The Path Towards Novel Varieties: Investigating Phenotypic-Genetic Diversity in New Promising Egyptian Rice Lines
Abstract
:1. Introduction
2. Materials and Methods
2.1. Plant Materials
2.2. Field Planting
2.3. Phenotypic Evaluation and Data Analysis
2.4. SSR Marker Genotyping and Data Analysis
3. Results
3.1. Phenotypic Variations
3.2. Estimates of Genetic Parameters
3.3. Correlation Coefficient
3.4. Genetic Diversity Revealed by SSR Markers
3.5. Cluster Analysis and Genetic Divergence Pattern
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- USDA. Rice Sector at a Lance. 2020. Available online: https://www.ers.usda.gov/topics/crops/rice/rice-sector-at-a-glance/ (accessed on 20 November 2024).
- Sedeek, S.E.; Aboyousef, M.I.; EL-Rafaee, I.S.; Abdallah, A.A.; Hammoud, S.A.; El-Malky, M.M.; EL-Namaky, R.A.; EL-Abd, A.B.; Ammar, M.H.; Abdelkhalik, A.F.; et al. Giza 183 Egyptian rice variety: A step to confront climate change challenges: International Conference of Field Crops Research Institute Egypt. J. Agric. Res. 2023, 101, 519–537. [Google Scholar] [CrossRef]
- Li, S.; Wu, F.; Zhou, Q.; Zhang, Y. Adopting agronomic strategies to enhance the adaptation of global rice production to future climate change: A meta-analysis. Agron. Sustain. Dev. 2024, 44, 23. [Google Scholar] [CrossRef]
- Bhandari, H.R.; Bhanu, A.N.; Srivastava, K.; Singh, M.N.; Shreya, H.A. Assessment of genetic diversity in crop plants—An overview. Adv. Plants Agric. Res. 2017, 7, 279–286. [Google Scholar] [CrossRef]
- Wang, T.; He, W.; Li, X.; Zhang, C.; He, H.; Yuan, Q.; Zhang, B.; Zhang, H.; Leng, Y.; Wei, H.; et al. A rice variation map derived from 10 548 rice accessions reveals the importance of rare variants. Nucleic Acids Res. 2023, 51, 10924–10933. [Google Scholar] [CrossRef]
- Zheng, X.; Zhong, L.; Pang, H.; Wen, S.; Li, F.; Lou, D.; Ge, J.; Fan, W.; Wang, T.; Han, Z.; et al. Lost genome segments associate with trait diversity during rice domestication. BMC Biol. 2023, 21, 20. [Google Scholar] [CrossRef]
- Rabara, R.C.; Ferrer, M.C.; Diaz, C.L.; Newingham, M.C.V.; Romero, G.O. Phenotypic Diversity of Farmers’ Traditional Rice Varieties in the Philippines. Agronomy 2014, 4, 217–241. [Google Scholar] [CrossRef]
- Sedeek, S.E.M.; Mazal, T.M.; Osman, M.M.A.; Hefeina, A.G.; EL-Kallawy, W.H.; Bleih, E.M. Genetic Diversity Among Some of Rice Genotypes Under Water Shortage. J. Plant Prod. 2022, 13, 929–936. [Google Scholar] [CrossRef]
- Ata-Ul-Karim, S.T.; Begum, H.; Lopena, V.; Borromeo, T.; Virk, P.; Hernandez, J.E.; Gregorio, G.B.; Collard, B.C.Y.; Kato, Y. Genotypic variation of yield-related traits in an irrigated rice breeding program for tropical Asia. Crop Environ. 2022, 1, 173–181. [Google Scholar] [CrossRef]
- Demeke, B.; Dejene, T.; Abebe, D. Genetic variability, heritability, and genetic advance of morphological, yield related and quality traits in upland rice (Oryza Sativa L.) genotypes at pawe, northwestern Ethiopia. Cogent Food Agric. 2023, 9, 2157099. [Google Scholar] [CrossRef]
- Awad-Allah, M.M.A.; Shafie, W.W.M.; Alsubeie, M.S.; Alatawi, A.; Safhi, F.A.; ALshamrani, S.M.; Albalawi, D.A.; Al-Amrah, H.; Alshehri, D.; Alshegaihi, R.M.; et al. Utilization of Genetic Resources, Genetic Diversity and Genetic Variability for Selecting New Restorer Lines of Rice (Oryza sativa L.). Genes 2022, 13, 2227. [Google Scholar] [CrossRef]
- Debsharma, S.K.; Syed, M.A.; Ali, M.H.; Maniruzzaman, S.; Roy, P.R.; Brestic, M.; Gaber, A.; Hossain, A. Harnessing on Genetic Variability and Diversity of Rice (Oryza sativa L.) Genotypes Based on Quantitative and Qualitative Traits for Desirable Crossing Materials. Genes 2023, 14, 10. [Google Scholar] [CrossRef] [PubMed]
- Faysal, A.S.M.; Ali, L.; Azam, M.G.; Sarker, U.; Ercisli, S.; Golokhvast, K.S.; Marc, R.A. Genetic Variability, Character Association, and Path Coefficient Analysis in Transplant Aman Rice Genotypes. Plants 2022, 11, 2952. [Google Scholar] [CrossRef] [PubMed]
- Gunasekaran, A.; Seshadri, G.; Ramasamy, S.; Muthurajan, R.; Karuppasamy, K.S. Identification of Newer Stable Genetic Sources for High Grain Number per Panicle and Understanding the Gene Action for Important Panicle Traits in Rice. Plants 2023, 12, 250. [Google Scholar] [CrossRef]
- Khan, M.A.R.; Mahmud, A.; Ghosh, U.K.; Hossain, M.S.; Siddiqui, M.N.; Islam, A.K.M.A.; Anik, T.R.; Rahman, M.M.; Sharma, A.; Abdelrahman, M.; et al. Exploring the Phenotypic and Genetic Variabilities in Yield and Yield-Related Traits of the Diallel-Crossed F5 Population of Aus Rice. Plants 2023, 12, 3601. [Google Scholar] [CrossRef]
- Saleh, M.M.; Salem, K.F.M.; Elabd, A.B. Definition of selection criterion using correlation and path coefficient analysis in rice (Oryza sativa L.) genotypes. Bull. Natl. Res. Cent. 2020, 44, 143. [Google Scholar] [CrossRef]
- Moukoumbi, Y.D.; Bayendi Loudit, S.M.; Sikirou, M.; Mboj, D.; Hussain, T.; Bocco, R.; Manneh, B. Evaluation of Genotypic Variability and Analysis of Yield and Its Components in Irrigated Rice to Stabilize Yields in the Senegal River Valley Affected by Climate Change. Agronomy 2023, 13, 2218. [Google Scholar] [CrossRef]
- IRRI. International Rice Research Institute Descriptors for Rice; SES Standard evaluation system for Rice Los Banos: Laguna, Philippines, 2002; 56p. [Google Scholar]
- Snedecor, G.W.; Cochran, W.G. Statistical Methods, 7th ed.; The Iowa State University Press: Ames, IA, USA, 1990; p. 593. [Google Scholar]
- Bartlett, M.S. Properties of sufficiency and statistical tests. Proc. R. Soc. Lond. Ser. A Math. Phys. Sci. 1937, 160, 268–282. [Google Scholar]
- Burton, G.W. Quantitative inheritance in Pearl millet (Pennisetum glaucum). Agron. J. 1951, 43, 409–417. [Google Scholar] [CrossRef]
- Johnson, H.W.; Robinson, H.F.; Comstock, R.E. Estimates of genetic and environmental variability in soybean. Agron. J. 1955, 47, 314–318. [Google Scholar] [CrossRef]
- Sivasubramanian, S.; Madhavamenon, P. Genotypic variability in rice. Madras Agric. J. 1973, 60, 1093–1096. [Google Scholar]
- Burton, G.; De vane, E. Estimating heritability in tall Fescue (Festuca arundinacea) from replicated Clonal material. Agron. J. 1953, 45, 478–481. [Google Scholar] [CrossRef]
- Gomez, K.A.; Gomez, A. Statistical Procedures for Agricultural Research, 1st ed.; Willey & Sons: New York, NY, USA, 1984. [Google Scholar]
- Weaver, B.; Wuensch, K.L. SPSS and SAS programs for comparing pearson correlations and OLS regression coefficients. Behav. Res. Methods 2013, 45, 880–895. [Google Scholar] [CrossRef] [PubMed]
- Murray, M.G.; Thompson, W.F. Rapid isolation of high molecular weight plant DNA. Nucleic Acids Res. 1980, 8, 4321–4326. [Google Scholar] [CrossRef] [PubMed]
- Rohlf, F.J. NTSYSpc Numeric Taxonomy and Multivariate Analysis System, Version 2.1; Exeter Publications: New York, NY, USA, 2000. [Google Scholar]
- Anderson, J.A.; Churchill, G.A.; Autrique, J.E.; Tanksley, S.D.; Sorrells, M.E. Optimizing parental selection for genetic linkage maps. Genome 1993, 36, 181–186. [Google Scholar] [CrossRef]
- FAO. Faostat Data. Available online: https://www.fao.org/faostat/en/#compare (accessed on 12 January 2023).
- USDA. Nathan Childs and Bonnie LeBeau, Rice Outlook: November 2022, RCS-22J; U.S. Department of Agriculture, Economic Research Service: Washington, DC, USA, 2022.
- Sedeek, S.E.M.; Hammoud, S.A.A.; Ammar, M.H.; Metwally, T.F. Genetic variability, heritability, genetic advance and cluster analysis for some physiological traits and yield and its components in rice (Oryza sativa L.). J. Agric. Res. Kafer EL-Sheikh Univ. 2009, 35, 858–878. [Google Scholar]
- Kumar, R.; Kaushal, S.; Shukla, Y.R. Variability, Correlation, and Path Analysis Studies in Lettuce. Int. J. Veg. Sci. 2010, 16, 299–315. [Google Scholar] [CrossRef]
- Pratap, A.; Bisen, P.; Lotongbam, B.; Sandhya; Singh, P.K. Assessment of genetic variability for yield and yield components in rice (Oryza sativa L.) germplasms. Int. J. Bio-Resour. Stress Manag. 2018, 9, 87–92. [Google Scholar] [CrossRef]
- Dhakal, A.; Sharma, S.; Pokhrel, A.; Poudel, A. Variability and heritability estimate of 30 rice landraces of lamjung and Tanahun districts, Nepal. Indones. J. Agric. Sci. 2020, 21, 1–10. [Google Scholar] [CrossRef]
- Nayak, A.R.; Chaudhury, D.; Reddy, J.N. Correlation and path analysis in scented rice. Indian J. Agric. Res. 2001, 35, 186–189. [Google Scholar]
- Nayak, A.R.; Reddy, J.N. Seasonal influence on quality characters in scented rice. Indian J. Genet. Plant Breed. 2005, 65, 127–128. [Google Scholar]
- Cho, Y.C.; Suh, J.P.; Choi, I.S.; Hong, H.C.; Baek, M.K.; Kang, K.H.; Kim, Y.G.; Ahn, S.N.; Choi, H.C.; Hwang, H.G.; et al. QTLs analysis of yield and its related traits in wild rice relative Oryza rufipogon. Treat. Crop Res. 2003, 4, 19–29. [Google Scholar]
- Suh, J.P.; Ahn, S.N.; Cho, Y.C.; Kang, K.H.; Choi, I.S.; Kim, Y.G.; Suh, H.S.; Hong, H.C. Mapping of QTLs for yield traits using an advanced backcross population from a cross between Oryza sativa and O. glaberrima. Korean J. Breed. 2005, 37, 214–220. [Google Scholar]
- Thomson, M.J.; Tai, T.H.; McClung, A.M.; Lai, X.-H.; Hinga, M.E.; Lobos, K.B.; Xu, Y.; Martinez, C.P.; McCouch, S.R. Mapping quantitative trait loci for yield, yield components and morphological traits in an advanced backcross population between Oryza rufipogon and the Oryza sativa cultivar Jefferson. Theor. Appl. Genet. 2003, 107, 479–493. [Google Scholar] [CrossRef]
- Moncada, P.; Martínez, C.; Borrero, J.; Chatel, M.; Gauch, H., Jr.; Guimaraes, E.; Tohme, J.; McCouch, S.R. Quantitative trait loci for yield and yield components in an Oryza sativa×Oryza rufipogon BC2F2 population evaluated in an upland environment. Theor. Appl. Genet. 2001, 102, 41–52. [Google Scholar] [CrossRef]
- Mei, H.W.; Li, Z.K.; Shu, Q.Y.; Guo, L.B.; Wang, Y.P.; Yu, X.Q.; Ying, C.S.; Luo, L.J. Gene actions of QTLs affecting several agronomic traits resolved in a recombinant inbred rice population and two backcross populations. Theor. Appl. Genet. 2005, 110, 649–659. [Google Scholar] [CrossRef]
- Lafitte, H.R.; Courtois, B.; Arraudeau, M. Genetic improvement of rice in aerobic systems: Progress from yield to genes. Field-Crops-Res. 2002, 75, 171–190. [Google Scholar] [CrossRef]
- Tian, F.; Li, D.J.; Fu, Q.; Zhu, Z.F.; Fu, Y.C.; Wang, X.K.; Sun, C.Q. Construction of introgression lines carrying wild rice (Oryza rufipogon Griff.) segments in cultivated rice (Oryza sativa L.) background and characterization of introgressed segments associated with yield-related traits. Theor. Appl. Genet. 2006, 112, 570–580. [Google Scholar] [CrossRef]
- Hua, J.; Xing, Y.; Wu, W.; Xu, C.; Sun, X.; Yu, S.; Zhang, Q. Single-locus heterotic effects and dominance by dominance interactions can adequately explain the genetic basis of heterosis in an elite rice hybrid. Proc. Natl. Acad. Sci. USA 2003, 100, 2574–2579. [Google Scholar] [CrossRef]
Variety | Pedigree | Type |
---|---|---|
Giza 178 | Giza 175/Milyang 49 | Indica/Japonica |
GZ12020-7-2-7-1 | Giza 178/GZ1368-S-5-4 | Indica/Japonica |
GZ12020-7-2-7-4 | Giza 178/GZ1368-S-5-4 | Indica/Japonica |
GZ12020-7-2-9-4 | Giza 178/GZ1368-S-5-4 | Indica/Japonica |
GZ12020-7-2-9-5 | Giza 178/GZ1368-S-5-4 | Indica/Japonica |
GZ12020-7-2-10-3 | Giza 178/GZ1368-S-5-4 | Indica/Japonica |
GZ1368-S-5-4 | IR1615/BY 94 | Indica/Japonica |
GZ12021-4-1-1-5 | Giza 178/GZ6296-12-1-2-1-1 | Indica/Japonica |
GZ12021-4-1-1-6 | Giza 178/GZ6296-12-1-2-1-1 | Indica/Japonica |
GZ12021-4-1-2-5 | Giza 178/GZ6296-12-1-2-1-1 | Indica/Japonica |
GZ12021-4-1-3-2 | Giza 178/GZ6296-12-1-2-1-1 | Indica/Japonica |
GZ12021-7-8-13-4 | Giza 178/GZ6296-12-1-2-1-1 | Indica/Japonica |
GZ12021-7-8-14-2 | Giza 178/GZ6296-12-1-2-1-1 | Indica/Japonica |
GZ12021-13-14-22-2 | Giza 178/GZ6296-12-1-2-1-1 | Indica/Japonica |
GZ12021-13-14-22-5 | Giza 178/GZ6296-12-1-2-1-1 | Indica/Japonica |
GZ6296-12-1-2-1-1 | AC1225/Hua lien Yu 202 | Indica/Japonica |
Marker | Ch. | Forward | Reverse |
---|---|---|---|
RM302 | 1 | tcatgtcatctaccatcacac | atggagaagatggaatacttgc |
RM279 | 2 | gcgggagagggatctcct | ggctaggagttaacctcgcg |
RM7 | 3 | ttcgccatgaagtctctcg | cctcccatcatttcgttgtt |
RM410 | 9 | gctcaacgtttcgttcctg | gaagatgcgtaaagtgaacgg |
RM511 | 12 | cttcgatccggtgacgac | aacgaaagcgaagctgtctc |
Genotypes | DU | PH | NPP | PL | FGP | UFGP | GW | GY | Rank |
---|---|---|---|---|---|---|---|---|---|
Giza 178 | 15 | 13 | 5 | 7 | 12 | 10 | 15 | 5 | 82 |
GZ12020-7-2-10-3 | 5 | 14 | 1 | 3 | 13 | 5 | 2 | 4 | 47 |
GZ12020-7-2-7-1 | 12 | 11 | 11 | 6 | 9 | 13 | 13 | 15 | 90 |
GZ12020-7-2-7-4 | 11 | 5 | 8 | 5 | 7 | 9 | 14 | 8 | 67 |
GZ12020-7-2-9-4 | 4 | 10 | 2 | 4 | 3 | 2 | 4 | 3 | 32 |
GZ12020-7-2-9-5 | 6 | 9 | 6 | 8 | 8 | 4 | 5 | 7 | 53 |
GZ1368-S-5-4 | 13 | 4 | 7 | 9 | 11 | 1 | 10 | 11 | 66 |
GZ12021-13-14-22-2 | 14 | 15 | 4 | 2 | 6 | 15 | 16 | 6 | 78 |
GZ12021-13-14-22-5 | 16 | 16 | 3 | 1 | 1 | 7 | 12 | 14 | 70 |
GZ12021-4-1-1-5 | 1 | 6 | 10 | 15 | 2 | 14 | 1 | 1 | 50 |
GZ12021-4-1-1-6 | 8 | 7 | 9 | 16 | 10 | 16 | 7 | 12 | 85 |
GZ12021-4-1-2-5 | 9 | 3 | 13 | 11 | 4 | 6 | 6 | 2 | 54 |
GZ12021-4-1-3-2 | 10 | 2 | 14 | 13 | 5 | 8 | 9 | 9 | 70 |
GZ12021-7-8-13-4 | 2 | 8 | 16 | 14 | 15 | 3 | 8 | 13 | 79 |
GZ12021-7-8-14-2 | 3 | 12 | 15 | 12 | 14 | 12 | 3 | 10 | 81 |
GZ6296-12-1-2-1-1 | 7 | 1 | 12 | 10 | 16 | 11 | 11 | 16 | 84 |
Trait | Gran Mean | GV | PV | GCV | PCV | h2 | GA% |
---|---|---|---|---|---|---|---|
Duration | 126.88 | 18.18 | 18.85 | 3.36 | 3.42 | 96.4 | 37.45 |
Plant height | 99.08 | 36.29 | 36.83 | 6.08 | 6.13 | 98.5 | 74.73 |
No. of panicles | 22.52 | 4.34 | 4.99 | 9.25 | 9.92 | 86.9 | 8.93 |
Panicle length | 22.81 | 1.54 | 1.66 | 5.44 | 5.64 | 92.71 | 3.16 |
No. of filled grains | 154.65 | 701.08 | 710.86 | 17.12 | 17.24 | 98.6 | 1443.8 |
No. of unfilled grain | 11.42 | 75.22 | 77.43 | 75.94 | 77.05 | 97.1 | 154.8 |
1000-grain weight | 24.74 | 4.29 | 4.49 | 8.37 | 8.56 | 95.5 | 9.20 |
Grain yield | 9.76 | 0.916 | 0.930 | 9.80 | 9.88 | 98.4 | 1.88 |
Trait | Gran Mean | GV | PV | GCV | PCV | h2 | GA% |
---|---|---|---|---|---|---|---|
Duration | 128.3 | 16.98 | 17.69 | 3.21 | 3.27 | 95.9 | 34.97 |
Plant height | 95.6 | 17.53 | 18.39 | 4.37 | 4.48 | 95.3 | 36.11 |
No. of panicles | 22.95 | 3.85 | 4.36 | 8.54 | 9.09 | 88.3 | 7.93 |
Panicle length | 21.60 | 1.28 | 1.42 | 5.23 | 5.52 | 90.0 | 2.63 |
No. of filled grains | 137.75 | 330.12 | 342.48 | 13.18 | 13.43 | 96.4 | 680.1 |
No. of unfilled grain | 14.45 | 82.09 | 84.29 | 62.70 | 63.53 | 97.3 | 168.94 |
1000-grain weight | 27.1 | 6.05 | 6.30 | 9.07 | 9.26 | 96.0 | 12.45 |
Grain yield | 10.0 | 0.47 | 0.48 | 2.18 | 6.99 | 97.7 | 0.98 |
Duration | Plant Height | No. of Panicles | Panicle Length | No. of Filled Grains | No. of Unfilled Grain | 1000-Grain Weight | Grain Yield | |
---|---|---|---|---|---|---|---|---|
Duration | 1 | 0.274 | 0.304 | 0.410 | 0.56 | −0.77 | −0.593 * | −0.30 |
Plant height | 1 | 0.410 | 0.585 * | 0.035 | −0.281 | −0.059 | 0.353 | |
No. of panicles | 1 | 0.588 * | 0.301 | −0.116 | −0.193 | 0.572 * | ||
Panicle length | 1 | 0.317 | −0.266 | −0.611 * | 0.225 | |||
No. of filled grains | 1 | −0.278 | −0.95 | 0.590 * | ||||
No. of unfilled grain | 1 | −0.178 | −0.372 | |||||
1000-grain weight | 1 | 0.570 * | ||||||
Grain yield | 1 |
Duration | Plant Height | No. of Panicles | Panicle Length | No. of Filled Grains | No. of Unfilled Grain | 1000-Grain Weight | Grain Yield | |
---|---|---|---|---|---|---|---|---|
Duration | 1 | 0.231 | 0.437 | 0.576 * | 0.165 | 0.045 | −0.705 ** | −0.238 |
Plant height | 1 | 0.165 | 0.304 | 0.644 ** | 0.476 | −0.048 | 0.101 | |
No. of panicles | 1 | 0.470 | 0.259 | 0.250 | −0.152 | 0.571 * | ||
Panicle length | 1 | 0.145 | −0.109 | −0.624 * | −0.270 | |||
No. of filled grains | 1 | 0.363 | 0.091 | 0.580 * | ||||
No. of unfilled grain | 1 | −0.122 | 0.205 | |||||
1000-grain weight | 1 | 0.540 * | ||||||
Grain yield | 1 |
Marker | Ch. | Number of Alleles | PIC |
---|---|---|---|
RM511 | 12 | 1 | 0.499 |
RM302 | 1 | 2 | 0.374 |
RM410 | 9 | 3 | 0.400 |
RM279 | 2 | 3 | 0.383 |
RM7 | 3 | 2 | 0.374 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Almasoud, W.A.; Abdel-Sattar, M.; Sedeek, S.; Elgammaal, A.A.; El-Refaee, N.; Ramadan, I.A.; Abdulmajid, D.; Rihan, H.Z. The Path Towards Novel Varieties: Investigating Phenotypic-Genetic Diversity in New Promising Egyptian Rice Lines. Agronomy 2024, 14, 2775. https://doi.org/10.3390/agronomy14122775
Almasoud WA, Abdel-Sattar M, Sedeek S, Elgammaal AA, El-Refaee N, Ramadan IA, Abdulmajid D, Rihan HZ. The Path Towards Novel Varieties: Investigating Phenotypic-Genetic Diversity in New Promising Egyptian Rice Lines. Agronomy. 2024; 14(12):2775. https://doi.org/10.3390/agronomy14122775
Chicago/Turabian StyleAlmasoud, Waleed A., Mahmoud Abdel-Sattar, Saber Sedeek, Amgad A. Elgammaal, Nouran El-Refaee, Ibrahem A. Ramadan, Dina Abdulmajid, and Hail Z. Rihan. 2024. "The Path Towards Novel Varieties: Investigating Phenotypic-Genetic Diversity in New Promising Egyptian Rice Lines" Agronomy 14, no. 12: 2775. https://doi.org/10.3390/agronomy14122775
APA StyleAlmasoud, W. A., Abdel-Sattar, M., Sedeek, S., Elgammaal, A. A., El-Refaee, N., Ramadan, I. A., Abdulmajid, D., & Rihan, H. Z. (2024). The Path Towards Novel Varieties: Investigating Phenotypic-Genetic Diversity in New Promising Egyptian Rice Lines. Agronomy, 14(12), 2775. https://doi.org/10.3390/agronomy14122775