Next Article in Journal
Development and Trait-Based Molecular Characterization of Thermosensitive Genic Male-Sterile Rice (Oryza sativa L.) Lines at Texas A&M AgriLife Research
Previous Article in Journal
Research Progress on Land Use and Analysis of Green Transformation in China Since the New Century
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

The Path Towards Novel Varieties: Investigating Phenotypic-Genetic Diversity in New Promising Egyptian Rice Lines

1
Department of Agricultural Engineering, College of Food and Agriculture Sciences, King Saud University, P.O. Box 2460, Riyadh 11451, Saudi Arabia
2
Department of Plant Production, College of Food and Agriculture Sciences, King Saud University, P.O. Box 2460, Riyadh 11451, Saudi Arabia
3
Rice Research and Training Center, Field Crops Research Institute, A.R.C., Sakha, Kafrelsheikh 33717, Egypt
4
Agronomy Department, Faculty of Agriculture, Tanta University, Tanta 31527, Egypt
5
School of Biological and Marine Sciences/Plymouth, University of Plymouth, Plymouth PL4 8AA, UK
*
Author to whom correspondence should be addressed.
Agronomy 2024, 14(12), 2775; https://doi.org/10.3390/agronomy14122775
Submission received: 3 November 2024 / Revised: 20 November 2024 / Accepted: 21 November 2024 / Published: 22 November 2024
(This article belongs to the Section Crop Breeding and Genetics)

Abstract

Rice (Oryza sativa L.) has an impressive range of phenotypic and genetic diversity, making it an important crop for global food security. Since rice phenotypic and genetic diversity are essential for enhancing the sustainability of rice production, an understanding of these variations is crucial for breeding efforts. Numerous factors, such as plant height, panicle number, grain properties, etc., exhibit phenotypic diversity in rice. Moreover, genetic diversity is essential for breeding and enhancing rice in multiple manners. This research investigates the phenotypic diversity of thirteen promising lines relative to their parents. Since the genetic effect reflects the plant’s phenotype, forty SSR markers were used to investigate the genotypic diversity. Generally, six promising genotypes produced much better grain yields than their parents. Across two years, the number of filled grains panicle−1 and the number of unfilled grains panicle−1 had the highest phenotypic and genotypic coefficients of variability percentage. The challenges towards novel variety with distinct characteristics were met in several promising lines under examination, which showed a significant and positive association between the grain yield and the number of panicles per plant, the number of filled grains per panicle, and the 1000-grain weight. Furthermore, five SSR markers were discovered to be polymorphic during the genetic diversity investigation, and the genotypes were classified into five clusters based on SSR marker data. The findings, together with further details, can be used to release novel and unique varieties.

1. Introduction

Climate change poses a barrier to enhancing rice production, which is one of the world’s most important staple foods [1]. Furthermore, rice cultivation is an extremely climate-sensitive agro-ecosystem [2]. The development of rice varieties with improved yield potential is an objective of the rice breeding program in Egypt. Therefore, further research and strategies that consider the specific climatic conditions and rice varieties in each location are essential to increase the sustainability of rice production in the face of climate change [3]. Selecting the right kind of parents for a hybridization program is the most important tool for a plant breeder. The use of genetic diversity to select parents for a successful hybridization and breeding program is a smart idea [4].
Rice phenotypic diversity pertains to the observable characteristics and properties of rice plants that differ among varieties. This diversity is essential for adjusting to different ecosystems and agricultural approaches [5]. This diversity is widespread worldwide, with rice germplasm resources including a wide range of genetic variants. The roles of structural variants in plant domestication and phenotypic variety development are not well understood, but they are thought to play a key part [6]. In a study of 307 traditional rice varieties, phenotypic diversity indices averaged 0.73 and 0.45 for quantitative and qualitative parameters, respectively, indicating significant variation in rice phenotypes [7]. In comparison, the phenotypic variance outperformed the genotypic variance for all examined characteristics [8]. Additionally, the broad-sense heritability for all traits in both seasons varied from 0.35 to 0.99 [9], while both the qualitative and quantitative parameters showed a high degree of variation across the genotypes and a highly significant difference (p < 0.001) [10]. Further investigation revealed that the results of the analysis of variance showed highly significant differences in all features between the genotypes that were subjected to the study [11]. For the majority of the characteristics, the phenotypic and genotypic coefficients of variation were moderate. This suggests that advantageous genetic diversity exists and can be used to enhance these characteristics. Additional research revealed significant differences across all genotypes for every characteristic analyzed, suggesting a more thorough comprehension of genetic diversity for selection [12]. There was substantial genetic diversity in most of the variables that were being studied. All of the characteristics demonstrated higher heritability and genetic advancement, indicating the possibility of effective selection. Genetic variables played a key impact in the expressivity of the studied characteristics, and all of the characteristics showed that the environment had a minor impact on the trait’s expression [13]. Except for panicle length, all traits had moderate to high genetic advancement and high broad-sense heritability. Fifty different germplasms of Indian origin were examined for genetic diversity [14]. The results showed that the no. of spikelets and the no. of filled grains per panicle had the highest genotypic and phenotypic coefficient of variation. By enhancing panicle characteristics, particularly grain number, the data gathered from this research will help increase grain yield. For the variables being studied, such as days to maturity, plant height, panicle length, and 1000-grain weight, the genotypic coefficient of variation was greater than the environmental coefficient of variation [15]. Furthermore, the high broad-sense heritability of identical traits indicates that the observed differences in these qualities between rice accessions are mostly influenced by genetic factors.
Correlation analysis revealed that the number of panicles per plant, the full grain number per panicle, and the 1000-grain weight were all very positively and significantly correlated (p ≤ 0.01) with grain yield per plant [16]. Despite a correlation between several phenotypic and yield parameters of 300 genotypes of irrigated rice, there were significant positive and negative correlations between the traits under investigation and grain yield [17]. According to path analysis, the harvest index had the greatest direct positive impact, while the days to heading had the greatest negative direct impact. Further correlation analysis revealed that the number of panicles per plant, the number of full grains per panicle, and the 1000-grain weight were all significantly and positively correlated with the total amount of grain yield per plant [16]. However, the number of panicles per plant, days to heading, and 1000-grain weight were all negatively correlated. The following variables had an enormous direct impact on grain yield per plant and a positive and substantial correlation: 1000-grain weight, panicle number per plant, and full grain number per panicle. Furthermore, correlation analysis demonstrated a highly significant positive association between grains per panicle and yield per plant, which might be employed as a selection criterion in rice breeding [12]. On the other hand, 1000-grain weight and the no. of tillers per hill were positively correlated with fertility. Furthermore, there was a positive correlation between the 1000-grain weight and both the length of the panicle and the grain yield per plant.
The current study set out to identify the phenotypic and genetic diversity by (1) analyzing and comparing the newly elite lines’ mean performance with their parents for some vegetative characteristics, yield and its components, and some panicle features and (2) investigating the genetic diversity of genotypes and its relationship to desirable traits.

2. Materials and Methods

2.1. Plant Materials

The current study was conducted at the Rainfed Irrigated Experimental Farm of the Rice Research and Training Centre (RRTC), Sakha, Kafr EL-Sheikh, Egypt, during the two successive rice seasons of 2023 and 2024 to investigate the plant characteristics and inheritance of some vegetative, yield and yield components, and panicle characteristics. The study involved the selection of sixteen rice genotypes, which varied significantly in terms of their genetic backgrounds. The selected genotypes included three parents: Giza 178 (commercial variety tolerant to salt and water deficiency), GZ1368-S-5-4 (tolerant to salinity and water deficiency), and GZ6296-12-1-2-1-1. The rest of the genotypes were fixed lines (Fn) which were generated via crossing Giza 178 with GZ1368-S-5-4 and Giza 178 with GZ6296-12-1-2-1-1 (Table 1).

2.2. Field Planting

The experiment was carried out in a randomized complete design with three replications. In each replication, 16 rice genotypes were sown on May 1st and were transplanted after 30 days of sowing in seven rows with a length of 5 m for each row. As part of the land preparation process, 36 kg P2O5 ha−1 was added as the basal application in the form of single upper phosphate (15%) and incorporated with soil. Nitrogen fertilizer at a rate of 165 kg Nha−1 in the form of urea (46.5%) was added in two doses: 2/3 as a basal treatment and integrated with soil during land preparation, and the second dose was applied 30 days after transplantation.

2.3. Phenotypic Evaluation and Data Analysis

The variables evaluated were days to maturity (days), plant height (cm), number of panicles plant-1, panicle length (cm), number of filled grains panicle-1, number of empty grains panicle-1, 1000-grain weight (g), and grain yield (t/ha), which were measured according to SES [18]. Analysis of variance was conducted for each season according to Sendecor and Cochran [19]. Error variances from separate analyses of the data were tested for homogeneity using the Bartlett test [20]. Phenotypic (PCV%) and genotypic (GCV%) coefficients of variability were estimated according to the method of Burton [21]. The expected genetic advancement from selection for the studied traits as well as the phenotypic correlation between any pairs of traits was calculated according to Johnson et al. [22]. The values of GCV% and PCV% were estimated according to Sivasubramanian and Madhavamenon [23]. Heritability in a broad sense was determined based on Burton and De Vane [24]. The relationship among the important characteristics in this study was assessed statistically through simple correlation, as reported by Gomez and Gomez [25], using SPSS statistics 19 [26].

2.4. SSR Marker Genotyping and Data Analysis

Total genomic DNA was isolated using the CTAB procedure described by Murray and Thompson) [27]. The amount and purity of DNA were measured using 0.8% agarose gel electrophoresis and diluted uncut lambda phage DNA as a size standard. DNA concentration was adjusted to around 15 ng/μL for the PCR process.
Forty SSR markers were utilized to determine genetic diversity in 14 rice genotypes, but only five markers met the aims of our study, which are shown in Table 2. PCR amplification reactions were performed in 10 μL reaction mixtures, containing 1 μL of template DNA, 2 μL of each forward and reverse primer, 3 μL ddH2O, and 5 μL of 2X GoTaq Green Master Mix (Promega, Madison, WI, USA). The reaction mixture was first denatured for 5 min at 95 °C, followed by 35 cycles of denaturation for 1 min at 94 °C, annealing at 2 °C for 30 s and elongation at 72 °C for 1 min, and a final extension at 72 °C for 10 min. PCR amplification was loaded in 3% agarose gel containing Ethidium Bromide for electrophoresis in 1X TAE (pH 8.0). DNA ladder (100 bp) was used for the determination of the size of amplicons. The gel was run at 60 volts (2.5 V/cm) for 3 h and photographed using a Biometra gel documentation unit (BioDoc, Biometra, Germany).
The amplified products of SSR marker analysis were quantified as either (1) presence or (0) absence based on every possible combination of marker allele and genotype. As a result, the similarity matrix and dendrogram were generated using UPGMA, which is included in NTSYSpc 2.21 p [28]. The similarity was then analyzed using NTSYS’s SIMQUAL function. The polymorphism information content (PIC) value of a marker was calculated according to the following formula of Anderson et al. [29].
PIC = 1 j = 1 n p i j 2
where p i j is the frequency of jth allele for the ith marker.

3. Results

3.1. Phenotypic Variations

During the 2023 and 2024 rice seasons, five promising lines derived from crossing the Egyptian rice cultivar Giza 178 with GZ1368-S-5-4 and eight rice genotypes derived from hybridization between Giza 178 and GZ6296-12-1-2-1-1 and their parents were evaluated in order to study the genetic diversity among some of the rice genotypes and their parents. The duration from sowing to harvest varied greatly amongst the rice genotypes and their parents. Regarding the rice genotype derived from hybridization between Giza 178 and GZ1368-S-5-4, the rice genotypes GZ 12020-7-2-9-5 and GZ12020-7-2-10-3 recorded the lowest values of days to maturity in both seasons of investigation 125 days. In contrast, the greatest values were observed by their parents (Giza 178 and GZ1368-S-5-4) at 135 days (Figure 1).
In terms of rice genotypes resulting from a cross between Giza 178 and GZ6296-12-1-2-1-1, the elite lines, GZ12021-4-1-1-5 and GZ12021-7-8-13-4, had shorter total durations than their parents. In both seasons, the two promising lines resulted in (123.3, 124.6) and (124.6, 124.6) days. While the parents Giza 178 and GZ6296-12-1-2-1-1 reported 135, 136, 125, and 125.6 days, respectively, in the same seasons of investigation (Figure 1).
Plant height in season 2023 was generally higher than plant height in season 2024 for all rice genotypes. According to data in Figure 2, the majority of rice genotypes showed plant heights that were desirable in both of the research seasons (2023 and 2024). This suggests that these elite genotypes are short in stature and are well-suited for mechanical harvesting, which can save time, labor, and money, and increase farmer income.
Rice varieties vary significantly in the number of panicles/plant due to variations in the genetic backgrounds among them. The lines GZ12020-7-9-4, GZ12020-7-2-9-5, and GZ12020-7-2-10-3, produced from crossing Giza 178 with GZ1368-S-5-4, gave the highest number of panicles/plant in both seasons of research compared to GZ1368-S-5-4 (Figure 3). For the genotypes obtained from hybridizations between Giza 178 and GZ6296-12-1-2-1-1, the data reported that GZ12021-13-14-22-2 and GZ12021-13-14-22-5 recorded the highest number of panicles/plant with no significant difference with their parent Giza 178 and with highly significant differences with the other parent, GZ6296-12-1-2-1-1 (Figure 3).
In both seasons of investigation (2023 and 2024), Giza 178 and its fixed progenies GZ12020-7-2-9-4 and GZ12020-7-2-10-3 produced the longest panicles compared to GZ1368-S-5-4 and other genotypes of the same cross, as shown in Figure 4. The hybrid combinations of Giza 178 and GZ6296-12-1-2-1-1, identified as GZ12021-13-14-22-2 and GZ12021-13-14-22-5, gave the highest panicle lengths, with a highly significant difference from the other parent, GZ6296-12-1-2-1-1 (Figure 4).
In both seasons, the elite lines (GZ12020-7-2-9-4, GZ12020-7-2-7-4, and GZ12020-7-2-9-5) developed from hybridization between Giza 178 and GZ1368-S-5-4 produced the highest values of no. of filled grains/panicle compared to their parents (Figure 5). GZ12021-4-1-1-5, GZ12021-4-1-2-5, GZ12021-4-1-3-2, GZ12021-13-14-22-2, and GZ12021-13-14-22-5 had the maximum number of filled grains/panicle compared to their parents (Giza 178 and GZ6296-12-1-2-1-1) in both the 2023 and 2024 seasons (Figure 5).
The investigation found that the GZ12020-7-2-9-4 and GZ12020-7-2-9-5 varieties, which were obtained from crossing Giza 178 with GZ1368-S-5-4, and GZ12021-7-8-13-4, which was generated from crossing Giza 178 with GZ6296-12-1-2-1, had the lowest values of unfilled grains/panicle (Figure 6).
According to Figure 7, the rice genotypes differed significantly in 1000-grain weight. In both seasons of inquiry, the rice genotypes GZ12020-7-2-10-3, GZ12020-7-2-9-4, and GZ12020-7-2-9-5 recorded the heaviest 1000-grain weights when compared to their parent Giza 178. Giza 178 produced 22.4 and 23.6 g in 2023 and 2024, whereas the elite lines produced 27.2, 25.9, 25.6, 29.1, 29.0, and 29.1 g in the same years. In both seasons of study, the genotypes GZ12021-4-1-1-5, GZ12021-4-1-2-5, GZ12021-7-8-13-4, and GZ12021-7-8-142 had the highest 1000-grain weight values compared to their parents, Giza 178 and GZ6296-12-1-2-1-1 (Figure 7).
In both seasons of research, the rice genotypes GZ12020-7-2-9-4, GZ12020-7-2-9-5, and GZ12020-7-2-10-3 produced better grain yields than their parent GZ1368-S-5-4, with no significant difference from the other parent, Giza 178 (Figure 8). For the genotypes generated from Giza 178 and GZ6296-12-1-2-1-1, the rice genotypes GZ12021-4-1-1-5, GZ12021-4-1-2-5, and GZ12021-13-14-22-2 exhibited better grain yield than their parents in 2023 and 2024 (Figure 8).
Based on the available data, there were no significant variations between the two studied seasons for all characteristics. On the other hand, it can be inferred that the rice genotypes GZ12020-7-2-9-4, GZ12020-7-2-9-5, and GZ12020-7-2-10-3, which were obtained through crossing Giza 178 and GZ1368-S-5-4, as well as GZ12021-4-1-1-5, GZ12021-4-1-2-5, and GZ12021-13-14-22-5, which were derived from Giza 178 and GZ6296-12-1-2-1-1, were the most optimal genotypes in terms of yield and its components when compared with their parents. Meanwhile, the superior lines when considering all characteristics were GZ12020-7-2-9-4, GZ12020-7-2-9-5, GZ12020-7-2-10-3, GZ12021-4-1-1-5, and GZ12021-4-1-2-5, according to the rankings in Table 3.

3.2. Estimates of Genetic Parameters

In both seasons (2023 and 2024), overall heritability was high for all analyzed characteristics (Table 3 and Table 4). High heritability estimates are beneficial for phenotype-based selection. Table 3 and Table 4 show genotypic variance (GV), phenotypic variance (PV), phenotypic coefficient of variance (PCV%), genotypic coefficient of variability (GCV%), broad sense heritability (h2), and genetic advancement (GA%).
The data showed that the phenotypic coefficient of variability was greater than the genotypic coefficient of variability for all traits, indicating that the environment has an effect on the expression of these traits; however, the genotypic component contributed the most to PCV%, followed by the environmental component. In both the 2023 and 2024 rice seasons, the number of filled grains panicle-1 and number of unfilled grains panicle-1 had the highest phenotypic coefficient of variability (%) and genotypic coefficient of variability (%), respectively (Table 4 and Table 5).
Table 3 and Table 4 show high heritability along with high genetic advancement for the number of filled grains panicle-1 and the number of unfilled grains panicle-1. Furthermore, all the traits showed high G.C.V% with high heritability estimates in a broad sense. Thus, the genetic advancement (GA%) from selection appeared to be effective for these characteristics.

3.3. Correlation Coefficient

According to Gomez and Gomez [25], the correlations between some agronomical variables and yield and its constituent parts were evaluated statistically using SPSS version 10 for Windows 10. Table 6 and Table 7 summarize the correlation coefficients among the studied attributes.
According to the findings in 2023, Table 6 showed a positive and significant correlation between panicle length and both the plant height and the number of panicles per plant (0.585* and 0.588*), as well as a significant positive correlation between grain yield and the number of panicles per plant, the number of filled grains per panicle, and the 1000-grain weight (0.572*, 0.590*, and 0.570*, respectively). However, there was a significant and negative correlation found between the 1000-grain weight and the duration and panicle length (−0.593* and −0.611*, respectively).
Regarding the correlation coefficients among the studied traits in the 2024 rice season, the results in Table 7 indicated the same trend observed in the 2023 rice season in addition to a new highly significant and positive correlation between plant height and no. of filled grains per panicle (0.644**) and a positive and significant correlation between duration and panicle length (0.576*).

3.4. Genetic Diversity Revealed by SSR Markers

In this research, 40 SSR markers were utilized to determine genetic variability among 16 genotypes. Five SSR markers were found to be polymorphic during the SSR marker study (Figure 9). The polymorphic information content (PIC) value for the used markers ranged from 0.374 (RM302 on Chromosome 1, RM7 on Chromosome 3) to 0.499 (RM511 on Chromosome 12) (Table 8). These results indicate low genetic diversity, as the genotypes are composed of parents and their offspring.

3.5. Cluster Analysis and Genetic Divergence Pattern

In order to generate similarity values between the genotypes under study, the input matrix for the genetic diversity among the genotypes was generated for SSR markers alleles. Five clusters were formed out of the genotypes (Figure 10). Five genotypes made up Cluster Ⅰ (GZ12020-7-2-7-1, GZ12020-7-2-7-4, GZ12021-7-8-13-4, GZ12021-7-8-14-2, and GZ6296-12-1-2-1-1) and were further split into two sub-clusters (Ⅰa and Ⅰb) that were divided at a similarity value of 0.77. Cluster Ⅱ had two genotypes (12020-7-2-9-4 and GZ12020-7-2-9-5) that had a similarity value of 0.70 compared to other clusters. Alternatively, cluster Ⅲ, which was distinguished from other clusters by a similarity value of 0.66, had five genotypes (GZ12020-7-2-10-3, GZ12021-4-1-1-5, GZ12021-4-1-1-6, GZ12021-4-1-2-5, and GZ12021-4-1-3-2) with an identical similarity value. Cluster Ⅳ contains three genotypes (Giza178, GZ12021-13-14-22-2, and GZ12021-13-14-22-5) and splits into two sub-clusters (Ⅳa and Ⅳb) with a similarity value of 0.82. Cluster Ⅴ has a single genotype (GZ1368) that has a similarity value of 0.39 to the other clusters.

4. Discussion

Releasing new high-yielding, early-maturing varieties of promising genotypes to maximize the grain yield of the new genotype varieties’ production potential was a great challenge in the context of a changing climate. The selected genotypes were examined in the experimental field of the Rice Research & Training Center, Egypt, during the 2023 and 2024 rice seasons. The grain yield averages of some promising genotypes were significantly higher than the commercial cultivar Giza 178 and their male parents GZ1368-S-5-4 and GZ6296-12-1-1-1-1. Based on data from the FAO [30] and USDA [31], the rice crop in Egypt has a greater harvested area and a higher yield. Furthermore, the elite genotypes were of short stature. Thus, they are suitable for mechanized harvest due to their short stature compared to Sakha 104 and Sakha 102. Sedeek et al. [8] reported that the reduction in plant height may be due to the reduction in cell turgor, which induces a reduction in cell enlargement and thus into a decrease in shoot enlargement and plant height.
A wide range of variability was observed among the rice varieties for all traits over the two seasons, where mean squares were highly significant. Therefore, the selection would be effective among the rice genotypes for these characteristics. Similar results were obtained by Sedeek et al. [32] and Kumar et al. [33]: the phenotypic coefficient of variability was higher than the genotypic coefficient of variability for all traits, and the phenotypic coefficient of variability was higher than the genotypic coefficient of variability for all traits.
Broad-sense heritability was high for all studied traits. This indicates that the selection process for these traits would certainly bring improvement in the genotypes. Burton [21], Pratap et al. [34], and Dhakal et al. [35] indicated that the genotypic coefficient of variability with heritability estimates would give a good prediction of genetic advancement from the selection. So, the expected gain from selection would be a better indication of the selection response. All the traits showed high G.C.V% with high heritability estimates in the broad sense. Thus, the genetic advance (GA%) from selection appeared to be effective for these characteristics.
Grain yield was indicated positively and significantly associated with several panicles per plant, the number of filled grains per panicle, and the 1000-grain weight, indicating the importance of these traits as selection criteria in yield enhancement programs. The results agree with the findings of Nayak et al. [36] and Nayak and Reddy [37].
Rice plant duration is an important feature for breeders, and is counted by days to heading. Furthermore, the use of SSR markers has proven to be effective in predicting genetic diversity and confirming phenotypic data. Figure 11 shows the distribution of polymorphic SSR markers used in the current research and their associated QTLs on chromosomes. In the current study, three polymorphic SSR markers (RM302 on Chromosome 1, RM7 on Chromosome 3, and RM410 on Chromosome 9) were linked to three QTLs responsible for days to heading identified in earlier studies. Cho et al. [38] discovered qDTH-9 QTL, and its location has been linked to the RM410 SSR map, which has a negative phenotypic effect. Moreover, the other two QTLs (qDTH-1 and dth3.2, which correspond to RM302 and RM7, respectively) had a positive phenotypic influence on days to heading [39,40]. Furthermore, RM7 was identified as a flanking marker for the QTL dth3.2 [40]. As a result, we can deduce that the variability of duration in the rice genotypes studied was due to the existence of multiple segments with varying effects.
The semi-dwarf phenotype is the most desired rice genetic characteristic. Several QTLs were identified as being linked with plant height. Two SSR markers (RM302 on Chromosome 1 and RM279 on Chromosome 2) were utilized in this work to identify two QTLs that reduce plant height (ph1.1 and Qph2). Moncada et al. [41] found that QTL ph1.1 corresponded to a semi-dwarf locus in other research. Likewise, the Qph2 was found to be an over-dominant QTL responsible for reducing rice plant height according to Mei et al. [42].
This study revealed a high polymorphism in two SSR markers (RM302 on Chromosome 1 and RM279 on Chromosome 2). Previous research found that the SSR marker RM302 was integrated into the identified qPN1 QTL, which controls panicle number per plant [43]. Furthermore, Tian et al. [44] discovered that the QTL qPN2, which includes the SSR marker RM279, has a favorable impact on the number of panicles per plant. Thus, it can explain the relatively significant variance in panicle number per plant seen in the current study’s genotypes.
The phenotypic data revealed that the examined genotypes differed significantly in 1000-grain weight. Similarly, polymorphism lines up with the phenotypic information of the same genotypes, according to the SSR marker RM302 (located on chromosome 1). Moncada et al. [41] found that the QTL gw1.2 explained the rise in 1000-grain weight, which was linked to RM302. In contrast, Hua et al. [45] found little heterosis for the QTL gw12, which was related to 1000-grain weight. In the current study, the SSR marker RM511 demonstrated monomorphism and was integrated into the QTL gw12. As a result, we may conclude that the variability in 1000-grain weight among rice genotypes tested may be attributable to the relationship with QTL gw1.2.
One of the most crucial characteristics of rice plants is the grain yield per plant; variations in this trait were seen among the genotypes under investigation. RM302 was the most polymorphic SSR marker utilized in this study among all the others. Moncada et al. [41] discovered that the QTL yld1.1 has an effect on improving yield per plant and indicated that prior research has produced similar results. The current study’s SSR marker was discovered to be related to the QTL yld1.1 identified by Moncada et al. [41], which could explain the increase in grain yield per plant for the genotypes under consideration.

5. Conclusions

The rice genotypes GZ12020-7-2-9-4, GZ12020-7-2-9-5, GZ12020-7-2-10-3, GZ12021-4-1-1-5, GZ12021-4-1-2-5, and GZ12021-13-14-22-2 outperformed Giza 178 in terms of yield and component, as well as earliness. During the genetic diversity analysis, five SSR markers were identified to be polymorphic, and genotypes were categorized into five clusters using SSR marker data. Based on the foregoing results, it is possible to deduce that yielding ability can be reached by selecting a higher number of panicles per plant, the number of filled grains per panicle, and the heaviest 1000-grain weight. These findings, together with further details, can be used to release novel and unique varieties with improved yield potential, hence improving rice production sustainability.

Author Contributions

Conceptualization, W.A.A., M.A.-S. and S.S.; Data curation, S.S., A.A.E., N.E.-R., I.A.R. and D.A.; Formal analysis, W.A.A., M.A.-S., A.A.E., N.E.-R., I.A.R. and D.A.; Methodology, W.A.A., M.A.-S., S.S., A.A.E., N.E.-R., I.A.R. and D.A.; Investigation, M.A.-S., S.S., A.A.E., N.E.-R., I.A.R. and D.A.; Resources, W.A.A., M.A.-S., S.S. and H.Z.R.; Software, M.A.-S., W.A.A., I.A.R. and D.A.; Validation, W.A.A., M.A.-S., S.S. and H.Z.R.; Visualization, M.A.-S., W.A.A., S.S. and H.Z.R.; Writing—original draft preparation, W.A.A., M.A.-S., S.S., A.A.E., N.E.-R., I.A.R. and D.A.; Writing—review and editing, W.A.A., M.A.-S., S.S., A.A.E., N.E.-R., I.A.R. and D.A.; Supervision, M.A.-S. and H.Z.R.; Funding acquisition, M.A.-S. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Researchers Supporting Project (number: RSPD2024R707), King Saud University, Riyadh, Saudi Arabia.

Data Availability Statement

Data are contained within the article.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. USDA. Rice Sector at a Lance. 2020. Available online: https://www.ers.usda.gov/topics/crops/rice/rice-sector-at-a-glance/ (accessed on 20 November 2024).
  2. Sedeek, S.E.; Aboyousef, M.I.; EL-Rafaee, I.S.; Abdallah, A.A.; Hammoud, S.A.; El-Malky, M.M.; EL-Namaky, R.A.; EL-Abd, A.B.; Ammar, M.H.; Abdelkhalik, A.F.; et al. Giza 183 Egyptian rice variety: A step to confront climate change challenges: International Conference of Field Crops Research Institute Egypt. J. Agric. Res. 2023, 101, 519–537. [Google Scholar] [CrossRef]
  3. Li, S.; Wu, F.; Zhou, Q.; Zhang, Y. Adopting agronomic strategies to enhance the adaptation of global rice production to future climate change: A meta-analysis. Agron. Sustain. Dev. 2024, 44, 23. [Google Scholar] [CrossRef]
  4. Bhandari, H.R.; Bhanu, A.N.; Srivastava, K.; Singh, M.N.; Shreya, H.A. Assessment of genetic diversity in crop plants—An overview. Adv. Plants Agric. Res. 2017, 7, 279–286. [Google Scholar] [CrossRef]
  5. Wang, T.; He, W.; Li, X.; Zhang, C.; He, H.; Yuan, Q.; Zhang, B.; Zhang, H.; Leng, Y.; Wei, H.; et al. A rice variation map derived from 10 548 rice accessions reveals the importance of rare variants. Nucleic Acids Res. 2023, 51, 10924–10933. [Google Scholar] [CrossRef]
  6. Zheng, X.; Zhong, L.; Pang, H.; Wen, S.; Li, F.; Lou, D.; Ge, J.; Fan, W.; Wang, T.; Han, Z.; et al. Lost genome segments associate with trait diversity during rice domestication. BMC Biol. 2023, 21, 20. [Google Scholar] [CrossRef]
  7. Rabara, R.C.; Ferrer, M.C.; Diaz, C.L.; Newingham, M.C.V.; Romero, G.O. Phenotypic Diversity of Farmers’ Traditional Rice Varieties in the Philippines. Agronomy 2014, 4, 217–241. [Google Scholar] [CrossRef]
  8. Sedeek, S.E.M.; Mazal, T.M.; Osman, M.M.A.; Hefeina, A.G.; EL-Kallawy, W.H.; Bleih, E.M. Genetic Diversity Among Some of Rice Genotypes Under Water Shortage. J. Plant Prod. 2022, 13, 929–936. [Google Scholar] [CrossRef]
  9. Ata-Ul-Karim, S.T.; Begum, H.; Lopena, V.; Borromeo, T.; Virk, P.; Hernandez, J.E.; Gregorio, G.B.; Collard, B.C.Y.; Kato, Y. Genotypic variation of yield-related traits in an irrigated rice breeding program for tropical Asia. Crop Environ. 2022, 1, 173–181. [Google Scholar] [CrossRef]
  10. Demeke, B.; Dejene, T.; Abebe, D. Genetic variability, heritability, and genetic advance of morphological, yield related and quality traits in upland rice (Oryza Sativa L.) genotypes at pawe, northwestern Ethiopia. Cogent Food Agric. 2023, 9, 2157099. [Google Scholar] [CrossRef]
  11. Awad-Allah, M.M.A.; Shafie, W.W.M.; Alsubeie, M.S.; Alatawi, A.; Safhi, F.A.; ALshamrani, S.M.; Albalawi, D.A.; Al-Amrah, H.; Alshehri, D.; Alshegaihi, R.M.; et al. Utilization of Genetic Resources, Genetic Diversity and Genetic Variability for Selecting New Restorer Lines of Rice (Oryza sativa L.). Genes 2022, 13, 2227. [Google Scholar] [CrossRef]
  12. Debsharma, S.K.; Syed, M.A.; Ali, M.H.; Maniruzzaman, S.; Roy, P.R.; Brestic, M.; Gaber, A.; Hossain, A. Harnessing on Genetic Variability and Diversity of Rice (Oryza sativa L.) Genotypes Based on Quantitative and Qualitative Traits for Desirable Crossing Materials. Genes 2023, 14, 10. [Google Scholar] [CrossRef] [PubMed]
  13. Faysal, A.S.M.; Ali, L.; Azam, M.G.; Sarker, U.; Ercisli, S.; Golokhvast, K.S.; Marc, R.A. Genetic Variability, Character Association, and Path Coefficient Analysis in Transplant Aman Rice Genotypes. Plants 2022, 11, 2952. [Google Scholar] [CrossRef] [PubMed]
  14. Gunasekaran, A.; Seshadri, G.; Ramasamy, S.; Muthurajan, R.; Karuppasamy, K.S. Identification of Newer Stable Genetic Sources for High Grain Number per Panicle and Understanding the Gene Action for Important Panicle Traits in Rice. Plants 2023, 12, 250. [Google Scholar] [CrossRef]
  15. Khan, M.A.R.; Mahmud, A.; Ghosh, U.K.; Hossain, M.S.; Siddiqui, M.N.; Islam, A.K.M.A.; Anik, T.R.; Rahman, M.M.; Sharma, A.; Abdelrahman, M.; et al. Exploring the Phenotypic and Genetic Variabilities in Yield and Yield-Related Traits of the Diallel-Crossed F5 Population of Aus Rice. Plants 2023, 12, 3601. [Google Scholar] [CrossRef]
  16. Saleh, M.M.; Salem, K.F.M.; Elabd, A.B. Definition of selection criterion using correlation and path coefficient analysis in rice (Oryza sativa L.) genotypes. Bull. Natl. Res. Cent. 2020, 44, 143. [Google Scholar] [CrossRef]
  17. Moukoumbi, Y.D.; Bayendi Loudit, S.M.; Sikirou, M.; Mboj, D.; Hussain, T.; Bocco, R.; Manneh, B. Evaluation of Genotypic Variability and Analysis of Yield and Its Components in Irrigated Rice to Stabilize Yields in the Senegal River Valley Affected by Climate Change. Agronomy 2023, 13, 2218. [Google Scholar] [CrossRef]
  18. IRRI. International Rice Research Institute Descriptors for Rice; SES Standard evaluation system for Rice Los Banos: Laguna, Philippines, 2002; 56p. [Google Scholar]
  19. Snedecor, G.W.; Cochran, W.G. Statistical Methods, 7th ed.; The Iowa State University Press: Ames, IA, USA, 1990; p. 593. [Google Scholar]
  20. Bartlett, M.S. Properties of sufficiency and statistical tests. Proc. R. Soc. Lond. Ser. A Math. Phys. Sci. 1937, 160, 268–282. [Google Scholar]
  21. Burton, G.W. Quantitative inheritance in Pearl millet (Pennisetum glaucum). Agron. J. 1951, 43, 409–417. [Google Scholar] [CrossRef]
  22. Johnson, H.W.; Robinson, H.F.; Comstock, R.E. Estimates of genetic and environmental variability in soybean. Agron. J. 1955, 47, 314–318. [Google Scholar] [CrossRef]
  23. Sivasubramanian, S.; Madhavamenon, P. Genotypic variability in rice. Madras Agric. J. 1973, 60, 1093–1096. [Google Scholar]
  24. Burton, G.; De vane, E. Estimating heritability in tall Fescue (Festuca arundinacea) from replicated Clonal material. Agron. J. 1953, 45, 478–481. [Google Scholar] [CrossRef]
  25. Gomez, K.A.; Gomez, A. Statistical Procedures for Agricultural Research, 1st ed.; Willey & Sons: New York, NY, USA, 1984. [Google Scholar]
  26. Weaver, B.; Wuensch, K.L. SPSS and SAS programs for comparing pearson correlations and OLS regression coefficients. Behav. Res. Methods 2013, 45, 880–895. [Google Scholar] [CrossRef] [PubMed]
  27. Murray, M.G.; Thompson, W.F. Rapid isolation of high molecular weight plant DNA. Nucleic Acids Res. 1980, 8, 4321–4326. [Google Scholar] [CrossRef] [PubMed]
  28. Rohlf, F.J. NTSYSpc Numeric Taxonomy and Multivariate Analysis System, Version 2.1; Exeter Publications: New York, NY, USA, 2000. [Google Scholar]
  29. Anderson, J.A.; Churchill, G.A.; Autrique, J.E.; Tanksley, S.D.; Sorrells, M.E. Optimizing parental selection for genetic linkage maps. Genome 1993, 36, 181–186. [Google Scholar] [CrossRef]
  30. FAO. Faostat Data. Available online: https://www.fao.org/faostat/en/#compare (accessed on 12 January 2023).
  31. USDA. Nathan Childs and Bonnie LeBeau, Rice Outlook: November 2022, RCS-22J; U.S. Department of Agriculture, Economic Research Service: Washington, DC, USA, 2022.
  32. Sedeek, S.E.M.; Hammoud, S.A.A.; Ammar, M.H.; Metwally, T.F. Genetic variability, heritability, genetic advance and cluster analysis for some physiological traits and yield and its components in rice (Oryza sativa L.). J. Agric. Res. Kafer EL-Sheikh Univ. 2009, 35, 858–878. [Google Scholar]
  33. Kumar, R.; Kaushal, S.; Shukla, Y.R. Variability, Correlation, and Path Analysis Studies in Lettuce. Int. J. Veg. Sci. 2010, 16, 299–315. [Google Scholar] [CrossRef]
  34. Pratap, A.; Bisen, P.; Lotongbam, B.; Sandhya; Singh, P.K. Assessment of genetic variability for yield and yield components in rice (Oryza sativa L.) germplasms. Int. J. Bio-Resour. Stress Manag. 2018, 9, 87–92. [Google Scholar] [CrossRef]
  35. Dhakal, A.; Sharma, S.; Pokhrel, A.; Poudel, A. Variability and heritability estimate of 30 rice landraces of lamjung and Tanahun districts, Nepal. Indones. J. Agric. Sci. 2020, 21, 1–10. [Google Scholar] [CrossRef]
  36. Nayak, A.R.; Chaudhury, D.; Reddy, J.N. Correlation and path analysis in scented rice. Indian J. Agric. Res. 2001, 35, 186–189. [Google Scholar]
  37. Nayak, A.R.; Reddy, J.N. Seasonal influence on quality characters in scented rice. Indian J. Genet. Plant Breed. 2005, 65, 127–128. [Google Scholar]
  38. Cho, Y.C.; Suh, J.P.; Choi, I.S.; Hong, H.C.; Baek, M.K.; Kang, K.H.; Kim, Y.G.; Ahn, S.N.; Choi, H.C.; Hwang, H.G.; et al. QTLs analysis of yield and its related traits in wild rice relative Oryza rufipogon. Treat. Crop Res. 2003, 4, 19–29. [Google Scholar]
  39. Suh, J.P.; Ahn, S.N.; Cho, Y.C.; Kang, K.H.; Choi, I.S.; Kim, Y.G.; Suh, H.S.; Hong, H.C. Mapping of QTLs for yield traits using an advanced backcross population from a cross between Oryza sativa and O. glaberrima. Korean J. Breed. 2005, 37, 214–220. [Google Scholar]
  40. Thomson, M.J.; Tai, T.H.; McClung, A.M.; Lai, X.-H.; Hinga, M.E.; Lobos, K.B.; Xu, Y.; Martinez, C.P.; McCouch, S.R. Mapping quantitative trait loci for yield, yield components and morphological traits in an advanced backcross population between Oryza rufipogon and the Oryza sativa cultivar Jefferson. Theor. Appl. Genet. 2003, 107, 479–493. [Google Scholar] [CrossRef]
  41. Moncada, P.; Martínez, C.; Borrero, J.; Chatel, M.; Gauch, H., Jr.; Guimaraes, E.; Tohme, J.; McCouch, S.R. Quantitative trait loci for yield and yield components in an Oryza sativa×Oryza rufipogon BC2F2 population evaluated in an upland environment. Theor. Appl. Genet. 2001, 102, 41–52. [Google Scholar] [CrossRef]
  42. Mei, H.W.; Li, Z.K.; Shu, Q.Y.; Guo, L.B.; Wang, Y.P.; Yu, X.Q.; Ying, C.S.; Luo, L.J. Gene actions of QTLs affecting several agronomic traits resolved in a recombinant inbred rice population and two backcross populations. Theor. Appl. Genet. 2005, 110, 649–659. [Google Scholar] [CrossRef]
  43. Lafitte, H.R.; Courtois, B.; Arraudeau, M. Genetic improvement of rice in aerobic systems: Progress from yield to genes. Field-Crops-Res. 2002, 75, 171–190. [Google Scholar] [CrossRef]
  44. Tian, F.; Li, D.J.; Fu, Q.; Zhu, Z.F.; Fu, Y.C.; Wang, X.K.; Sun, C.Q. Construction of introgression lines carrying wild rice (Oryza rufipogon Griff.) segments in cultivated rice (Oryza sativa L.) background and characterization of introgressed segments associated with yield-related traits. Theor. Appl. Genet. 2006, 112, 570–580. [Google Scholar] [CrossRef]
  45. Hua, J.; Xing, Y.; Wu, W.; Xu, C.; Sun, X.; Yu, S.; Zhang, Q. Single-locus heterotic effects and dominance by dominance interactions can adequately explain the genetic basis of heterosis in an elite rice hybrid. Proc. Natl. Acad. Sci. USA 2003, 100, 2574–2579. [Google Scholar] [CrossRef]
Figure 1. Duration (days) during 2023 and 2024.
Figure 1. Duration (days) during 2023 and 2024.
Agronomy 14 02775 g001
Figure 2. Plant height (cm) during 2023 and 2024.
Figure 2. Plant height (cm) during 2023 and 2024.
Agronomy 14 02775 g002
Figure 3. No. of panicles/plant during 2023 and 2024.
Figure 3. No. of panicles/plant during 2023 and 2024.
Agronomy 14 02775 g003
Figure 4. Panicle length (cm) during 2023 and 2024.
Figure 4. Panicle length (cm) during 2023 and 2024.
Agronomy 14 02775 g004
Figure 5. No of filled grains/plant during 2023 and 2024.
Figure 5. No of filled grains/plant during 2023 and 2024.
Agronomy 14 02775 g005
Figure 6. No. of unfilled grains/panicle during 2023 and 2024.
Figure 6. No. of unfilled grains/panicle during 2023 and 2024.
Agronomy 14 02775 g006
Figure 7. The 1000-grain weights (g) during 2023 and 2024.
Figure 7. The 1000-grain weights (g) during 2023 and 2024.
Agronomy 14 02775 g007
Figure 8. Grain yield (t/h) during 2023 and 2024.
Figure 8. Grain yield (t/h) during 2023 and 2024.
Agronomy 14 02775 g008
Figure 9. Agarose gels stained with ethidium bromide showing genetic polymorphism among 16 rice (Oryza sativa L.) genotypes using SSR primers (RM302 and RM279).
Figure 9. Agarose gels stained with ethidium bromide showing genetic polymorphism among 16 rice (Oryza sativa L.) genotypes using SSR primers (RM302 and RM279).
Agronomy 14 02775 g009
Figure 10. Dendrogram depicting the genetic relationship among 16 genotypes of rice based on SSR data using UPGMA.
Figure 10. Dendrogram depicting the genetic relationship among 16 genotypes of rice based on SSR data using UPGMA.
Agronomy 14 02775 g010
Figure 11. Distribution of polymorphic SSR markers and their associated QTLs on chromosomes.
Figure 11. Distribution of polymorphic SSR markers and their associated QTLs on chromosomes.
Agronomy 14 02775 g011
Table 1. The pedigree and group type of these varieties.
Table 1. The pedigree and group type of these varieties.
VarietyPedigreeType
Giza 178Giza 175/Milyang 49Indica/Japonica
GZ12020-7-2-7-1Giza 178/GZ1368-S-5-4Indica/Japonica
GZ12020-7-2-7-4Giza 178/GZ1368-S-5-4Indica/Japonica
GZ12020-7-2-9-4Giza 178/GZ1368-S-5-4Indica/Japonica
GZ12020-7-2-9-5Giza 178/GZ1368-S-5-4Indica/Japonica
GZ12020-7-2-10-3Giza 178/GZ1368-S-5-4Indica/Japonica
GZ1368-S-5-4IR1615/BY 94Indica/Japonica
GZ12021-4-1-1-5Giza 178/GZ6296-12-1-2-1-1Indica/Japonica
GZ12021-4-1-1-6Giza 178/GZ6296-12-1-2-1-1Indica/Japonica
GZ12021-4-1-2-5Giza 178/GZ6296-12-1-2-1-1Indica/Japonica
GZ12021-4-1-3-2Giza 178/GZ6296-12-1-2-1-1Indica/Japonica
GZ12021-7-8-13-4Giza 178/GZ6296-12-1-2-1-1Indica/Japonica
GZ12021-7-8-14-2Giza 178/GZ6296-12-1-2-1-1Indica/Japonica
GZ12021-13-14-22-2Giza 178/GZ6296-12-1-2-1-1Indica/Japonica
GZ12021-13-14-22-5Giza 178/GZ6296-12-1-2-1-1Indica/Japonica
GZ6296-12-1-2-1-1AC1225/Hua lien Yu 202Indica/Japonica
Table 2. List of polymorphic SSR markers.
Table 2. List of polymorphic SSR markers.
MarkerCh.ForwardReverse
RM3021tcatgtcatctaccatcacacatggagaagatggaatacttgc
RM2792gcgggagagggatctcctggctaggagttaacctcgcg
RM73ttcgccatgaagtctctcgcctcccatcatttcgttgtt
RM4109gctcaacgtttcgttcctggaagatgcgtaaagtgaacgg
RM51112cttcgatccggtgacgacaacgaaagcgaagctgtctc
Table 3. Ranking for genotypes on the basis of all characteristics.
Table 3. Ranking for genotypes on the basis of all characteristics.
GenotypesDUPHNPPPLFGPUFGPGWGYRank
Giza 178151357121015582
GZ12020-7-2-10-3514131352447
GZ12020-7-2-7-11211116913131590
GZ12020-7-2-7-4115857914867
GZ12020-7-2-9-441024324332
GZ12020-7-2-9-56968845753
GZ1368-S-5-413479111101166
GZ12021-13-14-22-214154261516678
GZ12021-13-14-22-516163117121470
GZ12021-4-1-1-51610152141150
GZ12021-4-1-1-687916101671285
GZ12021-4-1-2-5931311466254
GZ12021-4-1-3-21021413589970
GZ12021-7-8-13-428161415381379
GZ12021-7-8-14-23121512141231081
GZ6296-12-1-2-1-17112101611111684
DU: Duration; PH: Plant height; NPP: Number of panicles/plant; PL: Panicle length; FGP: Number of filled grains/plant; UFGP: Number of unfilled grains/plant; GW: 1000-grain weight; GY: Grain yield (t/h).
Table 4. Estimates of phenotypic and genotypic coefficients of variability, heritability, and genetic advancement for studied traits of 14 rice genotypes in 2023.
Table 4. Estimates of phenotypic and genotypic coefficients of variability, heritability, and genetic advancement for studied traits of 14 rice genotypes in 2023.
TraitGran MeanGVPVGCVPCVh2GA%
Duration126.8818.1818.853.363.4296.437.45
Plant height99.0836.2936.836.086.1398.574.73
No. of panicles22.524.344.999.259.9286.98.93
Panicle length22.811.541.665.445.6492.713.16
No. of filled grains154.65701.08710.8617.1217.2498.61443.8
No. of unfilled grain11.4275.2277.4375.9477.0597.1154.8
1000-grain weight24.744.294.498.378.5695.59.20
Grain yield9.760.9160.9309.809.8898.41.88
GV = genotypic variance; PV = phenotypic variance; GCV = genotypic coefficient of variability; PCV = phenotypic coefficient of variability; h2 = broad-sense heritability; and GA% = genetic advance %.
Table 5. Estimates of phenotypic and genotypic coefficients of variability, heritability, and genetic advance for studied traits of 14 rice genotypes in 2024.
Table 5. Estimates of phenotypic and genotypic coefficients of variability, heritability, and genetic advance for studied traits of 14 rice genotypes in 2024.
TraitGran MeanGVPVGCVPCVh2GA%
Duration128.316.9817.693.213.2795.934.97
Plant height95.617.5318.394.374.4895.336.11
No. of panicles22.953.854.368.549.0988.37.93
Panicle length21.601.281.425.235.5290.02.63
No. of filled grains137.75330.12342.4813.1813.4396.4680.1
No. of unfilled grain14.4582.0984.2962.7063.5397.3168.94
1000-grain weight27.16.056.309.079.2696.012.45
Grain yield10.00.470.482.186.9997.70.98
GV = genotypic variance; PV = phenotypic variance; GCV = genotypic coefficient of variability; PCV = phenotypic coefficient of variability; h2 = broad-sense heritability; and GA% = genetic advance %.
Table 6. Correlation coefficients among the studied traits in the 2023 rice season.
Table 6. Correlation coefficients among the studied traits in the 2023 rice season.
DurationPlant HeightNo. of PaniclesPanicle LengthNo. of Filled GrainsNo. of Unfilled Grain1000-Grain WeightGrain Yield
Duration10.2740.3040.4100.56−0.77−0.593 *−0.30
Plant height 10.4100.585 *0.035−0.281−0.0590.353
No. of panicles 10.588 *0.301−0.116−0.1930.572 *
Panicle length 10.317−0.266−0.611 *0.225
No. of filled grains 1−0.278−0.950.590 *
No. of unfilled grain 1−0.178−0.372
1000-grain weight 10.570 *
Grain yield 1
* significant at the 0.05 level.
Table 7. Correlation coefficients among the studied traits in the 2024 rice season.
Table 7. Correlation coefficients among the studied traits in the 2024 rice season.
DurationPlant HeightNo. of PaniclesPanicle LengthNo. of Filled GrainsNo. of Unfilled Grain1000-Grain WeightGrain Yield
Duration10.2310.4370.576 *0.1650.045−0.705 **−0.238
Plant height 10.1650.3040.644 **0.476−0.0480.101
No. of panicles 10.4700.2590.250−0.1520.571 *
Panicle length 10.145−0.109−0.624 *−0.270
No. of filled grains 10.3630.0910.580 *
No. of unfilled grain 1−0.1220.205
1000-grain weight 10.540 *
Grain yield 1
* significant at the 0.05 level. ** significant at the 0.01 level
Table 8. Polymorphic Information Content (PIC) for SSR loci across 16 selected rice genotypes.
Table 8. Polymorphic Information Content (PIC) for SSR loci across 16 selected rice genotypes.
MarkerCh.Number of AllelesPIC
RM5111210.499
RM302120.374
RM410930.400
RM279230.383
RM7320.374
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Almasoud, W.A.; Abdel-Sattar, M.; Sedeek, S.; Elgammaal, A.A.; El-Refaee, N.; Ramadan, I.A.; Abdulmajid, D.; Rihan, H.Z. The Path Towards Novel Varieties: Investigating Phenotypic-Genetic Diversity in New Promising Egyptian Rice Lines. Agronomy 2024, 14, 2775. https://doi.org/10.3390/agronomy14122775

AMA Style

Almasoud WA, Abdel-Sattar M, Sedeek S, Elgammaal AA, El-Refaee N, Ramadan IA, Abdulmajid D, Rihan HZ. The Path Towards Novel Varieties: Investigating Phenotypic-Genetic Diversity in New Promising Egyptian Rice Lines. Agronomy. 2024; 14(12):2775. https://doi.org/10.3390/agronomy14122775

Chicago/Turabian Style

Almasoud, Waleed A., Mahmoud Abdel-Sattar, Saber Sedeek, Amgad A. Elgammaal, Nouran El-Refaee, Ibrahem A. Ramadan, Dina Abdulmajid, and Hail Z. Rihan. 2024. "The Path Towards Novel Varieties: Investigating Phenotypic-Genetic Diversity in New Promising Egyptian Rice Lines" Agronomy 14, no. 12: 2775. https://doi.org/10.3390/agronomy14122775

APA Style

Almasoud, W. A., Abdel-Sattar, M., Sedeek, S., Elgammaal, A. A., El-Refaee, N., Ramadan, I. A., Abdulmajid, D., & Rihan, H. Z. (2024). The Path Towards Novel Varieties: Investigating Phenotypic-Genetic Diversity in New Promising Egyptian Rice Lines. Agronomy, 14(12), 2775. https://doi.org/10.3390/agronomy14122775

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop