soil; (c) The number of fungi that can be cultured in the soil; (d) Soil Cl concentration. Note: CK, replanted soil control; R1, 600 mg·L−1 chlorine dioxide; CK1, methyl bromide sterilized replanted soil. The same sampling time and different lowercase letters represent significant differences among different treatments (p < 0.05); * p < 0.05; *** p < 0.001 the same below.
Figure 3. Effect of chlorine dioxide treatment on the number of microorganisms and the gene copy number of pathogenic Fusarium fungi in soil. (a) Gene copy number of Fusarium; (b) The number of bacteria that can be cultured in the soil; (c) The number of fungi that can be cultured in the soil; (d) Soil Cl concentration. Note: CK, replanted soil control; R1, 600 mg·L−1 chlorine dioxide; CK1, methyl bromide sterilized replanted soil. The same sampling time and different lowercase letters represent significant differences among different treatments (p < 0.05); * p < 0.05; *** p < 0.001 the same below.
Agronomy 15 00059 g003
Figure 4. Effect of chlorine dioxide treatment on the structure and abundance of soil fungal communities. (a) PCoA analysis of soil fungal community structure; (b) Phylum level abundance of soil fungal communities; (c) Analysis of soil fungal community abundance at the genus level; (d) Fungal α diversity index. Note: CK, replanted soil control; R1, 600 mg·L−1 chlorine dioxide; CK1, methyl bromide sterilized replanted soil. The same sampling time and different lowercase letters represent significant differences among different treatments (p < 0.05); the same below.
Figure 4. Effect of chlorine dioxide treatment on the structure and abundance of soil fungal communities. (a) PCoA analysis of soil fungal community structure; (b) Phylum level abundance of soil fungal communities; (c) Analysis of soil fungal community abundance at the genus level; (d) Fungal α diversity index. Note: CK, replanted soil control; R1, 600 mg·L−1 chlorine dioxide; CK1, methyl bromide sterilized replanted soil. The same sampling time and different lowercase letters represent significant differences among different treatments (p < 0.05); the same below.
Agronomy 15 00059 g004
Figure 5. Effects of chlorine dioxide treatment on growth of young apple trees. Note: CK, replanted soil control; R1, 600 mg·L−1 chlorine dioxide; (ac), Height, stem diameter and shoot growth of apple saplings in Qixia experiment site; (df), Height, stem diameter and shoot growth of apple saplings in Penglai experimental site. ** p < 0.01; *** p < 0.001, the same below.
Figure 5. Effects of chlorine dioxide treatment on growth of young apple trees. Note: CK, replanted soil control; R1, 600 mg·L−1 chlorine dioxide; (ac), Height, stem diameter and shoot growth of apple saplings in Qixia experiment site; (df), Height, stem diameter and shoot growth of apple saplings in Penglai experimental site. ** p < 0.01; *** p < 0.001, the same below.
Agronomy 15 00059 g005
Table 1. Primer sequence of pathogenic Fusarium.
Table 1. Primer sequence of pathogenic Fusarium.
SpeciesPrimerF (5′-3′)
F. oxysporumJFCATACCACTTGTTGTCTCGGC
JRCGCCGCGTACCAGTTGCGAGGGT
F. solaniFFCGAGTTATACAACTCATCAACC
FRGGCCTGAGGGTTGTAATG
F. proliferatumCHFGATCGGCGAGCCCTTGCGGCAAG
CHRGGGGTTTAACGGCGTGGCC
F. moniliformeCFGACTCGCGAGTCAAATCGCGT
CRGAACGCGAATTAACGCGAGTC
Table 2. Inhibitory effects of different concentrations of chlorine dioxide on mycelial and spore growth of four Fusariums.
Table 2. Inhibitory effects of different concentrations of chlorine dioxide on mycelial and spore growth of four Fusariums.
Chlorine Dioxide Concentration (ClO2, mg·L−1)F. oxysporumF. solaniF. proliferatumF. moniliforme
Colony Diameter (cm)Inhibitory Rate (%)Colony Diameter (cm)Inhibitory Rate (%)Colony Diameter (cm)Inhibitory Rate (%)Colony Diameter (cm)Inhibitory Rate (%)
08.17 ± 0.09 a——7.77 ± 0.03 a——8.20 ± 0.10 a——8.27 ± 0.03 a——
507.23 ± 0.03 b11.466.60 ± 0.10 b15.067.23 ± 0.12 b11.797.50 ± 0.20 b9.20
1006.63 ± 0.13 c18.816.17 ± 0.19 c20.636.80 ± 0.06 c17.076.87 ± 0.23 c16.87
1506.17 ± 0.18 d24.525.70 ± 0.06 d26.646.53 ± 0.07 cd20.336.23 ± 0.15 d24.54
2005.20 ± 0.12 e36.355.13 ± 0.07 e33.936.27 ± 0.13 d23.585.60 ± 0.10 e32.20
4003.73 ± 0.12 f54.304.07 ± 0.26 f47.665.67 ± 0.07 e30.894.67 ± 0.09 f43.50
6002.83 ± 0.09 g65.323.30 ± 0.12 g57.534.53 ± 0.15 f44.723.63 ± 0.32 g56.01
Note: different lowercase letters represent significant differences among different treatments (p < 0.05).
Table 3. Inhibitory effects of chlorine dioxide on the spore germination of four Fusariums.
Table 3. Inhibitory effects of chlorine dioxide on the spore germination of four Fusariums.
Chlorine Dioxide Concentration (ClO2, mg·L−1)F. oxysporumF. solaniF. proliferatumF. moniliforme
Germination Rate (%)Inhibitory Rate (%)Germination Rate (%)Inhibitory Rate (%)Germination Rate (%)Inhibitory Rate (%)Germination Rate (%)Inhibitory Rate (%)
093.50 ± 1.04 a——96.00 ± 0.58 a——95.33 ± 1.17 a——93.83 ± 0.73 a——
5066.33 ± 1.86 b29.0666.17 ± 1.45 b31.0851.83 ± 1.01 b45.6374.67 ± 1.74 b20.42
10052.00 ± 2.00 c44.3951.67 ± 0.88 c46.1838.17 ± 1.92 c59.9656.00 ± 2.65 c40.32
15034.00 ± 2.36 d63.6430.83 ± 2.32 d67.8822.33 ± 0.60 d76.5743.00 ± 1.04 d54.17
2008.00 ± 1.15 e91.441.50 ± 0.29 e98.441.67 ± 0.17 e98.2526.17 ± 1.64 e72.11
4000.00 ± 0.00 f100.000.00 ± 0.00 e100.000.00 ± 0.00 e100.002.00 ± 0.50 f97.87
6000.00 ± 0.00 f100.000.00 ± 0.00 e100.000.00 ± 0.00 e100.000.00 ± 0.00 f100.00
Notes: Values marked with the same letter within a sampling date are not significantly different at p < 0.05 according to Duncan’s new multiple range test.
Table 4. Effects of different treatments on plant biomass of Malus hupehensis Rehd. seedlings.
Table 4. Effects of different treatments on plant biomass of Malus hupehensis Rehd. seedlings.
Sampling TimeTreatmentsPlant HeightStem Diameter
(cm)(mm)
2022.07CK39.23 ± 0.87 c5.08 ± 0.11 c
R149.53 ± 1.41 b6.41 ± 0.17 b
CK155.47 ± 0.84 a7.40 ± 0.06 a
2022.08CK52.20 ± 1.65 c7.65 ± 0.38 c
R166.40 ± 1.89 b8.87 ± 0.16 b
CK178.73 ± 1.13 a9.79 ± 0.12 a
Note: CK, replanted soil control; R1, 600 mg·L−1 chlorine dioxide; CK1, methyl bromide sterilized replanted soil. The same sampling time and different lowercase letters represent significant differences among different treatments (p < 0.05); the same below.
Table 5. Effects of different treatments on the concentration of phenolic compounds in replanted soil.
Table 5. Effects of different treatments on the concentration of phenolic compounds in replanted soil.
Types of Phenolic Acid (mg·kg−1)CKR1CK1
Vanillic acid18.80 ± 1.50 a17.73 ± 1.56 a11.46 ± 0.79 b
Syringic acid7.25 ± 0.30 a5.27 ± 0.12 b1.45 ± 0.28 c
Vanillin1.54 ± 0.03 a1.39 ± 0.04 b0.87 ± 0.02 c
Ferulic acid7.59 ± 0.25 a4.30 ± 0.33 b3.24 ± 0.47 b
Benzoic acid13.64 ± 0.12 a4.22 ± 0.67 c10.55 ± 1.35 b
Coumarin0.27 ± 0.03 a0.23 ± 0.02 a0.15 ± 0.01 b
Phloretin3.17 ± 0.45 a1.26 ± 0.11 b1.42 ± 0.01 b
Phlorizin3.28 ± 0.08 a1.65 ± 0.06 b1.31 ± 0.27 b
Notes: Values marked with the same letter within a sampling date are not significantly different at p < 0.05 according to Duncan’s new multiple range test.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Wang, G.; Xie, Y.; Lv, J.; Zhang, S.; Yin, C.; Liu, Y.; Mao, Z. Effects of Soil Disinfection Using Chlorine Dioxide on Soil Fungal Communities in Apple Replant Fields and the Growth of Malus hupehensis Rehd. Seedlings. Agronomy 2025, 15, 59. https://doi.org/10.3390/agronomy15010059

AMA Style

Wang G, Xie Y, Lv J, Zhang S, Yin C, Liu Y, Mao Z. Effects of Soil Disinfection Using Chlorine Dioxide on Soil Fungal Communities in Apple Replant Fields and the Growth of Malus hupehensis Rehd. Seedlings. Agronomy. 2025; 15(1):59. https://doi.org/10.3390/agronomy15010059

Chicago/Turabian Style

Wang, Gongshuai, Yuxin Xie, Jinhui Lv, Susu Zhang, Chengmiao Yin, Yusong Liu, and Zhiquan Mao. 2025. "Effects of Soil Disinfection Using Chlorine Dioxide on Soil Fungal Communities in Apple Replant Fields and the Growth of Malus hupehensis Rehd. Seedlings" Agronomy 15, no. 1: 59. https://doi.org/10.3390/agronomy15010059

APA Style

Wang, G., Xie, Y., Lv, J., Zhang, S., Yin, C., Liu, Y., & Mao, Z. (2025). Effects of Soil Disinfection Using Chlorine Dioxide on Soil Fungal Communities in Apple Replant Fields and the Growth of Malus hupehensis Rehd. Seedlings. Agronomy, 15(1), 59. https://doi.org/10.3390/agronomy15010059

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop